Novel Application of Magnetic Protein: Convenient One-Step Purification and Immobilization of Proteins

Jiang, Min; Zhang, Lujia; Wang, Fengqing; Zhang, Jie; Liu, Guosong; Gao, Bei; Wei, Dongzhi

doi:10.1038/s41598-017-13648-x

Novel Application of Magnetic Protein: Convenient One-Step Purification and Immobilization of Proteins

Article
Open access
Published: 17 October 2017

Volume 7, article number 13329, (2017)
Cite this article

Download PDF

You have full access to this open access article

Scientific Reports

Novel Application of Magnetic Protein: Convenient One-Step Purification and Immobilization of Proteins

Download PDF

Min Jiang¹,
Lujia Zhang^2,3,
Fengqing Wang¹,
Jie Zhang⁴,
Guosong Liu¹,
Bei Gao¹ &
…
Dongzhi Wei¹

14k Accesses
22 Citations
17 Altmetric
1 Mention
Explore all metrics

Abstract

Recently, a magnetic protein was discovered, and a multimeric magnetosensing complex was validated, which may form the basis of magnetoreception. In this study, the magnetic protein was firstly used in biotechnology application, and a novel convenient one-step purification and immobilization method was established. A universal vector and three linker patterns were developed for fusion expression of magnetic protein and target protein. The magnetic protein was absorbed by iron beads, followed by target protein aggregation, purification, and immobilization. GFP, employed as a reporter protein, was successfully purified from cell lysate. Subsequently, three enzymes (lipase, α-L-arabinofuranosidase, pullulanase) with different molecular sizes testified the versatility of this magnetic-based approach. The specific activities of the purified enzymes were distinctly higher than those of the traditionally purified enzymes using affinity chromatography. The lipase immobilized on iron beads presented improved thermostability and enhanced pH tolerance compared to the free enzyme. The immobilized lipase could be easily recovered and reused for maximum utilization. After 20 cycles of reutilization, the magnetically immobilized lipase retained 71% of its initial activity. This investigation may help introduce magnetic protein into biotechnology applications, and the one-step purification and immobilization method may serve to illustrate an economically viable process for industry.

Bioengineering and Biotechnological Applications of Bacterial Magnetic Particles

Application of magnetic nanoparticles in smart enzyme immobilization

Article 15 October 2015

One-step purification and immobilization of extracellularly expressed sortase A by magnetic particles to develop a robust and recyclable biocatalyst

Article Open access 26 July 2017

Introduction

Whether animals can detect Earth’s magnetic field, and how can they orient or migrate by sensing magnetic field, is one of the most controversial topic. Many researchers have attempted to identify the magnetic sensing and search for magnetic receptor^1,2,3. Recently, a magnetic protein biocompass was discovered and reported by Xie, et al.⁴. This biocompass is a multimeric magnetosensing rod-like protein complex, consisting of a novel magnetic receptor and magnetoreception-related photoreceptor cryptochromes. The protein complex has been demonstrated to be widely distributed among species, and believed to inspire technology innovation across multiple fields.

Protein separation and purification are important processes in biotechnology^5,6. Traditional methods, such as isoelectric point, sodium dodecyl sulfate, and gel permeation chromatography have been applied for various kinds of proteins. In the case of low-concentration proteins, separation and purification signify challenging tasks^7,8. Several fusion tags have been developed and the affinity chromatography has provided an efficient way to purify target fusion proteins^9,10,11. Whereas, the high-cost of affinity column and time-consuming manipulation restrict the large-scale usability of this technique. Immobilization of proteins, especially enzymes, is routinely performed since it facilitates the recovery and reuse of expensive enzymes and improves cost-effectiveness^12,13. Although many attempts have been made to exploit and optimize immobilization methods^14,15,16, iron oxide nanoparticles with uniquely large surface-to-volume ratio and quantum size effects offer a quick, convenient, and economical method for immobilizing enzymes^17,18. Nevertheless, prior enzyme purification is necessary, followed by magnetic immobilization, which places a heavy burden on industrial application. Consequently, one-step purification and immobilization has emerged as required. Ni²⁺-functionalized Fe₃O₄@polydopamin nanoparticles were developed for his-tagged proteins¹⁹. Amino-functionalized MCFs were produced and adhered to aldehyde-tagged enzyme²⁰. DNA aptamer-linked magnetic beads were obtained and applied to β-glucuronidases²¹. However, appropriate surface modification of iron oxide nanoparticles or mesocellular siliceous foam should be completed and evaluated before purification and immobilization, and the instability of modified nanoparticles restrict their repeated use.

In this study, the magnetic protein was used in biotechnology application for the first time. A universal vector for fusion expression of magnetic protein and target proteins was constructed, and a method using iron beads (no need for modification) for purification and immobilization of fusion proteins was developed, followed by experimental validation with GFP. Furthermore, several enzymes with different molecular sizes were employed to testify the versatility of this method. The detailed characteristics of immobilization enzyme were investigated as well. Our work provides a novel convenient method that can be exploited for numerous other protein purification and immobilization applications.

