Abstract
Achromobacter xylosoxidans strain A22732 is isolated from a pneumonia patient in China and produces carbapenemases OXA-114e and IMP-1, which are encoded by chromosome and plasmid, respectively and confer resistance to multiple ß-lactam antibiotics including carbapenems. The blaIMP-1 gene together with aacA7 and orfE is captured by a novel Tn402-like class 1 integron in a conjugative IncP-1ß plasmid. In addition to the intrinsic integron promoter PcW, there is still a blaIMP-1 gene cassette-specific promoter. This is the first report of carbapenemase-encoding IncP-1ß plasmid in clinical bacterial isolate.
Similar content being viewed by others
Introduction
Achromobacter xylosoxidans is a Gram-negative, motile bacterium from the Achromobacter genus of the Alcaligenaceae family and frequently found in water environments and can also cause opportunistic infections especially in immunocompromised patients.
A. xylosoxidans expresses a chromosomally encoded intrinsic carbapenemase OXA-114 (Ambler class D) in a constitutive manner1 with at least 22 variants OXA-114a to OXA-114v (http://www.ncbi.nlm.nih.gov/nuccore/, last accessed May 9, 2014) and PCR detection of blaOXA-114 genes has been established for species identification of this bacterium2.
The IMP-type metallo-carbapenemases (class B) are composed of at least 48 variants IMP-1 to IMP-48 (http://www.lahey.org/studies/, last accessed May 9, 2014) and they are found in many clinical Gram-negative bacteria including Pseudomonas spp., Acinetobacter spp. and members of the Enterobacteriaceae family3. At least three IMP variants, namely IMP-1 and IMP-194 and IMP-105, have been detected in A. xylosoxidans isolates from Japan; all of these blaIMP-1 genes are carried on plasmid-borne class 1 integrons, but the complete nucleotide sequences of these IMP-encoding plasmids are not determined.
The present study describes the complete nucleotide sequence of a conjugative IncP-1ß plasmid from a clinical A. xylosoxidans isolate from China, carrying a novel Tn402-like class 1 integron that includes the blaIMP-1 gene cassette.
Results and Discussion
A. xylosoxidans strain A22732 harboring a conjugative IMP-encoding plasmid
In September 2010, an 86-year-old male was admitted to our hospital and diagnosed to have pneumonia and sputum specimens were sampled on the same day. The next day, bacterial growth was observed after cultivation of sputum on Mueller-Hinton agar and the bacterial isolate designated A22732 was identified as A. xylosoxidans by VITEK 2, Bruker MALDI Biotyper and 16s rRNA gene sequencing. The antimicrobial susceptibility test using VITEK 2 indicated A22732 was resistant to multiple β-lactam antibiotics including imipenem and meropenem but remained susceptible to fluoroquinolones and the patient then received intravenous administration with moxifloxacin hydrochloride and he was cured after ten days of antimicrobial treatment.
Positive PCR amplification of two carbapenemase genes blaIMP and blaOXA-114 was observed for strain A22732, which was further validated by PCR amplicon sequencing, but all the remaining known carbapenemase and extended spectrum ß-lactamase (ESBL) genes tested gave negative PCR results. The whole gene amplification/sequencing indicated the presence of intact blaOXA-114e gene in A22732. A blaIMP-positive and blaOXA-114-negative E. coli transconjugant, designated A22732-IMP-EC600, was obtained by conjugal transfer, indicating that A22732 harbored a conjugative IMP-encoding plasmid, which was designated pA22732-IMP. As determined by a modified CarbaNP test6, strain 22732-IMP-EC600 had class B carbapenemase activity, while A22732 probably expressed class B/D carbapenemases (Fig S1), being consistent with the above PCR/sequencing results.
The minimum inhibitory concentration (MIC) values (Table 1) were determined for A22732, 22732-IMP-EC600 and EC600. A22732 and 22732-IMP-EC600 show almost identical drug resistance profiles. These two strains are highly resistant to penicillins, aztreonam and ephalosporins tested, but they remain susceptible to the fluoroquinolone, furane, aminoglycoside and sulfanilamide drugs tested. Both A22732 and 22732-IMP-EC600 are resistant to imipenem and meropenem, but the MIC values of imipenem and meropenem (both > = 16) against A22732 are much higher than those (4 and 2, respectively) against 22732-IMP-EC600, which is consistent with the fact that A22732 expresses two different arbapenemase IMP-1 and OXA-114e while 22732-IMP-EC600 produces only a single one IMP-1.
