Cultivable bacterial diversity and early plant growth promotion by the traditional organic formulations prepared using organic waste materials

  • Rangasamy Anandham
  • Nagaiah Premalatha
  • Hyeong Jin Jee
  • Hang Yeon Weon
  • Soon Wo Kwon
  • Ramasamy Krishnamoorthy
  • Pandiyan Indira Gandhi
  • Yong Ki Kim
  • Nellaiappan Olaganathan Gopal
Open Access
Original Research
  • 1.6k Downloads

Abstract

Purpose

Traditional organic formulations are widely used as a plant growth promoters; however, the knowledge on the microbial aspect of traditional organic formulations is still limited. The aim of this study was to illustrate the cultivable bacterial diversity of various traditional organic formulations and their potential for early plant growth promotion.

Methods

Five different traditional organic formulations such as 100 % panchagavya, 33 % panchagavya, plant extract with native microorganisms, commercial organic fertilizer extract with two percent leaf soil extract and commercial organic fertilizer extract with 2 % yogurt were prepared and used in this study. The liquid fraction of these traditional organic formulations were used to analyze the beneficial effect on plant growth by seed treatment and foliar applications.

Results

Bacterial 16SrDNA analysis revealed that the isolates fell into forty-three different genera, which can be grouped into seven different classes, such as Alphaproteobacteria, Actinobacteria, Bacilli (or Firmibacteria), Betaproteobacteria, Cytophagia, Flavobacteriia and Gammaproteobacteria. Higher bacterial diversity was observed in cow dung followed by 33 and 100 % panchagavya. Radish and Chinese cabbage seed germination and growth were significantly improved by traditional organic formulations compared to control.

Conclusion

The results of this study showed that the bacterial diversity changes depend on the type and concentration of ingredients used in traditional organic formulations. Substantial increase in plant growth by the traditional organic formulations indicates the suitability of using these organic preparations in eco-friendly agriculture.

Keywords

Eubacterial diversity Organic farming Organic formulations Panchagavya Plant growth-promoting bacteria 

Introduction

Intensive agriculture depends on expensive chemical inputs from off farm, which generates lot of pollutants and affects environment (Horrigan et al. 2002). Due to the negative impact of chemical inputs, organic farming gained more attention from last few decades (Badgley et al. 2007). The Food and Agricultural Organization of the United Nations (FAO) estimated that the area under organic agriculture was 37.2 million ha in 2011, which was three times higher than that of 1999 (FAO 2013). In organic farming, synthetic pesticides, mineral fertilizers, genetically modified organisms and sewage sludge applications are strictly excluded. Nonetheless, biofertilizers or traditional organic formulations prepared by using organic materials/wastes are encouraged to use as a plant nutrition (Badgley et al. 2007). Numerous studies stated that the yield and quality of plant products produced by organic farming are considerably better than that of conventional farming (Chemura 2014; Oliveira et al. 2013; Luthria et al. 2010). Organic farming not only improves the quality of the food products, but it also improves the soil fertility. In a long-term study in Switzerland, organic farming with composted animal manure improved soil quality significantly as compared to conventional farming with mineral fertilizer (Maeder et al. 2002).

Traditional organic formulations may contain numerous plant growth-promoting bacteria (PGPB), which may enhance plant growth by nitrogen fixation, growth hormone production and control phytopathogens (Amalraj et al. 2013; Naik and Sreenivasa 2009). In many Asian countries, farmers formulate their own organic formulations by combining different organic materials and treating them by fermentation or composting. For example, in India, panchagavya (PG) is one of the widely used traditional organic formulations, which is mostly prepared by farmers themselves. Panchagavya is a fermented product made from five ingredients obtained from cow, such as milk, urine, dung, curd and clarified butter (Amalraj et al. 2013). South Korean farmers use wild weed wineberry (Rubus phoenicolasius) extract with native microorganisms, which is prepared by mixing wild weed extract, salt, molasses and decomposed leaf soil extract. Thailand farmers use fermented plant extracts or fermented plant juices, which can promote plant growth and act as a biocontrol agent (Kantachote et al. 2009). Bokashi is a Japanese traditional organic formulation preparation which contains effective microorganisms (EM). Japanese first developed the EM concept during 1980s, and this preparation contains various PGPB and yeast (Yamada and Xu 2001). These traditional organic formulations have not been well characterized microbiologically.