Results

Heterologous expression and purification of clMagR and dMagR

Recombinant strains (BL21-pET28a-clMagR, BL21-pET28a-dMagR) were grown in LB medium supplemented with appropriate antibiotic. After induction for 18 h, the recombinant clMagR and dMagR were overexpressed as soluble proteins (Fig. 1). Fe₃O₄-SiO₂ nanoparticles were used to absorb and purify the clMagR and dMagR proteins. As shown in Fig. 1, both the purified clMagR and dMagR migrated as a single band on SDS-PAGE with an apparent molecular mass of about 14.6 kDa, which was identical to the calculated value. This result demonstrated the high specificity of the magnetic protein binding to iron beads.

Linker selection and purification of the fusion protein (clMagR-GFP)

Since clMagR and dMagR exhibited a similar expression level, clMagR was used to construct a universal vector (Fig. 2). In addition, three linker patterns were designed to purify fusion protein. Figure 3 illustrated that clMagR-GFP, clMagR-flexible linker-GFP, clMagR-rigid linker-GFP were all highly expressed in E. coli, and mainly in soluble forms. After purification with iron beads, the fusion proteins showed an apparent single band of 45 kDa according to SDS-PAGE analysis, which was consistent with the expected molecular mass of clMagR-GFP. Meanwhile, the data from fluorescence microtiter plate reader (Table 1) also indicated that GFP was efficiently expressed and displayed activity. These results indicated that the active GFP was successfully purified from cell lysate through adsorption of clMagR to iron beads.

Table 1 Fluorescence intensity of clMagR-rigid linker-GFP, clMagR-flexible linker-GFP and clMagR-GFP.

Full size table

Furthermore, as illustrated in Table 1, the fluorescence intensity of clMagR-GFP was similar to that of clMagR- flexible linker-GFP, but only a little lower than that of clMagR-rigid linker-GFP. In view of the simplicity and convenience of manipulation, no linker was added between the magnetic protein and the target protein in the following study.

The versatility of magnetic protein as purified label

To expand the application of this purification method, three enzymes with different molecular sizes (lipase gene 549 bp, α-AF gene 1479 bp, pullulanase gene 2766 bp) were chosen as target proteins. SDS-PAGE analysis indicated that clMagR-lipase, clMagR-α-AF and clMagR-pullulanase fusion proteins were all successfully expressed in E. coli. After absorption with Fe₃O₄-SiO₂ nanoparticles, these fusion proteins were effectively purified and showed a single band in SDS-PAGE respectively, which were in accordance with the expected molecular mass (Fig. 4).

The activities of clMagR-lipase, clMagR-α-AF and clMagR-pullulanase fusion proteins were detected. Meanwhile, the activity of free enzymes (without magnetic protein) were purified through Ni-NTA affinity chromatography and tested for comparison. Table 2 presented that the specific activities and purification fold of lipase, α-AF, and pullulanase (purified by Fe₃O₄-SiO₂ nanoparticles) were much higher than that of free enzymes (purified by affinity chromatography), confirming the high specificity of magnetic-based method.

Table 2 Enzyme activity of lipase, α-AF and pullulanase. ^aclMagR-enzymes were purified by iron beads. ^bclMagR was removed from enzymes. ^cFree enzymes were purified by Ni-NTA affinity chromatography. ^dHis tag was removed from free enzymes.

Full size table

The absorption capacity (immobilization efficiency) of iron beads were tested. Different amounts of Fe₃O₄-SiO₂ were added into cell lysates for protein purification. Table 3 illustrated that iron beads had the maximum adsorption capacity of 3.26 mg/g for clMagR-lipase.

Table 3 Effect of the amount of iron beads on immobilization efficiency. ^aclMagR-lipase was used as target protein.

Full size table

Separation of the magnetic protein from the target protein

Thrombin was added to cleave the magnetic protein from target protein. As presented in Fig. 5, after digestion at 37 °C for 1.5 h, or 20 °C for 3.5 h, or 4 °C for 10 h, clMagR (absorbed with iron beads) was completely isolated from lipase and removed by centrifugation. The remaining lipase presented a single band on SDS-PAGE with an apparent molecular mass of 20.1 kDa, which was identical to the calculated value. The appropriate cutting temperature can be selected according to the temperature tolerance of the target protein. The specific activity of the remaining lipase was 1589.1 ± 141.7 U/mg, which was higher than that of free lipase (purified by affinity chromatography, without His tag, Table 2). Similarly, the clMagR label was successfully cleaved from α-AF and pullulanase, and the specific activities of α-AF and pullulanase were also higher than activities of their respective free enzymes (purified by affinity chromatography, without His tag, Table 2). Note that the specific activity of clMagR-removed proteins were a little lower than that of clMagR fusion proteins. This may ascribe to enzymatic activity loss during the label-removing process.