IncP-1ß plasmid pA22732-IMP
The complete nucleotide sequence of pA22732-IMP was determined by a next-generation sequencing approach with a 160-fold coverage. pA22732-IMP has a circular DNA sequence of 49,804-bp with a total of 60 complete genes annotated and an average G+C content of 65.07 (Fig 1). The backbone of pA22732-IMP is composed of DNA regions for plasmid replication (ssb and trfA), partition (parA), stable inheritance and central control (the ctl region: kluB to kfrA), conjugal transfer (trbA to trbP, and traO to traC) and unknown functions (upf30.5 and upf31.0) (Fig 1), which show >99% identity to the corresponding regions of a set of IncP-1ß broad-host-range plasmids R751, pB3, pAKD1, pTP6, pADP1, pAMMD1, pB8, pUO1, pAKD15, pAKD17, pB10, pAKD14, pAKD29, pAKD18, pAKD33, pAKD31 and pJP47. The pA22732-IMP backbone of 41,970-bp has a G+C content of 66.04, while the remaining accessory modules have a lower G+C content of 59.85, indicating distinct origins of backbone and accessory elements (Fig 1).
Schematic maps of plasmid pA22732-IMP.
Genes are denoted by arrows and colored based on gene function classification. The innermost circle presents GC-Skew [(G-C)/(G+C)] with a window size of 500-bp and a step size of 20-bp. The blue circle presents GC content. Shown also are backbone (orange) and accessory module (yellow) regions of pA22732-IMP.
The entire pA22732-IMP sequence had >70% query cover and >80% identity with the above IncP-1ß plasmids. pA22732-IMP was aligned with four representative plasmids R751 (accession number U67194)8, pB109 (AJ564903), pB8 (AJ863570)10 and pAKD31 (JQ436721)11 through pairwise whole plasmid sequence comparison (Fig 2). R751 is from a clinical Enterobacter aerogenes isolate and represents the prototype IncP-1β drug-resistance plasmid, pB10 is isolated from a bacterial community residing in activated sludge compartment of a waste-water treatment plant and pB8 and pAKD31 are from agricultural soil bacteria. The above IncP-1ß plasmids were selected for further analyses, because they harbored different forms of Tn501-like or Tn402-like elements (see below).
The backbone regions are highly conserved in pA22732-IMP, R751, pB10, pB8 and pAKD31. All the former four plasmids harbor two accessory modules, namely Tn501-like element and Tn402-like integron, each of which has different gene organizations among these four plasmids (Fig 2). The above two accessory modules are inserted into downstream of trfA and that of traC2, respectively, which are the targeting locations typically interrupted by mobile elements in IncP-1β plasmids. By contrast, only Tn501-like element rather than Tn402-like integron is found in the corresponding region of pAKD31(Fig 2).
Tn501-like elements
Tn501-like transposon insertions, which often harbor the mer loci conferring mercuric chloride resistance, are frequently found in IncP-1ß plasmids from agricultural soils7,9,10,12. The ancestral Tn501-like mer locus (Fig 3) contains the Tn501 transposition genes tnpA (transposase) and tnpR (resolvase), the mercury-resistance genes merR (repressor of mer locus), merT (integral membrane protein for mercuric transport), merP (periplasmic mercury ion-binding protein), merA (mercuric reductase), merD (co-regulator protein), merE (integral membrane protein for mercuric transport) and orf2 (EAL-domain-containing protein) and the 38-bp terminal inverted repeats (left terminal inverted repeat IRi and right terminal repeat IRt)7.