In recent past, several culture-independent methods have been developed to illustrate higher percent of bacterial population than usually found with cultural-dependent methods (Videira et al. 2013). These culture-independent methods may give in-depth knowledge about bacterial diversity, but it is impossible to use this information to identify the physiology of particular bacterial strain, interaction between microorganisms and response of bacterial strains to different environmental conditions (Stewart 2012). However, the culture-dependent method can be more useful in studying bacterial physiology and their role in plant growth promotion (Palleroni 1997). In addition, a cultural-dependent method may be helpful in industrial applications such as developments of antibiotics or biofertilizers. Only a few reports elucidate the microbial population in different organic formulations prepared by farmers (Radha and Rao 2014; Amalraj et al. 2013; Girija et al. 2013). Recently, higher number of cultivable bacterial genera was obtained from the organic formulation prepared using fermented cow manure (Giannattasio et al. 2013). In addition, few novel and plant growth-promoting bacteria such as Larkinella bovis sp. nov. and Microbacterium suwonense sp. nov. were isolated from traditional organic formulations and tested for their plant growth promotion (Anandham et al. 2011a, b; Sreenivasa et al. 2009).

In this study, culture-dependent method was used to illustrate the bacterial diversity in various traditional organic formulations made from organic materials and evaluated the effect of organic formulations on early growth of radish and Chinese cabbage. Successfully cultivated bacterial isolates may be used to develop a microbial consortium to support sustainable agricultural practice in future.

Materials and methods

Traditional organic formulations preparations

Organic formulations such as 100 % PG, 33 % PG, plant extract with native microorganism (PNM), commercial organic fertilizer extract with 2 % leaf soil extract (OLE) and commercial organic fertilizer extract with 2 % yogurt (OY) were prepared and used in this study. Ingredients and their concentration of different traditional organic formulations are given in Table 1.
Table 1

Ingredients and their concentrations of different organic formulations

100 % PG

33 % PG

PNM

OLE

OY

Cow dung (1.5 g)

Cow urine (4.5 ml)

Cow milk (3.0 ml)

Yogurt (3.0 g)

Molasses (4.5 g)

Potato (3.0 g) and make up to 1 l with water

Cow dung (0.5 g)

Cow urine (1.49 ml)

Cow milk (0.99 ml)

Yogurt (0.99 g)

Molasses (4.5 g)

Potato (0.99 g) and make up to 1 l with water

0.2 % wild weed wineberry extracts, 0.1 % sodium chloride

0.5 % molasses and make up to 1 l with water

40 % OF extract, 2 % molasses

0.2 % sodium chloride

2 % leaf soil extract and make up to 1 l with water

2 % yogurt

40 % OF extract

2 % molasses and make up to 1 l with water

Commercially available pelleted organic fertilizer (OF) extract was used to prepare OLE and OY. Pelleted OF contains 55 % caster bean waste, 40 % rice bran and 5 % palm waste with the nutrient content of 45 % N, 1.5 % P and 1.0 % K. For preparing an organic fertilizer extract, forty gram OF was boiled in 400 ml of water (sterile distilled water) for 30 min and then the filtrate was collected using the filter paper (Whatman No. 2–90 mm). Leaf soil extract was prepared by mixing 20 g of soil [containing decomposed leaf, collected from the hilly region Gangwon Province of South Korea (37°49′22.64″N; 128°09′23.00″E)] with 120 ml of water (sterile distilled water) and shaken for 30 min, then filtered through filter paper (Whatman No. 2–90 mm). The ingredients of the each traditional organic formulation were mixed in a flask and allowed for fermentation for 5 days in shaking condition (120 rpm) at 30 °C. During fermentation, microorganisms can degrade the organic materials and enhance the production of organic formulations. All five organic formulations were separately filtered through a cloth filter (performed under aseptic condition to avoid contamination), and then, the liquid fraction was used for further experiments.

Cultivable bacterial diversity analysis

Bacteria were isolated from the liquid fraction of various traditional organic formulations using trypticase soybean agar (TSA; Difco), Lysogeny agar (LA; Difco) and R2A agar (Difco). In addition, PG ingredients (cow urine, cow dung and cow milk) were also used for bacterial isolation (by serial dilution and plating) and diversity analysis. Isolated bacterial cultures (169 isolates) were grouped into different genera based on their short-length sequencing of 16S rDNA with 895F (CRCCTGGGGAGTRCRG), 47F (GCGCCAGGGAATTCTAAAAC) and 783R (ACCMGGGTATCTAATCCKG) primers. Only 96 bacterial isolates were selected (by avoiding duplicate within the treatments), and nearly full-length sequence of 16S rDNA was sequenced for species-level identification. Genomic DNA of 96 bacterial isolates was extracted using Ultra Clean DNA isolation kit (MO BioLaboratories Inc., Carlsbad, CA, USA) and amplified using universal 16S rDNA primers (27F and 1492R). The 16S rDNA nucleotide sequences were identified by PCR direct sequencing by fluorescent dye terminator method (ABI Prism™ Bigdye™ Terminator cycle sequencing ready reaction kit v.3.1; Applied Biosystems, Foster, CA, USA), and the products were purified by Millipore-Montage dye removal kit (Beckman Coulter Inc., Fullerton, CA, USA). Finally, the products were run into an ABI3730XL capillary DNA sequencer (50 cm capillary). 16S rDNA sequences from the automatic sequencer were aligned, and bacterial identities deduced by using the EzTaxon-e server (http://eztaxon-e.ezbiocloud.net/) to ascertain their closest relatives. The sequences obtained in this study were submitted in GenBank, with the accession numbers from GQ246652 to GQ246748. 16S rDNA sequences were aligned using the CLUSTALW program, and the phylogenetic tree was constructed using MEGA version 6.0 (Tamura et al. 2013). Neighbor-joining tree was constructed with the bootstrap values of 1000.