Biochemical characterization of immobilized enzyme

Upon absorption by iron beads, the clMagR-enzyme could be easily separated by centrifugation and reused for the next batch, thus regarding as immobilized enzyme. The characteristics of free lipase, clMagR-lipase (before purification), and immobilized lipase were investigated. As shown in Fig. 6a, the optimum temperature of the free lipase was 40 °C, but the highest enzymatic activity of clMagR-lipase and immobilized lipase were at 50 °C and 55 °C, respectively. Figure 6c clearly indicates that the free lipase exhibited its maximal activity at pH 9.0, while the maximum activity was at pH 10.0 for clMagR-lipase and immobilized lipase. Thermostability of the free lipase, clMagR-lipase, and immobilized lipase was also studied. All enzymes featured a similar trend: the residual activity decreased with increased temperature. However, the immobilized lipase was obviously more stable than free lipase. At 50 °C, the residual activities of the immobilized lipase, clMagR-lipase, and free lipase were 42%, 34%, and 29%, respectively (Fig. 6b). The pH stability of these lipases were determined by incubating the enzymes in various buffers for 12 h. Figure 6d presents that immobilized lipase displayed much better pH tolerance in alkaline conditions than free enzyme. The magnetic immobilized lipase retained 65% of the optimal activity in excess alkali condition of pH 12.0, while the clMagR-lipase and free lipase maintained only 46% and 42%, respectively.

The reusability of clMagR-lipase was studied under constant conditions. As illustrated in Fig. 7, the immobilized lipase maintained nearly 90% of its activity in the first 5 cycles, more than 80% activity after 12 batches, and retained 71% of initial activity even after 20th reuse.

Discussion

It is well-known that many species can perceive navigation cues from geomagnetic fields for the purpose of guidance or navigation²². Recently, Xie et al. reported a putative magnetic receptor and a biocompass model, which may form the basis of magnetoreception in animals⁴. This novel magnetic protein is capable of detecting the magnetic field intensity and presents significant orientation preferences to the geomagnetic field. Such a magnetic protein was believed to inspire plenty of potential applications across different fields. In this study, we first used this magnetic protein as a label for purification and immobilization of other proteins.

For practical and economic reasons, integrating protein purification and immobilization steps draws great concerns in biotechnology and industrial applications²³. Traditional approaches such as immunoaffinity chromatography, metal affinity chromatography, and modified iron oxide nanoparticle immobilization mainly rely on van der Waals interactions, electrostatic interactions, and hydrogen bonding between the protein and the support^24,25,26. Therefore, external environment factors, like ionic strength, pH, and temperature have strong impacts on the purification and immobilization process. Here, we established a novel one-step purification and immobilization method based on magnetic absorption. The penetrability of magnetism is independent of external conditions, thus providing a stable separation and immobilization process that can be extensively used in various conditions like extreme environment. Moreover, traditional methods are costly (affinity chromatography column, modification materials), complex to manipulate, time-consuming (sample loading and elution, modification of the support and evaluation), and contaminate the environment (usage of organic solutions, toxicity of metal iron). Magnetic-absorption-based purification and immobilization in this study could potentially overcome all these drawbacks.

In this study, a universal vector was constructed for fusion expression of magnetic protein and target protein, and GFP was employed as reporter protein to validate this purification method. Generally, linker was used to control the distance and prevent interference between two fusion proteins^27,28. In our work, three linker patterns were designed, and a no-linker pattern was preferred since the low-molecular-size magnetic protein MagR did not affect green fluorescent intensity. Actually, in the subsequent experiments with the target proteins lipase, α-AF, and pullulanase, three linking patterns were all applied. The consistent results (data not shown) indicated that fusion expression with magnetic protein had little effect on target protein activity. Furthermore, to meet high demands of protein application, thrombin site was also introduced, and the target protein could be easily separated from MagR. In addition, the remaining iron beads could be reused continuously and steadily after separating from magnetic protein by boiling in a water bath.

Versatility is of great significance for novel purification approaches. In this work, three enzymes with different molecular sizes were successfully purified and verified the practicability and versatility of this magnetic purification approach. SDS-PAGE analysis suggested that enzymes with lower molecular sizes were easier to purify. The probable reason is that proteins with larger molecular sizes are difficult to pull by MagR. Although the adsorption capacity was not high, using this magnetic-based purification method, the purification fold was much higher than that using Ni-NTA affinity chromatography. Therefore, in the case of low-concentration proteins, the purification method developed in our work has distinct advantages.

The characteristics of immobilized lipase were investigated in this work. In accordance with other immobilization methods^29,30,31, the magnetically immobilized lipase exhibited higher thermostability and pH stability. The enhanced thermal stability could be explained by a more rigid conformation, less denaturation and restricted diffusion of lipase aided through immobilization. Similarly, the increased pH stability can be attributed to the interaction between lipase and iron beads (through MagR), which could reduce drastic conformational changes during pH shifting. Reusability is another prominent advantage of immobilized enzymes, which in turn would commercially benefit biocatalyst applications. Many enzymes immobilized on modified iron oxide nanoparticles could be used for no more than 10 cycles^32,33. This may be attributed to the fact that apart from the detachment between protein and the carrier, the separation of modification material from the support could also result in loss of enzymatic activity. But in the current study, the immobilized lipase maintained over 70% of its initial activity even after 20 cycles.

In summary, the magnetic protein was used in biotechnology for the first time, and a novel one-step protein purification and immobilization method was established in this study. A universal vector and three linker patterns were constructed for fusion expression of magnetic protein and target protein. Several proteins with different molecular sizes were used and verified the practicability of this magnetism-based approach. The detailed report of high purification specificity, improved stability and favorable reusability of immobilized enzyme demonstrated that the magnetic protein-based purification and immobilization method is facile, economical, and stable that can be easily extended to other protein systems. This study is a beneficial attempt and paved a way to apply magnetic protein in biotechnology applications.

