Advertisement

Acta Neuropathologica

, Volume 137, Issue 5, pp 693–714 | Cite as

Post-stroke inflammation—target or tool for therapy?

  • Kate Lykke LambertsenEmail author
  • Bente Finsen
  • Bettina Hjelm Clausen
Open Access
Review

Abstract

Inflammation is currently considered a prime target for the development of new stroke therapies. In the acute phase of ischemic stroke, microglia are activated and then circulating immune cells invade the peri-infarct and infarct core. Resident and infiltrating cells together orchestrate the post-stroke inflammatory response, communicating with each other and the ischemic neurons, through soluble and membrane-bound signaling molecules, including cytokines. Inflammation can be both detrimental and beneficial at particular stages after a stroke. While it can contribute to expansion of the infarct, it is also responsible for infarct resolution, and influences remodeling and repair. Several pre-clinical and clinical proof-of-concept studies have suggested the effectiveness of pharmacological interventions that target inflammation post-stroke. Experimental evidence shows that targeting certain inflammatory cytokines, such as tumor necrosis factor, interleukin (IL)-1, IL-6, and IL-10, holds promise. However, as these cytokines possess non-redundant protective and immunoregulatory functions, their neutralization or augmentation carries a risk of unwanted side effects, and clinical translation is, therefore, challenging. This review summarizes the cell biology of the post-stroke inflammatory response and discusses pharmacological interventions targeting inflammation in the acute phase after a stroke that may be used alone or in combination with recanalization therapies. Development of next-generation immune therapies should ideally aim at selectively neutralizing pathogenic immune signaling, enhancing tissue preservation, promoting neurological recovery and leaving normal function intact.

Keywords

Cytokines Ischemia Immune therapy Drugs Neuroprotection 

Abbreviations

Ab

Antibody

ATROSAB

Antagonistic TNF receptor one-specific antibody

BBB

Blood brain barrier

DWI

Diffusion-weighted imaging

gp130

Glycoprotein 130

icIL-1Ra

Intracellular interleukin-1 receptor antagonist

IL

Interleukin

IL-1R

Interleukin-1 receptor

IL-1Ra

Interleukin-1 receptor antagonist

IL-1RAcP

Interleukin-1 receptor accessory protein

IL-6R

Interleukin-6 receptor

IL-10R

Interleukin-10 receptor

i.c.v.

Intracerebroventricular

i.v.

Intravenous

ko

Knock out

LTα

Lymphotoxin-alpha

MCA

Middle cerebral artery

MCAO

Middle cerebral artery occlusion

NF-κB

Nuclear factor-kappa B

PET

Positron emission tomography

pMCAO

Permanent middle cerebral artery occlusion

PMN

Polymorphonuclear

PWI

Perfusion-weighted imaging

r

Recombinant

rh

Recombinant human

s.c.

Subcutaneous

sgp130

Soluble glycoprotein 130

sIL-1Ra

Secreted interleukin-1 receptor antagonist

sIL-6R

Soluble interleukin-6 receptor

solTNF

Soluble tumor necrosis factor

TACE

Tumor necrosis factor-alpha converting enzyme

TfR

Transferrin receptor

tmTNF

Transmembrane tumor necrosis factor

TNF

Tumor necrosis factor

TNFR

Tumor necrosis factor receptor

tMCAO

Transient middle cerebral artery occlusion

TROS

TNF receptor one silencer

Ischemic stroke

Ischemic stroke is the second leading cause of preventable deaths and the third leading cause of long-term disability worldwide [84]. This review focuses on the possibility of targeting post-stroke inflammation to improve tissue preservation, neurological outcome, and long-term survival. Ischemic stroke, accounting for approx. 90% of all stroke cases [84], is caused by embolism or thrombosis of a cerebral artery. This typically occurs in the middle cerebral artery (MCA), which supplies the lateral convexity of the cerebral hemisphere and thereby the majority of the primary motor and sensory cortex, leading to contralateral hemiplegia with reduced sensation. Today, recanalization by intravenous (i.v.) thrombolysis and thrombectomy are first-line treatments for ischemic stroke patients [95]. One of the major criteria for i.v. thrombolysis is the 4.5-h ‘therapeutic time window’, although the recent DAWN and DEFUSE 3 trials, which combine thrombectomy and i.v. thrombolysis, suggest expanding the therapeutic window up to 24 h when using perfusion imaging to guide treatment [2, 127]. Importantly, these studies additionally document that restoring perfusion not only leads to smaller infarcts, but that smaller infarcts correlate with a better neurological outcome [2, 127]. Given the low number of stroke patients eligible for treatment using thrombolysis and/or thrombectomy (approx. 10%), novel treatment options are critically needed. New therapies targeting key pathogenic mechanisms, including post-stroke inflammation, are currently being pursued experimentally and clinically, either alone or in combination with thrombolysis and/or thrombectomy [23]. Such treatments might also benefit stroke patients with good collateral blood supply who suffer permanent ischemia or patients in whom recanalization treatment is contraindicated.