Pathogen detection in organic formulations preparations and their ingredients

Five traditional organic formulations and PG ingredients were tested for the presence of pathogens such as Staphylococci and Enterobacteriaceae using the STAPH PLUS (Thermo Fisher Scientific Inc., Waltham, MA, USA) and RapID One (Thermo Fisher Scientific Inc., Waltham, MA, USA), respectively, according to the manufacturers instruction.

Plant growth experiments

Radish (Raphanus sativus L. cultivar Hong Feng No. 1) and Chinese cabbage (Brassica rapa subsp. pekinensis cultivar Norangchusurk) seeds were surface sterilized and imbibed in 5 ml liquid fraction of five different organic formulations with 0, 50 and 100 times dilutions and incubated at 25 ± 2 °C for 72 h for seed germination. The seeds were taken as germinated if the radicle emerges from the seeds. Three-day-old germinated seeds were transplanted into 40-L pot containing 20-kg pot mixture (pH 7.0; EC—1.2; NH4+N—170 mg kg−1; NO3N—110 mg kg−1; available P2O5—300 mg kg−1; K2O—340 mg kg−1; CEC—10 cmolc kg−1) and maintained for 30 days. Pot experiment was performed with sixteen treatments (five organic fertilizers with three dilutions and one control). The plants were irrigated once in 2 days until the pot mixture reached 70 % of its water-holding capacity. Additional to seed treatment, 25 ml of respective traditional organic formulations was sprayed on the plants until runoff using the handheld pneumatic sprayer, on seventh day after transplantation. In the case of control, sterile distilled water was sprayed to maintain the same conditions as other treatments. There were three replications for each treatment and arranged in a completely randomized block design in the greenhouse. Root length, shoot length and dry weight of the plants were measured 30 days after transplantation (DAT).

Statistical analysis

Data on microbial count and plant parameters were subjected to analysis of variance (ANOVA) and Duncan’s multiple range test (DMRT) using the SAS package, version 9.1.3 (SAS Institute Inc., Cary, NC, USA) and tested significant differences at 0.05. Data on plant growth of individual traditional organic formulation treatment and their dilutions were compared with control plants in order to find out the effect of traditional organic formulations on radish and Chinese cabbage growth. Microbial count data were log10-transformed before statistical analysis. Heat map was constructed using Microsoft Excel conditional formatting.

Results

Bacterial count and cultivable bacterial diversity of various traditional organic formulations and PG ingredients

LA and TSA were found to support a higher number of bacterial group than that of R2A medium (Online Resource 1). No significant differences in bacterial count were observed among different organic formulations prepared and used in this study. Short-length sequencing of 169 bacterial isolates obtained from different organic formulations and PG ingredients (cow urine, cow dung and cow milk) revealed that the isolates were belonged to 43 different genera (Fig. 1). These 43 genera can be grouped into seven different classes, such as Alphaproteobacteria, Actinobacteria, Bacilli (or Firmibacteria), Betaproteobacteria, Cytophagia, Flavobacteriia and Gammaproteobacteria (Fig. 2). Fifty-four percentage of the cultivable bacterial population in 100 % PG preparation was Bacilli (or Firmibacteria). In particular, Bacillus, Lactobacillus, Lactococcus, Leuconostoc and Lysinibacillus genera were dominated. The higher proportion of Alphaproteobacteria was observed in 33 % PG followed by Firmibacteria and Betaproteobacteria. Other organic formulations such as PNM, OLE, OY and PG ingredients were found to be dominated by Firmibacteria and Alphaproteobacteria or Actinobacteria (Fig. 2). Higher number of cultivable bacterial species were observed in cow dung (54 species) followed by 33 % (37 species) and 100 % PG (28 species).
Fig. 1

Heat map shows the number of bacterial species isolated from different organic formulations and their ingredients. T1 100 % panchagavya; T2 33 % panchagavya; T3 plant extract with native microorganisms; T4 commercial organic fertilizer extract with 2 % leaf soil extract; T5 commercial organic fertilizer extract with 2 % yogurt; T6 cow urine; T7 cow dung; T8 cow milk