Materials and Methods

Bacterial strains and plasmids

Two magnetic protein (MagR) genes were used in this study: clMagR (GenBank Accession No. XP_005508102.1) and dMagR (GenBank Accession No. NP_573062.1), which were synthesized by GenScript (Nanjing, China). E. coli DH5α (Tiangen, Shanghai, China) was used for construction and conventional amplification of plasmids. E. coli BL21 (DE3) (Tiangen) was used for protein expression. Plasmid pET-28a(+) (Novagen, Darmstadt, German) was used to construct the protein expression vector. Genes encoding lipase (GenBank Accession No. KF040967.1), α-L-arabinofuranosidase (α-AF, GenBank Accession No. CP002403.1), pullulanase (GenBank Accession No. KJ740392.1) and green fluorescent protein (GFP, GenBank Accession No. KF410615.1) were preserved in our laboratory.

Chemicals

PrimeSTAR high-fidelity DNA polymerase, T4 DNA ligase, and restriction enzymes were purchased from Takara (Otsu, Japan). ClonExpress II One Step Cloning Kit was provided by Vazyme (Nanjing, China). The substrate 4-nitrophenyl palmitate, substrate 4-nitrophenyl-α-L-arabinofuranoside, substrate pullulan and thrombin were supplied by Sigma-Aldrich (Milwaukee, USA). Other molecular biology reagents and chemicals (analytical grade) were obtained commercially.

Cloning and expression of clMagR and dMagR in E. coli

Both clMagR and dMagR were amplified with the primers clMagRF/clMagRR and dMagRF/dMagRR (Table 4), respectively. After digestion by Nde I/Xho I and EcoR I/Xho I, the clMagR and dMagR genes were cloned into the plasmid pET-28a(+) respectively, which was also digested by the same restriction endonucleases. The positive clones were selected and confirmed by sequencing. The recombinant plasmids pET28a-clMagR and pET28a-dMagR were transformed into E. coli BL21 (DE3).

Table 4 Primers used in this study. ^aThe sequence underlined was introduced.

Full size table

Recombinant cells (BL21-pET28a-clMagR, BL21-pET28a-dMagR) were cultured at 37 °C until the optical density (600 nm) reached 0.6-0.8. IPTG (20 µM) was added to induce clMagR or dMagR expression at 20 °C for 18 h, then the cells were harvested and washed with distilled water. The collected cells were resuspended in TBS buffer (20 mM Tris, 150 mM NaCl, pH 7.5) and disrupted ultrasonically for 15 min. The cell lysate was centrifuged at 4 °C and the supernatant was collected.

Magnetic validation of clMagR and dMagR

The clMagR and dMagR protein were purified by Fe₃O₄-SiO₂ nanoparticles (BeaverBeads, Suzhou, China). 0.1 mL Fe₃O₄-SiO₂ (10 mg/mL) was added into 0.5 mL cell lysate, followed by incubation for 10 min. The resultant precipitation was harvested by centrifugation, and washed three times with TBS buffer to remove the non-adsorptive proteins. Absorbed proteins were detected by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

Construction of a universal plasmid

A universal vector was constructed for fusion expression of magnetic protein and target protein. The pET-28a(+) vector was used as the skeleton. Then fragment I containing the whole clMagR gene was amplified using primers MagRF/MagRR (Table 4) with BamH I and Sac I restriction sites respectively. After digestion, fragment I was reclaimed and connected with pET-28a(+), generating the universal vector p28aMagR, which was validated by DNA sequencing.

Linker design and magnetic purification of GFP

In order to control the distance and reduce interference between the magnetic protein and target protein, three linker patterns were utilized. Rigid linker (AAAGCGAAACTGAAAGAGGAGGAAGAGC GTAAGCAGCGCGAAGAAGAAGACGTATTAAACGTCTGGAAGAACTGGCG AAACGTAAAGAAGAGGAACGCAAA), flexible linker (GGCGGAGGTGGCTCTGGCGGTGGCGGATCG), and no linker were inserted between magnetic protein and target protein, respectively. Meanwhile, thrombin-cleavage site was added to separate magnetic protein from target protein when necessary. Green fluorescent protein (GFP) was selected as a reporter protein to determine the effect of different linkers on fusion protein activity (Fig. 8).

For plasmid construction, firstly, DNA fragments II and VI including the complete ORF of gfp were amplified using primers GFP1F/GFP1R and GFP2F/GFP2R, respectively (Table 4). Secondly, DNA fragments III and VII containing the thrombin digestion sequence + flexible linker and thrombin digestion sequence + rigid linker were synthesized, and applied as templates to amplify DNA fragment IV (primers linker1F/linker1R) and VIII (linker2F/linker2R), respectively. Thirdly, using fragments II + IV, and VI + VIII as templates, fragments V and IX were obtained with primers linker1F/GFP1R and linker2F/GFP2R, respectively. Next, the vector p28aMagR was digested by Sac I and Not I, and then integrated with the uniformly treated fragments V and IX, generating vectors p28aMagR-flexible linker-GFP and p28aMagR-rigid linker-GFP, respectively. Similarly, the gfp gene was amplified with the primers GFP3F/GFP3R. After digestion by Sac I/Not I, the gfp gene was cloned into the plasmid p28aMagR to obtain vector p28aMagR-GFP.