The ischemic penumbra as target for post-stroke intervention

The ischemic penumbra consists of electrophysiologically silenced, potentially salvageable tissue [7], that can be assessed clinically using the “mismatch” between perfusion- and diffusion-weighted magnetic resonance images (PWI–DWI mismatch) [142] or positron emission tomography (PET) [77]. The cerebral metabolic rates for oxygen measured by PET define cerebral blood flow in cortical grey matter below 12 ml/100 g/min as infarct core, flow between 12 and 22 ml/10 g/min as critically hypoperfused penumbral tissue, and flow between 22 and 35 ml/100 g/min as an area of oligemia, i.e. hypoperfused tissue without risk for infarction [77]. This should be compared to the flow in normal grey matter, which is between 50 and 55 ml/100 g/min [95]. In tissue sections, the penumbra is defined as areas with reduced protein synthesis but preserved ATP content. This matches brain areas with transient heat shock protein 70 mRNA expression from 3 to 4 h after MCA occlusion (MCAO) [74, 75]. Using these definitions, the penumbra presents 30% of the final infarct volume at 1 h, approx. 18% at 6 h, and 5% at 24 h after permanent MCAO (pMCAO) [74]. After transient MCAO (tMCAO), the penumbra is initially increased as a result of edema associated with reperfusion, after which it is gradually recruited into the infarct and regresses to the final infarct volume at day 3 [75]. In rats, the infarct volume measured at 24 h after proximal pMCAO is significantly larger than after 60 min of proximal tMCAO, but is similar to that observed after 180 min of proximal tMCAO [112].

By showing that the therapeutic window can be expanded, the DAWN and DEFUSE 3 trial results, combining the use of thrombectomy and thrombolysis [2, 127], have ‘thrown the ball back in the ring’ in experimental stroke research. Some tMCAO models mirror thrombectomy in terms of reperfusion dynamics (review by [107]), encouraging testing of novel combination treatments. Furthermore, the clinical documentation that smaller infarcts translate into better neurological outcome [2, 127] emphasizes the importance of infarct volume reduction, ideally in conjunction with improved functional recovery, as an important outcome in experimental stroke research. The size of ischemic damage is typically presented as: 1—total infarct volume (‘direct infarct volume’ given in mm3), or 2—percentage of infarcted tissue in the ipsilateral hemisphere, corrected for edema formation and infarct resorption (‘indirect infarct volume’) (for details see [140]). Infarct volumes given as percentages and corrected for edema/resorption remain largely constant from 24 h to 24 weeks [140]. Direct infarct volumetric data obtained at 24 h after occlusion are robust, while data obtained at 5 days represents the cumulative effect of infarct formation and resorption [94, 140].