Tn501-like loci can be identified in all the above five plasmids (Fig 3). The Tn501-like element of pB10 is flanked by a 5-bp target site (direct repeats of TGCCT), but those of all the other four plasmids leave no trace of insertion.
pB10 harbors an greatly extended Tn501-like mer locus, because tnpA is interrupted by IS1071 (which is further interrupted by Tn1721-like tetracycline-resistance locus) plus a Tn5393c-like streptomycin resistance locus, thereby leading to partial deletion of tnpA. Loss of IRi and tnpAR as well as 3'-terminus deletion of orf2, because of insertion of IS1071 plus IS21 into orf2, is observed for the Tn501-like mer locus of pAKD31. The Tn501-like mer locus of pA22732-IMP has undergone loss of IRi, tnpAR and orf2 as well as an inversion event of the whole locus.
Both R751 and pB8 carry a ‘cryptic’ Tn501-like element, which is composed of IRi, orf1, orf2, a merR remnant and IRt in the absence of all the other features identified for the ancestral Tn501-like mer locus. In addition, R751 has acquired two copies of IS4321 (IS4321L and IS4321R), which flank the merR remnant and orf2, respectively. By contrast, evolution of pB8 involves insertion of a Tn501-like quaternary ammonium compound resistance (qacF) locus into orf2, thereby disrupting this gene.
Tn402-like integrons
Tn402 is bound by 25-bp IRi and IRt10,13 and acts as the primary carrier element of class 1integrons14,15,16,17. Tn402-like class 1 integrons are indentified in pB8, pA22732-IMP, R751 and pB10, but not pAKD31 (Fig 4a). The pB8 integron is a typical class 1 integron integron that, from 5′ to 3′ side, harbors 5′-conserved segment (CS)-specific integrase gene intI1, resistance gene cassettes blaOXA-2 (class D ß-lactamase OXA-2) and aadA4 (spectinomycin/streptomycin resistance), 3′-CS-specific gene cluster qacEΔ1-sul1-orf5 and Tn402 transposition genes tniAB10. The pA22732-IMP integron contains intI1, aacA7 (gentamicin/amikacin resistance), orfE, blaIMP-1 and truncated tniA, being atypical due to lack of 3′-CS. Notably, 3′-CS-lacking integrons have been already observed in many cases16,18,19. The R751 integron contains dhfrIIc (trimethoprim resistance), orfD, truncated qacE and complete Tn402 transposition module tniABQC13.The pB10 integron harbors intI1, blaOXA-2, orfE and qacEΔ1-sul1-orf59.
At least three key steps (Fig S2) are involved in evolution of Tn402-like class 1 integrons14,15,16,17: step I, insertion of ancestor class 1 integron (lack of 3′- CS) into Tn402 (harboring complete tniABQC transposition module) to generate a hybrid structure, combining the ability of integron to capture environmental gene cassettes to the mobility of Tn402 into plasmids and other genetic platforms, which might occur prior to or concomitant with antibiotic era including capture of qacE (quaternary ammonium compound resistance); step II, capture of sul1 (sulfonamide resistance) and orf5 and then formation of 3′-CS due to deletion events between qacE and sul1; step III, deletion events within tniABQR, making Tn402 transposition incompetent.
The pB8 and pB10 integrons, each of which contain 5′-CS, drug resistance gene cassettes, 3′-CS and completely or partially truncated tni module, appear to undergone all the above three steps of evolution. By contrast, the evolution step II (generation of 3′-CS) is mostly likely omitted for the pA22732-IMP integron, while the R751 integron might represent a primitive Tn402-like integron due to absence of evolution steps II and III (truncation of tni module).
The Tn402-like integron of pA22732-IMP is inserted into the traC-parA intergenic region, leaving parA and its downstream gene upf31.0 intact. The parA upstream or around region represents a hot spot for Tn402 targeting, most likely due to it contains the multimer resolution site II for recognition by Tn402 transposase20,21. Interestingly, the insertion of Tn402-like integrons into the hotspot target region leads to further deletion of parA from pB8 and R751 and that of parA/upf31.0 from pB10.
The pA22732-IMP, R751 and pB8 integrons contains IRi and IRt of Tn402, but only IRi rather than IRt is identified for pB10. The lack of IRt in pB10 might due to the above-mentioned deletion removing of parA/upf31.0. The 5-bp target site (direct repeats of AGCAT) is still intact to flank the pA22732-IMP integron, but all the other three integrons do not leave traces of insertion.