The recombinant plasmids p28aMagR-flexible linker-GFP, p28aMagR-rigid linker-GFP, and p28aMagR-GFP were transformed into E. coli BL21 (DE3) respectively. The vector p28aMagR was expressed in E. coli BL21 (DE3) as control. Transformants were grown and induced with 20 µM IPTG at 20 °C for 10 h. Cells were harvested, washed two times with TBS buffer, and disrupted by ultrasonication. The fusion protein was purified by Fe₃O₄-SiO₂ nanoparticles as described above. Subsequently, the crude extract and the purified fusion protein were analyzed by SDS-PAGE. Meanwhile, 200 μL of MagR-GFP, MagR-flexible linker-GFP, and MagR-rigid linker-GFP solution was transferred to a 96-well microplate, respectively, and then placed in a BioTek^TM Cytation^TM 3 Cell Imaging Multi-Mode Reader (Vermont, USA) with 485 nm excitation and 520 nm emission. GFP signals were read before being processed in Microsoft Excel³⁴.

Purification and activity detection of lipase, α-AF and pullulanase

In order to confirm the universality of this purification method, lipase, α-AF, and pullulanase with different molecular sizes were selected as target proteins. Primers lipaseF/lipaseR, AFF/AFR, pulluF/pulluR (Table 4), with Sal I and Xho I digestion sites, were synthesized to amplify the complete ORF of genes coding lipase, α-AF and pullulanase, respectively. Meanwhile, a thrombin digestion sequence was introduced in the 5’ end of these genes. The purified PCR products were digested with Sal I and Not I and integrated into universal vector p28aMagR, creating p28aMagR-lipase, p28aMagR-α-AF and p28aMagR-pullulanase, respectively.

Meanwhile, the coding sequence of lipase, α-AF and pullulanase were amplified with the primers 28a-lipaseF/28a-lipaseR, 28a-AFF/28a-AFR, and 28a-pulluF/28a-pulluR, respectively. These PCR products were digested and cloned into plasmid pET28a (+), creating pet28a-lipase, pet28a-α-AF, and pet28a-pullulanase as comparison.

The recombinant vectors were transformed into E. coli BL21 (DE3) respectively. IPTG (0.1 mmol/L) was added to induce the cultures at 20 °C for 16 h. The cells were collected by centrifugation, washed with TBS buffer twice, and then disrupted by ultrasonication. The fusion proteins (MagR + lipase/α-AF/pullulanase) were purified by Fe₃O₄-SiO₂ nanoparticles as described above (Fig. 9). Subsequently, the crude extracts and the purified fusion proteins were analyzed by SDS-PAGE. The free enzymes (without MagR) were purified using Ni-NTA sepharose column (Qiagen, Dusseldorf, Germany) according to the manufacturer’s protocol³⁵. The protein concentrations were determined using BCA Protein Assay kit (Biotech Well, Shanghai, China) with bovine serum albumin (BSA) as a standard.

Lipase activity was determined according to the method described by Cai et al.³⁶. One unit of lipase activity is defined as the amount of enzyme liberate 1 μmol p-nitrophenol per min from 4-nitrophenyl palmitate under the assay conditions. The α-AF activity was assayed in accordance with Yang et al.³⁷. One unit of α-AF activity is defined as the amount of enzyme releasing 1 μmol p-nitrophenol per min using 4-nitrophenyl α-L-arabinofuranoside as substrate. The activity of pullulanase was estimated using the 3,5-dinitrosalicylic acid (DNS) method³⁸. One unit of pullulanase activity is defined as the amount of enzyme required to release 1 µmol of glucose equivalent of reducing sugar per minute under the assay conditions.

To study the absorption capacity (immobilization efficiency) of iron beads, 0 mg, 0.5 mg, 1 mg, 1.5 mg and 2 mg Fe₃O₄-SiO₂ nanoparticles were added into the 1 mL cell lysate respectively, and incubated at room temperature for 10 min. The resulting precipitate was harvested and washed three times with TBS buffer to remove the non-adsorptive proteins. The bead-adsorbed protein was boiled for 5 min, and separated from iron beads by centrifugation. The supernatant protein concentrations were determined using BCA Protein Assay kit (Biotech Well, Shanghai, China) with bovine serum albumin (BSA) as a standard.

Separation of magnetic protein from target proteins

E. coli BL21 expressing p28aMagR-lipase, p28aMagR-α-AF, or p28aMagR-pullulanase were harvested and disrupted ultrasonically. The fusion proteins were purified with iron beads and then resuspended in 20 mM Tris-HCl buffer (NaCl 150 mM, pH 8.0). Subsequently, appropriate amount of thrombin (about 0.2 U) was added into 0.1 mL of fusion protein solution. The reaction mixture was incubated at different temperatures (4 °C, 20 °C, or 37 °C) for a certain period of time (10 h, 3.5 h or 1.5 h). Finally, the iron beads with MagR protein were removed by centrifugation. The supernatants containing lipase, α-AF, or pullulanse were analyzed and detected by activity measurement respectively. Meanwhile, the free enzymes (with His tag, without MagR) were purified using Ni-NTA sepharose column. Subsequently, appropriate amount of thrombin (about 0.5 U) was added into 0.1 mL of free enzymes solution. The reaction mixture was incubated at 37 °C for 1.5 h. Finally, the activities of free enzymes (without His tag) were detected for comparison.