The inflammatory response in stroke

Inflammation is integral to the pathophysiology of ischemic stroke and a prime target for the development of new stroke therapies. The first immune cells to sense a stroke are the brain-resident microglial cells, which are innate immune cells that are perfectly situated and equipped to sense imbalances in the CNS. Microglia express receptors that are involved in immune signaling and modulation, recognition of danger signals elicited from dying cells, pathogens and self-antigens, as well as neurotransmitter receptors in both human [56] and mouse [78]. Like other cells, the microglia are sensitive to ischemia. 12 h after pMCAO, CD11b+ microglia in the infarct show signs of fragmentation, and by 24 h the number of microglia within the infarct is reduced [81, 94]. Microglia in the ‘peri-infarct’ show signs of activation in the form of process retraction from 30 min to 1 h after pMCAO, followed by upregulation of CD11b, CD45 and Iba1 in the peri-infarct from 3.5 to 6 h [32, 81, 94], where also the first CD11b+ macrophage-like cells (and Gr1+ neutrophils) appear [32, 94]. Microglial activation in the peri-infarct persists weeks after MCAO [94, 131]. Importantly, the microglia in the peri-infarct and infarct display different pro- and anti-inflammatory phenotypes [32, 33, 115], which include the expression of the pro-inflammatory cytokines tumor necrosis factor (TNF), interleukin (IL)-1β, and the anti-inflammatory IL-1 receptor antagonist (IL-1Ra) (Fig. 1) [32, 33, 92]. Microglia appear not to display classical M1 and M2 phenotypes after experimental stroke [61]. During later stages microglia, like monocytic macrophages, contribute to the resolution of the infarct by phagocytosing dead cells or debris, which is considered beneficial (review by [124]). However, microglia can also engulf viable ischemic neurons, that transiently express “eat-me” signals [122], and if dysregulated thereby increase neuronal cell death in the peri-infarct.
Fig. 1

Neuroinflammation in the post-ischemic human and murine brain. ac Immunohistochemical staining of CD45+ (a), Iba1+ (b), and CD68+ (c) microglia/macrophages in human post-mortem ischemic brain tissue. di Immunohistochemical staining of TNF+ (d), TNFR1+ (e), TNFR2+ (f), IL-1β+ (g), IL-1α+ (h), and IL-1Ra+ (i) cells in human post-mortem ischemic brain tissue. (j, k) Immunofluorescence double staining showing co-localization of IL-6 to NeuN+ neurons (j), but absence of IL-6 to CD11b+ microglia/macrophages (k) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN+ neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [31, 33] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG2A, clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in [70]. In images ai, Toluidine blue was used as a counterstain and in jl, DAPI was used as a nuclear marker. Scale bars: a, i = 40 μm, j = 20 μm, and k, l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

The infiltrating leukocytes, predominantly polymorphonuclear leukocytes (PMNs, neutrophils) and monocytes/macrophages, play different and complex roles in ischemic stroke. Neutrophils infiltrate early after MCAO [26]. They attach to the endothelium by binding different adhesion molecules (review by [125]), and with CXCL1 and CXCL2 as the main chemokines responsible for neutrophil extravasation [176]. Neutrophils expressing Ly6G and myeloperoxidase have been identified in the leptomeninges from 6 h after occlusion, thereafter in the Virchow–Robin spaces and superficial cortical layers, to eventually become widespread in the infarct and peri-infarct [133, 176]. In rodent pMCAO models, the number of neutrophils in infarct and peri-infarct peaks at 24 h and gradually decreases from 48 to 72 h [133, 176]. Differences in the peak of neutrophil recruitment have been reported between pMCAO and tMCAO [198]. Neutrophil accumulation has traditionally been considered detrimental post-stroke, either through the release of neurotoxic proteolytic enzymes [4] or neutrophil accumulation causing further blood flow obstruction and the ‘no-reflow’ phenomenon (reviewed in [39]). Neutrophils have also been shown to cause disruption of the blood–brain barrier (BBB) and hemorrhagic transformation post-stroke, worsening the neurological outcome [83]. Blockade of neutrophil recruitment has been shown to improve the functional outcome in rodent stroke models [83]. Neutropenia does not affect infarct size after MCAO [76] however, and none of the anti-neutrophil therapies tested so far have shown a beneficial effect in stroke patients [83]. Interestingly, neutrophils appear to display different phenotypes (neurotoxic N1 and neuroprotective N2) that may shape the effector functions of other cells and they are themselves cleared by phagocytic microglia/macrophages, which is considered important for the resolution of inflammation post-stroke [36]. Therefore, inhibiting neutrophil recruitment could also prove damaging if applied at the wrong time point.