Integrase IntI1 recognizes two different types of recombination site attI1 (integron attachment site) and attC (recognition site for integrase) and it catalyzes integration or excision of gene cassettes through site-specific recombination commonly between one attI1 site and one or more attC sites22,23. One attI1 site and three attC sites, upstream of aacA7, orfE, blaIMP-1 and tniA, respectively, are indentified in the pA22732-IMP integron (Fig 4a). These sites are long inverted-repeat-containing sequences of variable length and sequence and each inverted repeat begins with a core sequence RYYYAAC and ends with an inverted core sequence GTTRRRY as described previously24,25, which would form imperfect cruciform structures and be required for capture of aacA7, orfE and blaIMP-1.
Expression of integron gene cassettes
The pA22732-IMP integron gene cassettes aacA7, orfE and blaIMP-1, but not intI1 and tniA, are organized in the same transcriptional direction (Fig 5a). PCR generates an amplicon ranged from 5′-untranslated region (5′-UTR) of aacA7 to 5′-terminal of the blaIMP-1 coding region, when using A22732 genomic DNA as template (Fig 5a). The positive RT-PCR amplification with the same primer pair, using cDNA sample generated from A22732 total RNA as template (Fig 5b), indicates that aacA7, orfE and blaIMP-1 are transcribed into a single RNA transcript and thereby, these three genes constitutes a single operon aacA7-orfE-blaIMP-1 (Fig 5a).
Organization and expression of integron gene cassettes.
a) Operon structure. Boxed arrows stand for length/direction of indicated genes. The two broken-line arrows represent primary RNA transcripts transcribed for the aacA7-orfE-blaIMP-1 operon and the blaIMP-1 gene, respectively. Line with filled circles at both termini indicates location of primer pair plus expected PCR amplicon. b) PCR and RT-PCR. cDNAs generated from total RNA of strain A22732 and genomic DNA of A22732 were used as templates for RT-PCR and PCR, respectively. c) Primer extension. Primer extension assay of the RNA transcript of aacA7 or blaIMP-1 was done for A22732 cultured with addition of increasing amounts of imipenem. Lanes C, T, A and G represent Sanger sequencing reactions. The transcription start of aacA7 or blaIMP-1is indicated by the arrow with nucleotide T or G, respectively and the minus number under arrow indicate the nucleotide position upstream of the aacA7 or blaIMP-1 start codon. Representative data from at least two independent biological replicates are shown.
Integrons act as natural gene expression platforms due to the presence of an intrinsic promoter (Pc) that is recognized by RNA polymerase to drive transcription of inserted gene cassettes that generally do not have their own promoters. At least eight distinct types of Pc promoter, PcS (strong, TTGACA-N17-TAAACT), PcW (weak, TGGACA-N17-TAAGCT), PcH1 (hybrid 1, TGGACA-N17-TAAACT), PcH2 (Hybrid 2, TTGACA-N17-TAAGCT), PcSS (super-strong, TTGATA-N17-TAAACT), PcIn42 (TTGGCA-N17-TAAACT), PcIn116 (TTGACA-N17-TGAACT) and PcPUO (TCGACA-N17-TAAACT) have been described for class 1 integrons26. As detected by primer extension (Fig 5c), a transcription start site (nucleotide C) is located at 227-bp upstream of aacA7 start codon (i.e. a 227-bp 5′-UTR of aacA7), validating presence of the PcW promoter to drive aacA7-orfE-blaIMP-1 transcription. The PcW promoter can be found for all the pA22732-IMP, pB8, R751 and pB8 integrons.
Remarkably, the primer extension assay detects another transcription start site (nucleotide G) which is located at 155-bp upstream of blaIMP-1 start codon. This assay discloses presence of an internal promoter (TTGCCA-N16-TATCAT) driving transcription of the blaIMP-1 gene cassette (Fig 5c). Being very rare, the internal gene cassette-specific promoter is an extra element in evolution of antimicrobial resistance phenotype and act independent of Pc promoter27.
In addition, the primer extension assay shows that addition of increasing amounts of imipenem during bacterial cultivation has no effect on promoter activity of either aacA7-orfE-blaIMP-1 or blaIMP-1 (Fig 5c), validating constitutive expression of the aacA7-orfE-blaIMP-1 operon and the blaIMP-1 gene cassette. Notably, constitutive transcription of integron gene cassettes has been suggested previously23,28,29.