Fig. 2

Class and genus-level distribution of bacteria in different organic formulations and their ingredients. aAlphaproteobacteria; bActinobacteria; cBacilli (or Firmibacteria); dBetaproteobacteria; eCytophagia; fFlavobacteriia; gGammaproteobacteria. Larger circle represents percentages of different classes of bacteria present in organic formulations and ingredients. Partitioning of small circle represents number of genera present in a particular class

Out of 169 bacterial isolates, 96 were carefully selected for full-length sequencing by avoiding duplicates within the treatments. All sequenced isolates with closest neighbor and their accession numbers are given in Online Resource 2. Our sequencing results revealed that PG preparation had thirteen unique bacterial genera, which were belong to various PGPB and fermentative groups of bacteria. Azospirillum, Brevundimonas, Lactobacillus, Xenophilius, Xylophilus, Comamonas and Acetobacter are the representatives of PGPB genera found in PG preparation (Fig. 3).
Fig. 3

Neighbor-joining phylogenetic tree shows the relationship among the bacterial species isolated from 33 % panchagavya preparations (highlighted in bold) and their closest neighbors. Tree was constructed using near-full-length sequences of bacterial 16S rDNA sequences with 1000 bootstraps values

Pathogen detection in traditional organic formulations and their ingredients

RapID STAPH PLUS system and RapID One analysis revealed the presence of Staphylococcus aureus and Escherichia coli in cow dung which was one of the ingredients in PG preparation, but those pathogens were not observed in PG organic formulations. In addition, 16S rDNA amplification confirmed the presence of foodborne pathogens (Shigella flexneri, Bergyella zoohelcum and Enterococcus durans) in cow dung and cow milk (Online Resource 2). However, these pathogens were not observed in 33 and 100 % PG organic formulations.

Germination assay and plant responses to different organic formulations and their dilution

Germination percentage of radish and Chinese cabbage treated with different organic formulations is presented in Fig. 4. Dilution of 33 % PG, PNM, OLE and OY fertilizers showed a significant increase in radish seed germination. On the other hand, traditional organic formulations did not show any significant increase in Chinese cabbage seed germination (Fig. 4).
Fig. 4

Effect of seed treatment of different organic formulations on radish (a) and Chinese cabbage (b) seed germination percentage under in vitro condition. T1 100 % panchagavya; T2 33 % panchagavya; T3 plant extract with native microorganisms; T4 commercial organic fertilizer extract with 2 % leaf soil extract; T5 commercial organic fertilizer extract with 2 % yogurt. Control, 0, 50 and 100 times dilution of organic formulations are represented in different shades. Values are mean ± standard error (SE) of three replications, and same letters in each treatment are not significantly different from each other at P < 0.05 according to Duncan’s multiple range test (DMRT)

Organic formulation-treated plants showed higher growth compared to control plants (except in 100 % PG treatment). Zero times dilution of 100 % PG had negative impact on plant growth, which registered the lower root length, shoot length and dry weight of radish than that of diluted treatments (Fig. 5; Online Resource 3, 4). Higher root length of radish (25.6 cm) and Chinese cabbage (33.33 cm) was observed in OY (50 times diluted) and 33 % PG (zero times diluted) treatment, respectively (Online Resource 3). Radish and Chinese cabbage shoots length was found to be higher in 33 % PG and OY (zero times diluted) treatment, respectively (Online Resource 4). Higher dry matter accumulation was found in OLE-treated (100 times diluted) radish and Chinese cabbage plants (Fig. 5). Dry weight of radish was significantly improved by 100 % PG, 33 % PG, PNM and OLE treatments than that of control plants. Traditional organic formulations have no significant impact on Chinese cabbage dry weight.
Fig. 5

Effect of different organic formulations on dry weight of radish (a) and Chinese cabbage (b) under pot culture condition. T1 100 % panchagavya; T2 33 % panchagavya; T3 plant extract with native microorganisms; T4 commercial organic fertilizer extract with 2 % leaf soil extract; T5 commercial organic fertilizer extract with 2 % yogurt. Control, 0, 50 and 100 times of dilution organic formulations are represented in different shades. Values are mean ± SE of three replications, and same letters in each treatment are not significantly different from each other at P < 0.05 according to DMRT

Discussion

Farmer utilizes locally available organic materials for preparing organic formulations, and there are many well-developed traditional organic formulations which are available worldwide, but most of them are unpopular. Chemical and microbiological aspect of many traditional organic formulations is not well studied. Recently, nuclear magnetic resonance analysis of organic formulations revealed the presence of various bioactive compounds, which helps in plant growth improvement (Spaccini et al. 2012). In this work, we have chosen five different traditional organic formulations such as 100 % PG, 33 % PG, PNM, OLE and OY to analyze microbiological aspects and the effect of organic formulations on early plant growth was also illustrated.