One-step purification and immobilization of lipase

The purification and immobilization of lipase was realized by the physical adsorption of iron beads and magnetic protein. The enzymatic properties and reusability of fusion lipase (clMagR-lipase) that immobilized on iron beads were analyzed. The characteristics of free lipase (purified by Ni-NTA affinity chromatography) and clMagR-lipase (before purification) were investigated for comparison. The optimum temperature for the immobilized lipase and free lipase was determined under standard assay conditions at different temperature (20–60 °C) (pH 9.0). The thermostability was evaluated by measuring the residual activity after incubating the enzymes at various temperatures ranging from 20 °C to 60 °C for 12 h in Tris-HCl buffer (pH 9.0). Similarly, to determine the optimum pH, immobilized lipase and free lipase activities were studied over a pH range of 5.0–12.0 at 40 °C. The pH stability was investigated by incubating the enzyme in different buffers for 12 h at 4 °C and the residual activity was measured as previously described. The following buffers were used: 50 mM citrate buffer (pH 5.0–6.0), 50 mM sodium phosphate buffer (pH 6.0–7.0), 50 mM Tris–HCl buffer (pH 8.0–9.0), and 50 mM glycine-NaOH buffer (pH 10.0–12.0).

The reusability of the immobilized lipase was measured under constant conditions. Immobilized enzyme was recovered from the reaction media by centrifugal separation and washed with TBS buffer for the next batch. The reaction was conducted for a total of 20 batches, where the activity of the first run was defined as 100%.