Concluding remarks
We present the first complete sequence of IMP-encoding plasmid from A. xylosoxidans and this is also the first report of identification of a carbapenemase-encoding IncP-1ß plasmid from a clinical bacterial isolate. The detected blaIMP-1 gene is captured by a novel class 1 integron with a novel gene cassette array in the IncP-1ß plasmid pA22732-IMP. The class 1 integron is embedded in a Tn402-like transposon and inserted into pA22732-IMP by transposition. Most of the characterized IncP-1ß plasmids are isolated from bacteria in agricultural soils or waters and frequently associated with mercury resistance7,9,10,11,13. Only a few of them, e.g. pA22732-IMP and R75, are of clinical origins and harbor an array structure of multiple resistance gene cassettes. The IncP-1ß plasmids thus could represent important vehicles for spreading clinically relevant resistance determinants across a number of bacterial species. The transfer of blaIMP to A. xylosoxidans, which already carried blaOXA-114 intrinsically, would lead to more severe drug resistance, making high difficulty in timely choosing sensitive antibiotics for treatment. The IMP-producing A. xylosoxidans should be taken seriously as the surveillance target especially in East Asia countries such as China and Japan.
Methods
Bacteria isolation and identification
Fresh sputum specimens were sampled from the indicated patient and inoculated onto Mueller-Hinton agar for bacterial isolation. The use of human specimens and all related experimental protocols were approved by the Committee on Human Research of Chinese People's Liberation Army General Hospital and carried out in accordance with the approved guidelines and moreover the informed consent was obtained from the indicated patient. Single colony of each bacterial strain tested was subjective for species identification by VITEK 2 (BioMérieux), Bruker MALDI Biotyper and 16s rRNA gene sequencing. For determination of16S rRNA gene sequence, the almost complete coding region of 16S rRNA gene was amplified by PCR with the universal primers 27f (AGAGTTTGATCCTGGCTCAG) and 1492r (TACCTTGTTACGACTT)30 and then sequenced on ABI 3730 Sequencer.
PCR detection of bla genes
All known carbapenemase and ESBL genes as listed in Table S1 were subjected to PCR detection. Primer pair GTCCAAGACCGGCAACTC/CACCAGCAGGATCGACAG was designed from whole-genome shotgun sequences of strain A22732 (data not shown) for amplifying the DNA fragments containing the whole coding region of blaOXA-114, because all the available primers gave negative amplification. All amplicons were sequenced on ABI 3730 Sequencer with the same primers for PCR.
Detection of carbapenemase activity
Activity of class A/B/D carbapenemases was determined by CarbaNP test6 with modifications. Overnight bacterial cell culture in the Mueller-Hinton broth was diluted 1:100 into 3 ml of fresh Mueller-Hinton broth and bacteria were allowed to grow at 37°C with shaking at 200 rpm to reach an optical density (OD600) of 1.0 to 1.4. If required, ampicillin was used at 100 μg/ml. Bacterial cells were harvested from 2 ml of the above culture and washed twice with 20 mM Tris-HCl (pH 7.8). Cell pellets were resuspended in 500 μl of 20 mM Tris-HCl (pH 7.8) and lysed by soniation, followed by centrifugation at 10000 × g at 4°C for 5 min. 50 μl of the supernatant (the enzymatic bacterial suspension) were mixed with 50 μl of substrate I to V, respectively, followed by incubation at 37°C for a maximum of 2 h. Substrate I: 0.054% red phenol plus 0.1 mM ZnSO4 (pH7.8). Substrate II: 0.054% red phenol plus 0.1 mM ZnSO4 (pH7.8) and 0.6 mg/μl imipenem. Substrate III: 0.054% red phenol plus 0.1 mM ZnSO4 (pH7.8), 0.6 mg/μl mg imipenem and 0.8 mg/μl tazobactam. Substrate IV: 0.054% red phenol plus 0.1 mM ZnSO4 (pH7.8), 0.6 mg/μl mg imipenem and 3 mM EDTA (pH7.8). Substrate V: 0.054% red phenol plus 0.1 mM ZnSO4 (pH7.8), 0.6 mg/μl mg imipenem, 0.8 mg/μl tazobactam and 3 mM EDTA (pH7.8).