Three diverse microbiological media have been used to obtain higher number of cultivable bacterial population from different organic formulations. This cultivation-dependent approach exhibited the presence of novel bacterial isolates such as L. bovis sp. nov. and M. suwonense sp. nov. in organic formulations and PG ingredients, respectively (Anandham et al. 2011a, b). Fermentation process during the preparation of traditional organic formulations encourages different group of microorganisms to develop (Yan et al. 2013). These microorganisms may be grouped into three different groups such as plant growth promoters, fermentative microorganisms and antibiotic producers based on their functions. Fermentative group of microorganisms break down complex nutrients into simple nutrients, and antibiotic producers inhibit pathogenic bacterial growth (Yadav et al. 2013; Gea et al. 2009). On the other hand, PGPB harbored in the organic formulations improves plant growth by various mechanisms (Naik and Sreenivasa 2009). PGPB are the group of bacteria found in the rhizosphere and/or phyllosphere region of plants, which can enhance plant growth by direct and indirect mechanisms (Vacheron et al. 2013). Presence of various PGPB and slow release of nutrients are the two main reasons for plant growth promotion and improving soil health by organic formulations (Amalraj et al. 2013).

In our study, total bacterial populations in raw and processed organic formulations were not significantly changed. However, bacterial genus/species between organic formulations and their raw ingredients were changed. This clearly indicates the occurrence of bacterial succession during fermentation process. In recent past, use of pyrosequencing technique revealed the presence of 142 bacterial genera in cow dung, which includes cultivable and non-cultivable bacteria (Dowd et al. 2008). However, only 19 cultivable bacterial genera from the cow dung were able to cultivate under laboratory condition. Less number of cultivable bacterial genera obtained in this study proven the uncultivable nature of numerous bacterial genera in common laboratory media (Joseph et al. 2003). Other than 169 bacterial isolates, we were also obtained some yeast strains, which might also played an important role in the breakdown of complex sugars into simple components in the fermentation process during organic formulations preparation (Kantachote et al. 2009).

One of the PG ingredients (cow dung) was considered to be an carrier for foodborne pathogens like S. aureus, E. coli, Salmonella sp. and Campylobacter sp. (Simujide et al. 2013). In line with this, our results also showed the presence of S. aureus and E. coli pathogens in cow dung. However, these pathogens were eliminated by fermentation process during organic formulations preparation. Similar to our results, El Fels et al. (2015) showed the elimination of coliforms during the composting of organic waste material. Particularly, antibiotic-producing microorganisms in organic formulations might have played an important role in eliminating foodborne pathogens and phytopathogens (Qiu et al. 2012). Similar to this, composting of cow dung was also reported to be effective in removing foodborne pathogens such as S. aureus and E. coli (Simujide et al. 2013). Recently, Liu et al. (2013) reported that the inoculation of antagonistic bacteria with organic formulations was found to be effective in phytopathogen control.

Dominance nature of Firmibacteria in organic formulations used in this study might be due to the use of soil and plant extracts as one of the ingredients. Recently, Chen et al. (2013) reported the dominance of Firmibacteria in plant and soil ecosystem. Similarly, Firmibacteria was also dominated in compost prepared using agricultural waste materials (Chandna et al. 2013). PGPB such as Acetobacter sp. (Sevilla et al. 2001), Azospirillum sp. (Fages and Arsac 1991) and Brevundimonas sp. (Kumar and Gera 2014) found in 33 % PG were belong to Alphaproteobacteria. In addition, Firmibacteria class PGPB like Bacillus subtilis (Mohamed and Gomaa 2012) and Lactobacillus sp. (Limanska et al. 2013) were also observed (Fig. 3). Soil bacteria like Micrococcus sp., Paenibacillus sp. and Acetobacter sp. were dominated in PNM and OLE preparations. This may be due to the use of soil as one of the ingredient in these organic formulations preparations. Whereas Leuconostoc mesenteroides was found to be dominant in treatment containing OFE with 2 % yogurt, this bacterial species was mainly involved in milk fermentation process (Kihal et al. 2007).

Traditional organic formulations exhibited a significant positive impact on radish growth except 100 % PG. In line with this, many authors reported the beneficial effect of organic formulations on plant growth improvement (Naik and Sreenivasa 2009; Amalraj et al. 2013). Similarly, Pigeon pea treated with PG, vermicompost and farm yard manure improved plant growth compared to control, but the results were not significantly different among various organic formulations used (Gupta et al. 2014; Amalraj et al. 2013). Organic compost application significantly improved the dry biomass accumulation in wheat (Carpenter-Boggs et al. 2000). In agreement with this, our study also showed significantly higher radish dry biomass on organic formulations application. One hundred percent PG-treated plants showed significantly lower radish root length, shoot length, dry weight and root length of Chinese cabbage compared to that of diluted treatments and control. This might be due to the presence of plant growth inhibitors, acidic pH (5.6) and nutrients in undiluted 100 % PG. In line with this, Kadam and Pathade (2014) also showed the negative effect of higher concentration of vermicompost application on French bean growth compared to lower concentration of compost application. There were no consistent positive results for plant growth improvement on dilution of original organic formulations, except for 100 % PG. Similarly, different rate of compost application to vegetable crops showed no significant differences in plant growth between high and low concentrations (Chang et al. 2007).