References

Maeda, K. et al. Chemical compass model of avian magnetoreception. Nature. 453, 387–390 (2008).
Article ADS CAS PubMed Google Scholar
Rodgers, C. T. & Hore, P. J. Chemical magnetoreception in birds: The radical pair mechanism. Proc. Natl. Acad. Sci. 106, 353–360 (2009).
CAS Google Scholar
Solov’yov, I. A., Mouritsen, H. & Schulten, K. Acuity of a cryptochrome and vision-based magnetoreception system in birds. Biophys. J. 99, 40–49 (2010).
Article ADS PubMed PubMed Central Google Scholar
Qin, S. Y. et al. A magnetic protein biocompass. Nature Materials. 15, 217–226 (2016).
Article ADS CAS PubMed Google Scholar
Ni, K. F., Yang, J. B., Ren, Y. H. & Wei, D. Z. Facile synthesis of glutathione-functionalized Fe3O4@polydopamine for separation of GST-tagged protein. Materials Letters. 128, 392–395 (2014).
Article CAS Google Scholar
Zhang, T. et al. Purification and characterization of a novel phloretin-2′-O-glycosyltransferase favoring phloridzin biosynthesis. Sci. Rep. 6, 35274 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Ghosh, R. Protein separation using membrane chromatography: Opportunities and challenges. J. Chromatogr A. 952, 13–27 (2002).
Article CAS PubMed Google Scholar
Palani, A. et al. Selective enrichment of cysteine-containing peptides using SPDP-functionalized superparamagnetic Fe₃O₄@SiO₂ nanoparticles: application to comprehensive proteomic profiling. J. Proteome. Res. 7, 3591–3596 (2008).
Article CAS PubMed Google Scholar
Muir, T. W., Sondhi, D. & Cole, P. A. Expressed protein ligation: A general method for protein engineering. Proc. Natl. Acad. Sci. 95, 6705–6710 (1998).
CAS Google Scholar
Terpe, K. Overview of tag protein fusions: From molecular and biochemical fundamentals to commercial systems. Appl. Microbiol. Biotechnol. 60, 523–533 (2003).
Article CAS PubMed Google Scholar
Castaldo, M., Barlind, L., Mauritzson, F., Wan, P. T. & Snijder, H. J. A fast and easy strategy for protein purification using “teabags”. Sci. Rep. 6, 28887–28890 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Lu, S. W., Khan, F. & Micklefield, J. Selective covalent protein immobilization: strategies and applications. Chem. Rev. 40, 4025–4053 (2009).
Google Scholar
Jia, F., Narasimhan, B. & Mallapragada, S. Materials-based strategies for multi-enzyme immobilization and co-localization: a review. Biotechnol. Bioeng. 111, 209–222 (2014).
Article CAS PubMed Google Scholar
Chen, F. F. et al. A novel and efficient method for the immobilization of thermolysin using sodium chloride salting-in and consecutive microwave irradiation. Bioresour. Technol. 115, 158–163 (2012).
Article CAS PubMed Google Scholar
Kumada, Y. et al. Identification and characterization of polydimethylsiloxane-binding peptides (PDMS-tag) for oriented immobilization of functional protein on a PDMS surface. J. Biotechnol. 236, 193–198 (2016).
Article CAS PubMed Google Scholar
Gao, J. K. et al. Dopamine-functionalized mesoporous onion-like silica as a new matrix for immobilization of lipase Candida sp. 99-125. Sci. Rep. 7, 40395–40403 (2017).
Article ADS CAS PubMed PubMed Central Google Scholar
Chien, L. J. & Lee, C. K. Biosilicification of dual-fusion enzyme immobilized on magnetic nanoparticle. Biotechnol. Bioeng. 100, 223–230 (2008).
Article CAS PubMed Google Scholar
Xie, W. L. & Zang, X. Z. Immobilized lipase on core–shell structured Fe₃O₄-MCM-41 nanocomposites as a magnetically recyclable biocatalyst for interesterification of soybean oil and lard. Food. Chem. 194, 1283–1292 (2016).
Article CAS PubMed Google Scholar
Yang, J. B., Ni, K., Wei, D. Z. & Ren, Y. H. One-step purification and immobilization of his-tagged protein via Ni²⁺-functionalized Fe₃O₄@polydopamine magnetic nanoparticles. Biotechnol. Bioprocess. Eng. 20, 901–907 (2015).
Article CAS Google Scholar
Wang, A. et al. Convenient one-step purification and immobilization of lipase using a genetically encoded aldehyde tag. Biochem. Eng. J. 73, 86–92 (2013).
Article CAS Google Scholar
Qiao, L. F., Lv, B., Feng, X. D. & Li, C. A new application of aptamer: One-step purification andimmobilization of enzyme from cell lysates for biocatalysis. J. Biotechnol. 203, 68–76 (2015).
Article CAS PubMed Google Scholar
Wiltschko, W. & Wiltschko, R. Magnetic orientation and magnetoreception in birds and other animals. J. Comp. Physiol. 191, 675–693 (2005).
Article MATH Google Scholar
Eş, I., Vieira, J. D. & Amaral, A. C. Principles, techniques, and applications of biocatalyst immobilization for industrial application. Appl. Microbiol. Biotechnol. 99, 2065–2082 (2015).
Article PubMed Google Scholar
Cassimjee, K. E. et al. One-step enzyme extraction and immobilization for biocatalysis applications. Biotechnol. J. 6, 463–469 (2011).
Article CAS PubMed Google Scholar
Tural, S., Tural, B. & Demir, A. S. Heterofunctional magnetic metal-chelate-epoxy supports for the purification and covalent immobilization of benzoylformate decarboxylase from pseudomonas putida and its carboligation reactivity. Chirality. 27, 635–642 (2015).
Article CAS PubMed Google Scholar
Ni, K. F. et al. A novel technique for in situ aggregation of gluconobacter oxydans using bio-adhesive magnetic nanoparticles. Biotechnol. Bioeng. 109, 2970–2977 (2012).
Article CAS PubMed PubMed Central Google Scholar
Reddy Chichili, V. P., Kumar, V. & Sivaraman, J. Linkers in the structural biology of protein-protein interactions. Protein Science. 22, 153–167 (2013).
Article CAS PubMed Google Scholar
Li, G. et al. Construction of a linker library with widely controllable flexibility for fusion protein design. Appl. Microbiol. Biotechnol. 100, 215–225 (2016).
Article CAS PubMed Google Scholar
Agyei, D., Tambimuttu, S., Kasargod, B., Gao, Y. & He, L. Quick and low cost immobilization of proteinases on polyesters: Comparison of lactobacilli cell-envelope proteinase and trypsin for protein degradation. J. Biotechnol. 188, 53–60 (2014).
Article CAS PubMed Google Scholar
Jackson, E., López-Gallego, F., Guisand, J. M. & Betancor, L. Enhanced stability of l-lactate dehydrogenase through immobilization engineering. Process. Biochem. 51, 1248–1255 (2016).
Article CAS Google Scholar
Thais, S. S. et al. Immobilization and stabilization of an endoxylanase from Bacillus subtilis (XynA) for xylooligosaccharides (XOs) production. Catalysis. Today. 259, 130–139 (2016).
Article Google Scholar
Juang, T. Y. et al. Surface-functionalized hyperbranched poly(amido acid) magnetic nanocarriers for covalent immobilization of a bacterial γ-glutamyltranspeptidase. Molecules. 19, 4997–5012 (2014).
Article PubMed Google Scholar
Soozanipour, A., Taheri-Kafrani, A. & Isfahani, A. L. Covalent attachment of xylanase on functionalized magnetic nanoparticles and determination of its activity and stability. Chem. Eng. J. 270, 235–243 (2015).
Article CAS Google Scholar
Hung, C. W., Holoman, T., Kofinas, P. & Bentley, W. E. Towards oriented assembly of proteins onto magnetic nanoparticles. Biochem. Eng. J. 38, 164–170 (2008).
Article CAS Google Scholar
Wu, J. P., Li, M., Zhou, Y., Yang, L. R. & Xu, G. Introducing a salt bridge into the lipase of Stenotrophomonas maltophilia results in a very large increase in thermal stability. Biotechnol. Lett. 37, 403–407 (2015).
Article CAS PubMed Google Scholar
Cai, X. H., Ma, J., Wei, D. Z., Lin, J. P. & Wei, W. Functional expression of a novel alkaline-adapted lipase of Bacillus amyloliquefaciens from stinky tofu brine and development of immobilized enzyme for biodiesel production. Antonie. van. Leeuwenhoek. 106, 1049–1060 (2014).
Article CAS PubMed Google Scholar
Yang, Y. et al. Characterization of a novel α-L-arabinofuranosidase from Ruminococcus albus 7 and rational design for its thermostability. J. Agr. Food. Chem. 64, 3069–3074 (2016).
Google Scholar
Wei, W., Ma, J., Chen, S. Q., Cai, X. H. & Wei, D. Z. A novel cold-adapted type I pullulanase of Paenibacillus polymyxa Nws-pp2: in vivo functional expression and biochemical characterization of glucans hydrolyzates analysis. BMC. Biotechnol. 15, 1–13 (2015).
Article Google Scholar