Conjugal transfer
Plasmid conjugal transfer experiments were carried out with rifampin-resistant E. coli EC600 being used as recipient and blaIMP-positive A. xylosoxidans as donor. 3 ml of overnight cultures of each of donor and recipient bacteria were mixed together, harvested and resuspended in 80 μl of Brain Heart Infusion (BHI) medium. The mixture was spotted on a 1 cm2 filter membrane that was placed on the BHI agar plate and then incubated for mating at 37°C for 12-18 h. Bacteria were washed from the filter membrane and spotted on the Muller-Hinton agar plate containing 1500 μg/ml rifampin and 100 μg/ml ampicillin for selection of the blaIMP-positive E. coli transconjugant.
Determination of minimum inhibitory concentration (MIC)
The MIC values of indicated bacterial strains were tested by using VITEK 2 according to manufacturer's instructions and antimicrobial susceptibility was judged by Clinical and Laboratory Standards Institute (CLSI) standard.
Determination of plasmid DNA sequence
The chromosome DNA-free plasmid DNA was isolated from the cell cultures of the blaIMP-positive E. coli transconjugant using a Qiagen large construct kit and then sequenced by using whole-genome shotgun strategy in combination with Illumina HiSeq 2500 sequencing technology. The contigs were assembled with Velvet and the gaps were filled through combinatorial PCR and Sanger Sequencing on ABI 3730 Sequencer. The genes were predicted with GeneMarkS and further annotated by BLASTP against Uniport and NR databases.
RNA isolation and reverse transcription (RT)-PCR
Bacteria were cultured overnight in Mueller-Hinton broth (BD) with or without addition of 2 μg/ml imipenem (Sigma). Total RNAs were extracted from harvested bacterial cells using TRIzol Reagent (Life Technologies). RNA quality was monitored by agarose gel electrophoresis and RNA quantity was determined by spectrophotometry. The contaminated DNA in the total RNA samples was removed by using Amibion's DNA-freeTM Kit. cDNAs were generated by using 5 µg of RNA and 3 µg of random hexamer primers in a 40 µl reaction mixture. The cDNA samples were generated by RT from total RNAs. Genomic DNA and cDNA were used as the templates for PCR and RT-PCR, respectively, with the primer pair TGTTTGATGTTATGGAGCAG/AGCCGTAAATGGAGTGTC. To ensure that no contamination of genomic DNA in the RT reactions would occur, RT-PCR of negative controls was performed using the ‘cDNA’ sample generated without reverse transcriptase as template. Reactions containing primer pairs without templates were also included as blank controls.
Primer extension assay
The [γ-32P] ATP end-labeled primer CAGTCATAACAAGCCAT or CATACTTTTCCTTTTCTAACGG, which was complementary to aacA7 or blaIMP-1 transcript, respectively, was annealed with total RNA sample of strain A22732 for primer extension assay as described previously31. For different cell cultures (lanes) in a single experiment, equal amounts of total RNA were used as starting materials. The corresponding end-labeled primer was also used for sequencing the PCR amplicon generated by the primer pair TGACGATGCGTGGAGACC/CAGTCATAACAAGCCAT or TGTTTGATGTTATGGAGCAG/AGCCGTAAATGGAGTGTC. DNA sequencing was carried out using the AccuPower & Top DNA Sequencing Kit (Bioneer). Primer extension products and sequencing materials were analyzed on an 8 M urea-6% polyacrylamide gel electrophoresis. Radioactive species were detected by autoradiography.
Nucleotide sequence accession number
The complete sequence (File S1) of plasmid pA22732-IMP was submitted to the GenBank nucleotide sequence database under accession number KJ588780.
References
Doi, Y., Poirel, L., Paterson, D. L. & Nordmann, P. Characterization of a naturally occurring class D beta-lactamase from Achromobacter xylosoxidans. Antimicrob. Agents Chemother. 52, 1952–1956 (2008).
Turton, J. F. et al. Identification of Achromobacter xylosoxidans by detection of the blaOXA-114-like gene intrinsic in this species. Diagn. Microbiol. Infect. Dis. 70, 408–411 (2011).