Conclusion

This study illustrated the cultivable bacterial diversity of organic formulations traditionally prepared and used by farmers. The results of this study revealed that the bacterial diversity changes depend on the type and concentration of ingredients used in organic formulations. Significant increases in plant growth by organic formulations indicate the appropriateness of substituting organic formulations in the place of chemical fertilizers to enhance eco-friendly agriculture. Future study focusing on the plant growth-promoting characters of the isolates and symbiotic association among the isolates might help in developing microbial consortium for sustainable agriculture.

Notes

Acknowledgments

This work was supported by the National Academy of Agricultural Science (NAAS) and the Rural Development Administration (RDA), Republic of Korea. R.A. thanks RDA for award of a postdoctoral fellowship.

Supplementary material

40093_2015_107_MOESM1_ESM.docx (13 kb)
Supplementary material 1 (DOCX 12 kb)
40093_2015_107_MOESM2_ESM.docx (18 kb)
Supplementary material 2 (DOCX 18 kb)
40093_2015_107_MOESM3_ESM.docx (33 kb)
Supplementary material 3 (DOCX 33 kb)
40093_2015_107_MOESM4_ESM.docx (33 kb)
Supplementary material 4 (DOCX 32 kb)

References

  1. Amalraj ELD, Praveen Kumar G, Mir Hassan Ahmed SK, Abdul R, Kishore N (2013) Microbiological analysis of panchagavya, vermicompost, and FYM and their effect on plant growth promotion of pigeon pea (Cajanus cajan L.) in India. Org Agric 3:23–29CrossRefGoogle Scholar
  2. Anandham R, Kwon SW, Weon HY, Kim SJ, Kim YS, Gandhi PI, Kim YK, Jee HJ (2011a) Larkinella bovis sp. nov., isolated from fermented bovine products, and emended descriptions of the genus Larkinella and of Larkinellainsperata Vancanneyt et al. 2006. Int J Syst Evol Microbiol 61:30–34CrossRefGoogle Scholar
  3. Anandham R, Tamura T, Hamada M, Weon HY, Kim SJ, Kim YS, Suzuki K, Kwon SW (2011b) Microbacterium suwonense sp. nov., isolated from cow dung. J Microbiol 49:852–856CrossRefGoogle Scholar
  4. Badgley C, Moghtader J, Quintero E, Zakem E, Chappell MJ, Vazquez KA, Samulon A, Perfecto I (2007) Organic agriculture and the global food supply. Renew Agric Food Syst 22:86–108CrossRefGoogle Scholar
  5. Carpenter-Boggs L, Reganold JP, Kennedy AC (2000) Biodynamic preparations: short-term effects on crops, soils, and weed populations. Am J Altern Agric 15:110–118CrossRefGoogle Scholar
  6. Chandna P, Mallik S, Kuhad RC (2013) Assessment of bacterial diversity in agricultural by-product compost by sequencing of cultivated isolates and amplified rDNA restriction analysis. Appl Microbiol Biotechnol 97:6991–7003CrossRefGoogle Scholar
  7. Chang EH, Chung RS, Tsai YH (2007) Effect of different application rates of organic fertilizer on soil enzyme activity and microbial population. Soil Sci Plant Nutr 53:132–140CrossRefGoogle Scholar
  8. Chemura A (2014) The growth response of coffee (Coffea arabica L) plants to organic manure, inorganic fertilizers and integrated soil fertility management under different irrigation water supply levels. Int J Recycl Org Waste Agric 3:59. doi:10.1007/s40093-014-0059-x CrossRefGoogle Scholar
  9. Chen F, Wang M, Zheng Y, Li S, Wang H, Han D, Guo S (2013) The effect of biocontrol bacteria on rhizosphere bacterial communities analyzed by plating and PCR-DGGE. Curr Microbiol 67:177–182CrossRefGoogle Scholar
  10. Dowd SE, Callaway TR, Wolcott RD, Sun Y, McKeehan T, Hagevoort RG, Edrington TS (2008) Evaluation of the bacterial diversity in the feces of cattle using 16S rDNA bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP). BMC Microbiol 8:125. doi:10.1186/1471-2180-8-125 CrossRefGoogle Scholar
  11. El Fels L, Ouhdouch Y, Hafidi M (2015) Use of the co-composting time extract agar to evaluate the microbial community changes during the co-composting of activated sludge and date palm waste. Int J Recycl Org Waste Agric 4:95–103CrossRefGoogle Scholar