Download references

Acknowledgements

This work was funded by Natural Science Foundation of Shanghai (No. 16ZR1449500), the National High Technology Research and Development Program of China (No. 2013AA102109), and the National Natural Foundation of China (No. 31571786).

Author information

Authors and Affiliations

State Key Lab of Bioreactor Engineering, New World Institute of Biotechnology, East China University of Science and Technology, Shanghai, 200237, China
Min Jiang, Fengqing Wang, Guosong Liu, Bei Gao & Dongzhi Wei
School of Chemistry and Molecular Engineering, East China Normal University, Shanghai, 200062, China
Lujia Zhang
NYU-ECNU Center for Computational Chemistry at NYU Shanghai, Shanghai, 200062, China
Lujia Zhang
School of Physics and Materials Science, East China Normal University, Shanghai, 200062, China
Jie Zhang

Authors

Min Jiang
View author publications
You can also search for this author in PubMed Google Scholar
Lujia Zhang
View author publications
You can also search for this author in PubMed Google Scholar
Fengqing Wang
View author publications
You can also search for this author in PubMed Google Scholar
Jie Zhang
View author publications
You can also search for this author in PubMed Google Scholar
Guosong Liu
View author publications
You can also search for this author in PubMed Google Scholar
Bei Gao
View author publications
You can also search for this author in PubMed Google Scholar
Dongzhi Wei
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Min Jiang and Bei Gao designed experiments. Min Jiang and Guosong Liu performed the experiments. Lujia Zhang and Jie Zhang provided technical assistance. Bei Gao, Fengqin Wang and Dongzhi Wei contributed reagents and materials. Min Jiang and Bei Gao drafted the manuscript. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Bei Gao or Dongzhi Wei.

Ethics declarations

Competing Interests

The authors declare that they have no competing interests.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Jiang, M., Zhang, L., Wang, F. et al. Novel Application of Magnetic Protein: Convenient One-Step Purification and Immobilization of Proteins. Sci Rep 7, 13329 (2017). https://doi.org/10.1038/s41598-017-13648-x

Download citation

Received: 23 May 2017
Accepted: 26 September 2017
Published: 17 October 2017
DOI: https://doi.org/10.1038/s41598-017-13648-x
Springer Nature Limited

This article is cited by

Immobilization and stabilization of enzymes using biomimetic silicification reactions
- Cecilia Ortiz
- Erienne Jackson
- Lorena Betancor
Journal of Sol-Gel Science and Technology (2022)
Functional Immobilization of a Biofilm-Releasing Glycoside Hydrolase Dispersin B on Magnetic Nanoparticles
- Zewen Liu
- Zisong Zhao
- Hao Xie
Applied Biochemistry and Biotechnology (2022)
Modulation of MagR magnetic properties via iron–sulfur cluster binding
- Zhen Guo
- Shuai Xu
- Can Xie
Scientific Reports (2021)
Microbial lipolytic fusion enzymes: current state and future perspectives
- Renata Gudiukaite
- Alisa Gricajeva
World Journal of Microbiology and Biotechnology (2017)

Novel Application of Magnetic Protein: Convenient One-Step Purification and Immobilization of Proteins

Abstract

Similar content being viewed by others

Bioengineering and Biotechnological Applications of Bacterial Magnetic Particles

Application of magnetic nanoparticles in smart enzyme immobilization

One-step purification and immobilization of extracellularly expressed sortase A by magnetic particles to develop a robust and recyclable biocatalyst

Introduction

Results

Heterologous expression and purification of clMagR and dMagR

Linker selection and purification of the fusion protein (clMagR-GFP)

The versatility of magnetic protein as purified label

Separation of the magnetic protein from the target protein

Biochemical characterization of immobilized enzyme

Discussion

Materials and Methods

Bacterial strains and plasmids

Chemicals

Cloning and expression of clMagR and dMagR in E. coli

Magnetic validation of clMagR and dMagR

Construction of a universal plasmid

Linker design and magnetic purification of GFP

Purification and activity detection of lipase, α-AF and pullulanase

Separation of magnetic protein from target proteins

One-step purification and immobilization of lipase

References

Acknowledgements

Author information

Authors and Affiliations

Contributions

Corresponding authors

Ethics declarations

Competing Interests

Additional information

Rights and permissions

About this article

Cite this article

Share this article

This article is cited by

Immobilization and stabilization of enzymes using biomimetic silicification reactions

Functional Immobilization of a Biofilm-Releasing Glycoside Hydrolase Dispersin B on Magnetic Nanoparticles

Modulation of MagR magnetic properties via iron–sulfur cluster binding

Microbial lipolytic fusion enzymes: current state and future perspectives

Search

Navigation