Zhao, W. H. & Hu, Z. Q. IMP-type metallo-beta-lactamases in Gram-negative bacilli: distribution, phylogeny and association with integrons. Crit. Rev. Microbiol. 37, 214–226 (2011).
Yamamoto, M. et al. Molecular characterization of IMP-type metallo-beta-lactamases among multidrug-resistant Achromobacter xylosoxidans. J. Antimicrob. Chemother. 67, 2110–2113 (2012).
Iyobe, S. et al. Detection of a variant metallo-beta-lactamase, IMP-10, from two unrelated strains of Pseudomonas aeruginosa and an alcaligenes xylosoxidans strain. Antimicrob. Agents Chemother. 46, 2014–2016 (2002).
Dortet, L., Poirel, L. & Nordmann, P. Rapid identification of carbapenemase types in Enterobacteriaceae and Pseudomonas spp. by using a biochemical test. Antimicrob. Agents Chemother. 56, 6437–6440 (2012).
Sen, D. et al. Broad-host-range plasmids from agricultural soils have IncP-1 backbones with diverse accessory genes. Appl. Environ. Microbiol. 77, 7975–7983 (2011).
Thorsted, P. B. et al. Complete sequence of the IncPbeta plasmid R751: implications for evolution and organisation of the IncP backbone. J. Mol. Biol. 282, 969–990 (1998).
Schluter, A. et al. The 64 508 bp IncP-1beta antibiotic multiresistance plasmid pB10 isolated from a waste-water treatment plant provides evidence for recombination between members of different branches of the IncP-1beta group. Microbiology 149, 3139–3153 (2003).
Schluter, A. et al. Plasmid pB8 is closely related to the prototype IncP-1beta plasmid R751 but transfers poorly to Escherichia coli and carries a new transposon encoding a small multidrug resistance efflux protein. Plasmid 54, 135–148 (2005).
Kim, D. U., Kim, M. S., Lim, J. S. & Ka, J. O. Widespread occurrence of the tfd-II genes in soil bacteria revealed by nucleotide sequence analysis of 2,4-dichlorophenoxyacetic acid degradative plasmids pDB1 and p712. Plasmid 69, 243–248 (2013).
Schluter, A., Szczepanowski, R., Puhler, A. & Top, E. M. Genomics of IncP-1 antibiotic resistance plasmids isolated from wastewater treatment plants provides evidence for a widely accessible drug resistance gene pool. FEMS Microbiol. Rev. 31, 449–477 (2007).
Radstrom, P. et al. Transposon Tn5090 of plasmid R751, which carries an integron, is related to Tn7, Mu and the retroelements. J. Bacteriol. 176, 3257–3268 (1994).
Sajjad, A., Holley, M. P., Labbate, M., Stokes, H. W. & Gillings, M. R. Preclinical class 1 integron with a complete Tn402-like transposition module. Appl. Environ. Microbiol. 77, 335–337 (2011).
Gillings, M. et al. The evolution of class 1 integrons and the rise of antibiotic resistance. J. Bacteriol. 190, 5095–5100 (2008).
Toleman, M. A., Vinodh, H., Sekar, U., Kamat, V. & Walsh, T. R. blaV IM-2-harboring integrons isolated in India, Russia and the United States arise from an ancestral class 1 integron predating the formation of the 3′ conserved sequence. Antimicrob. Agents Chemother. 51, 2636–2638 (2007).
Stokes, H. W. et al. Class 1 integrons potentially predating the association with Tn402-like transposition genes are present in a sediment microbial community. J. Bacteriol. 188, 5722–5730 (2006).
Saenz, Y. et al. Class 1 integrons lacking qacEDelta1 and sul1 genes in Escherichia coli isolates of food, animal and human origins. Vet. Microbiol. 144, 493–497 (2010).
Kiiru, J., Butaye, P., Goddeeris, B. M. & Kariuki, S. Analysis for prevalence and physical linkages amongst integrons, ISEcp1, ISCR1, Tn21 and Tn7 encountered in Escherichia coli strains from hospitalized and non-hospitalized patients in Kenya during a 19-year period (1992–2011). BMC Microbiol. 13, 109, 10.1186/1471-2180-13-109 (2013).