  12. Fages J, Arsac JF (1991) Sunflower inoculation with Azospirillum and other plant growth promoting rhizobacteria. Plant Soil 137:87–90CrossRefGoogle Scholar
  13. FAO (2013) Statistical yearbook world food and agriculture. Food and Agriculture Organization of the United Nations, Rome, pp 1–307Google Scholar
  14. Gea FJ, Navarro MJ, Tello JC (2009) Potential application of compost teas of agricultural wastes in the control of the mushroom pathogen Verticillium fungicola. J Plant Dis Prot 116:271–273Google Scholar
  15. Giannattasio M, Vendramin E, Fornasier F, Alberghini S, Zanardo M, Stellin F, Concheri G, Stevanato P, Ertani A, Nardi S, Rizzi V, Piffanelli P, Spaccini R, Mazzei P, Piccolo A, Squartini A (2013) Microbiological features and bioactivity of a fermented manure product (preparation 500) used in biodynamic agriculture. J Microbiol Biotechnol 23:644–651CrossRefGoogle Scholar
  16. Girija D, Deepa K, Xavier F, Antony I, Shidhi PR (2013) Analysis of cow dung microbiota—a metagenomic approach. Indian J Biotechnol 12:372–378Google Scholar
  17. Gupta R, Yadav A, Garg VK (2014) Influence of vermicompost application in potting media on growth and flowering of marigold crop. Int J Recycl Org Waste Agric 3:47. doi:10.1007/s40093-014-0047-1 CrossRefGoogle Scholar
  18. Horrigan L, Lawrence RS, Walker P (2002) How sustainable agriculture can address the environmental and human health harms of industrial agriculture. Environ Health Perspect 110:445–456CrossRefGoogle Scholar
  19. Joseph SJ, Hugenholtz P, Sangwan P, Osborne CA, Janssen PH (2003) Laboratory cultivation of widespread and previously uncultured soil bacteria. Appl Environ Microbiol 69:7210–7215CrossRefGoogle Scholar
  20. Kadam D, Pathade G (2014) Effect of tendu (Diospyros melanoxylon RoxB.) leaf vermicompost on growth and yield of French bean (Phaseolus vulgaris L.). Int J Recycl Org Waste Agric 3:44. doi:10.1007/s40093-014-0044-4 CrossRefGoogle Scholar
  21. Kantachote D, Kowpong K, Charernjiratrakul W, Pengnoo A (2009) Microbial succession in a fermenting of wild forest noni (Morinda coreia Ham) fruit plus molasses and its role in producing a liquid fertilizer. Electron J Biotechnol 12. doi:10.2225/vol12-issue3-fulltext-12
  22. Kihal M, Prevost H, Henni DE, Benmechernene Z, Divies C (2007) Carbon dioxide production by Leuconostoc mesenteroides grown in single and mixed culture with Lactococcus lactis in skimmed milk. World J Dairy Food Sci 2:62–68Google Scholar
  23. Kumar V, Gera R (2014) Isolation of a multi-trait plant growth promoting Brevundimonas sp. and its effect on the growth of Bt-cotton. 3 Biotech 4:97–101CrossRefGoogle Scholar
  24. Limanska N, Ivanytsia T, Basiul O, Krylova K, Biscola V, Chobert JM, Ivanytsia V, Haertle T (2013) Effect of Lactobacillus plantarum on germination and growth of tomato seedlings. Acta Physiol Plant 35:1587–1595CrossRefGoogle Scholar
  25. Liu Y, Shi J, Feng Y, Yang X, Li X, Shen Q (2013) Tobacco bacterial wilt can be biologically controlled by the application of antagonistic strains in combination with organic fertilizer. Biol Fertil Soils 49:447–464CrossRefGoogle Scholar
  26. Luthria D, Singh AP, Wilson T, Vorsa N, Banuelos GS, Vinyard BT (2010) Influence of conventional and organic agricultural practices on the phenolic content in eggplant pulp: plant-to-plant variation. Food Chem 121:406–411CrossRefGoogle Scholar
  27. Maeder P, Fliebbach A, Dubois D, Gunst L, Fried P, Niggli U (2002) Soil fertility and biodiversity in organic farming. Science 296:1694–1697CrossRefGoogle Scholar
  28. Mohamed HI, Gomaa EZ (2012) Effect of plant growth promoting Bacillus subtilis and Pseudomonas fluorescens on growth and pigment composition of radish plants (Raphanus sativus) under NaCl stress. Photosynthetica 50:263–272CrossRefGoogle Scholar
  29. Naik N, Sreenivasa MN (2009) Influence of bacteria isolated from panchagavya on seed germination and seed vigour in wheat. Karnataka J Agric Sci 22:231–232Google Scholar