Kamali-Moghaddam, M. & Sundstrom, L. Transposon targeting determined by resolvase. FEMS Microbiol. Lett. 186, 55–59 (2000).
Szczepanowski, R., Krahn, I., Bohn, N., Puhler, A. & Schluter, A. Novel macrolide resistance module carried by the IncP-1beta resistance plasmid pRSB111, isolated from a wastewater treatment plant. Antimicrob. Agents Chemother. 51, 673–678 (2007).
Partridge, S. R. et al. Definition of the attI1 site of class 1 integrons. Microbiology 146, 2855–2864 (2000).
Hall, R. M. & Collis, C. M. Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol. Microbiol. 15, 593–600 (1995).
Stokes, H. W., O'Gorman, D. B., Recchia, G. D., Parsekhian, M. & Hall, R. M. Structure and function of 59-base element recombination sites associated with mobile gene cassettes. Mol. Microbiol. 26, 731–745 (1997).
Francia, M. V., Avila, P., de la Cruz, F. & Garcia Lobo, J. M. A hot spot in plasmid F for site-specific recombination mediated by Tn21 integron integrase. J. Bacteriol. 179, 4419–4425 (1997).
Jove, T., Da Re, S., Denis, F., Mazel, D. & Ploy, M. C. Inverse correlation between promoter strength and excision activity in class 1 integrons. PLoS Genet. 6, e1000793, 10.1371/journal.pgen.1000793 (2010).
da Fonseca, E. L. & Vicente, A. C. Functional characterization of a cassette-specific promoter in the class 1 integron-associated qnrVC1 gene. Antimicrob. Agents Chemother. 56, 3392–3394 (2012).
Jacquier, H., Zaoui, C., Sanson-le Pors, M. J., Mazel, D. & Bercot, B. Translation regulation of integrons gene cassette expression by the attC sites. Mol. Microbiol. 72, 1475–1486 (2009).
Depardieu, F., Podglajen, I., Leclercq, R., Collatz, E. & Courvalin, P. Modes and modulations of antibiotic resistance gene expression. Clin. Microbiol. Rev. 20, 79–114 (2007).
Frank, J. A. et al. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl. Environ. Microbiol. 74, 2461–2470 (2008).
Zhang, Y. et al. Molecular characterization of transcriptional regulation of rovA by PhoP and RovA in Yersinia pestis. PLoS One 6, e25484, 10.1371/journal.pone.0025484 (2011).
Acknowledgements
This work is funded by National Key Program for Infectious Disease of China (2013ZX10004216 and 2013ZX10004-217-002), National Basic Research Program of China (2014CB744400), Program of Manned Spaceflight (040203) and National Natural Science Foundation of China (81350020 and 81373077). All the experiments were done in Dr. Dongsheng Zhou's laboratory.
Author information
Authors and Affiliations
Contributions
D.Z. and C.L. designed experiments. Z.C., H.F., L.W., F.S., Y.W., Z.Y., H.Y., W.Y., J.W., P.X., D.Z. and C.L. performed experiments. D.Z., Z.C. and H.F. analyzed data. D.Z., Z.C., H.F. and Y.W. contributed reagents, materials and analysis tools. D.Z. and C.L. wrote this manuscript.
Ethics declarations
Competing interests
The authors declare no competing financial interests.
Electronic supplementary material
Supplementary Information
Supplementary material
Rights and permissions
This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article's Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder in order to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/
About this article
Cite this article
Chen, Z., Fang, H., Wang, L. et al. IMP-1 encoded by a novel Tn402-like class 1 integron in clinical Achromobacter xylosoxidans, China. Sci Rep 4, 7212 (2014). https://doi.org/10.1038/srep07212
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/srep07212
- Springer Nature Limited
This article is cited by
-
Shigella flexneri: an emerging pathogen
Folia Microbiologica (2020)
-
Proteomic identification of Axc, a novel beta-lactamase with carbapenemase activity in a meropenem-resistant clinical isolate of Achromobacter xylosoxidans
Scientific Reports (2018)
-
Characterization of a novel Achromobacter xylosoxidans specific siphoviruse: phiAxp-1
Scientific Reports (2016)
-
Isolation and molecular characterisation of Achromobacter phage phiAxp-3, an N4-like bacteriophage
Scientific Reports (2016)