  30. Oliveira AB, Moura CFH, Gomes Filho E, Marco CA, Urban L, Miranda MRA (2013) The impact of organic farming on quality of tomatoes is associated to increased oxidative stress during fruit development. PLoS One 8. doi:10.1371/journal.pone.0056354
  31. Palleroni NJ (1997) Prokaryotic diversity and the importance of culturing. Antonie Van Leeuwenhoek J Microbiol 72:3–19CrossRefGoogle Scholar
  32. Qiu M, Zhang R, Xue C, Zhang S, Li S, Zhang N, Shen Q (2012) Application of bio-organic fertilizer can control Fusarium wilt of cucumber plants by regulating microbial community of rhizosphere soil. Biol Fertil Soils 48:807–816CrossRefGoogle Scholar
  33. Radha TK, Rao DLN (2014) Plant growth promoting bacteria from cow dung based biodynamic preparations. Indian J Microbiol 54:413–418CrossRefGoogle Scholar
  34. Sevilla M, Burris RH, Gunapala N, Kennedy C (2001) Comparison of benefit to sugarcane plant growth and 15N2 incorporation following inoculation of sterile plants with Acetobacter diazotrophicus wild-type and Nif-mutant strains. Mol Plant Microbe Interact 14:358–366CrossRefGoogle Scholar
  35. Simujide H, Aorigele C, Wang CJ, Manda B, Lina M, Wu MY, Li Y, Ge Bai TR (2013) Reduction of food borne pathogens during cattle manure composting with addition of calcium cyanamide. J Environ Eng Landsc 21:77–84CrossRefGoogle Scholar
  36. Spaccini R, Mazzei P, Squartini A, Giannattasio M, Piccolo A (2012) Molecular properties of a fermented manure preparation used as field spray in biodynamic agriculture. Environ Sci Pollut Res 19:4214–4225CrossRefGoogle Scholar
  37. Sreenivasa MN, Naik N, Bhat SN (2009) Beejamrutha: a source for beneficial bacteria. Karnataka J Agric Sci 22:1038–1040Google Scholar
  38. Stewart EJ (2012) Growing unculturable bacteria. J Bacteriol 194:4151–4160CrossRefGoogle Scholar
  39. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729CrossRefGoogle Scholar
  40. Vacheron J, Desbrosses G, Bouffaud ML, Touraine B, Moenne-Loccoz Y, Muller D, Legendre L, Wisniewski-Dye F, Prigent-Combaret C (2013) Plant growth-promoting rhizobacteria and root system functioning. Front Plant Sci 4:356. doi:10.3389/fpls.2013.00356 CrossRefGoogle Scholar
  41. Videira S, Pereira e Silva M, Souza Galisa P, Dias A, Nissinen R, Divan V, Elsas J, Baldani J, Salles J (2013) Culture-independent molecular approaches reveal a mostly unknown high diversity of active nitrogen-fixing bacteria associated with Pennisetum purpureum—a bioenergy crop. Plant Soil 373:737–754CrossRefGoogle Scholar
  42. Yadav A, Gupta R, Garg VK (2013) Organic manure production from cow dung and biogas plant slurry by vermicomposting under field conditions. Int J Recycl Org Waste Agric 2:21. doi:10.1186/2251-7715-2-21 CrossRefGoogle Scholar
  43. Yamada K, Xu HL (2001) Properties and applications of an organic fertilizer inoculated with effective microorganisms. J Crop Prod 3:255–268CrossRefGoogle Scholar
  44. Yan ZH, Jie L, Jing LJ, Cai LY, Fen WX, Jun CZ (2013) Microbial community dynamics during biogas slurry and cow manure compost. J Integr Agric 12:1087–1097CrossRefGoogle Scholar

Copyright information

© The Author(s) 2015

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  • Rangasamy Anandham
    • 1
    • 2
  • Nagaiah Premalatha
    • 1
  • Hyeong Jin Jee
    • 2
  • Hang Yeon Weon
    • 3
  • Soon Wo Kwon
    • 3
  • Ramasamy Krishnamoorthy
    • 1
  • Pandiyan Indira Gandhi
    • 4
  • Yong Ki Kim
    • 2
  • Nellaiappan Olaganathan Gopal
    • 1
  1. 1.Department of Agricultural Microbiology, Agricultural College and Research InstituteTamil Nadu Agricultural UniversityMaduraiIndia
  2. 2.Organic Agriculture Division, National Academy of Agricultural ScienceRural Development AdministrationSuwonRepublic of Korea
  3. 3.Korean Agricultural Culture Collection, National Agro Biodiversity Center, National Academy of Agricultural ScienceRural Development AdministrationSuwonRepublic of Korea
  4. 4.Regional Research StationTamil Nadu Agricultural UniversityVridhachalamIndia

Personalised recommendations