Recruitment of circulating monocytes to the ischemic brain equals that of neutrophils and is regulated by adhesion molecules, chemokines, and cytokines. CD11b+Ly6ChighCCR2+ monocytes appear to be the predominant cell type recruited after both pMCAO and tMCAO [27, 116]. Recruitment after tMCAO takes place in a CCR2-dependent manner [41], while this appears not to be the case after pMCAO [27]. Histologically, CD11b+ and CD45+ macrophage-like cells are observed both in the infarct and peri-infarct from 6 to 48 h after pMCAO [94, 131]. From 3 to 7 days after occlusion the infarct becomes infiltrated with CD11b+, CD45+, and ED1+ macrophages, reminiscent of phagocytic ‘foam cells’ that are prominent in the infarct [81, 94]. Interestingly, when in the brain the Ly6ChighCCR2+ monocytes change their phenotype by downregulating Ly6C expression, upregulating F4/80, and then expressing arginase-1 and the chitinase-like protein YM-1, thereby developing into M2 phenotype macrophages [116]. This occurs from 1 to 3 days after pMCAO [116]. Histologically, Ym1+ and CD206+ cells have been shown to be abundant within the infarct core at 24 h, and to be even more numerous at 7 days, along with cells expressing the lysosomal marker CD68 [131]. This is in line with a role in infarct resolution and repair.

Although monocytes/macrophages have been reported to exacerbate ischemic brain damage in the acute phase after tMCAO [41], blocking the infiltration of Ly6Chigh monocytes (and neutrophils) using a CCR2 antagonist worsened the outcome after tMCAO, which was ascribed to CCR2 antagonism altering the polarization of infiltrated macrophages [27]. Monocytes/macrophages have been suggested to exert beneficial effects in the sub-acute phase after a stroke, by preventing hemorrhagic transformation [63], emphasizing that inhibition of monocyte recruitment might be damaging if done at the wrong time point. To add to the complexity, it appears that subsets of CD11b+CD45high macrophages express different pro- and anti-inflammatory cytokines at different time points after pMCAO [27, 32, 33, 92], raising the potential to modulate this expression and to stimulate the production of anti-inflammatory cytokines such as IL-1Ra [33]. The emerging understanding of how macrophages are stimulated by the ischemic environment to adopt distinct phenotypes or exert different functions might reveal new therapeutic strategies for controlling inflammation after ischemic injury.

Recent studies have also implicated lymphocytes in the pathogenesis of acute stroke. Since it is largely unknown as yet how these cells affect inflammation in the ischemic brain, the reader is referred to existing reviews on this topic [153].

Cytokines and cytokine therapies in experimental and human stroke

Treatment strategies aimed at preventing ischemia-induced cell death and promoting anti-inflammatory responses in ischemic tissue at risk have been studied both experimentally and in clinical trials (Table 1). Special attention has been given to inflammatory cytokines and the possibility to modulate their pro- or anti-inflammatory properties. Cytokine therapies are based on administration of highly specific engineered antibodies, soluble cytokine receptors, and mutant or fusion proteins that bind and neutralize the activities of a given cytokine (Table 2). A number of drugs targeting the key pro-inflammatory cytokines TNF, IL-1, and IL-6 (Table 2) are already being used in patients for the treatment of non-neurological diseases such as rheumatoid arthritis, inflammatory bowel disease, and psoriasis. As cytokines have both beneficial and detrimental effects, their neutralization can result in unwanted side effects, including predisposing patients to infections, lupus-like syndrome, lymphoma, long-term effects on the cardiovascular system, and demyelinating disease [151]. Therefore, there is a need to develop and evaluate novel therapeutics that can better distinguish between detrimental and protective signaling of a given cytokine. Four cytokines have proven especially promising as potential therapeutic targets in experimental ischemic stroke: the pro-inflammatory cytokines TNF, IL-1, IL-6 and the anti-inflammatory cytokine IL-10.
Table 1

Studies on anti-cytokine treatments in experimental and human stroke

Ischemia model

Strain

Intervention

Results

Target involved

References

TNF system

 Mouse

  Distal pMCAO (electrocoagulation)

C57BL/6

i.v. injection of 10 mg/kg anti-TNF inhibitor (etanercept) or 10 mg/kg anti-solTNF inhibitor (XPro1595) 30 min after occlusion

No change in infarct volume, improved functional outcome

tmTNF and/or solTNF

[30]

  Proximal tMCAO (60 min, filament)

C57BL/6

i.v. injection of 1 mg/kg etanercept or cTfRMab-TNFR 45 or 90 min after occlusion

cTfRMAb-TNFR decreased infarct volume and neural deficits

tmTNF and solTNF

[167]

  Proximal tMCAO (60 min, filament)

C57BL/6

i.v. injection of 1 mg/kg cTfRMab-TNFR and 1 mg/kg cTfRMab-GDNF 45 min after occlusion

cTfRMAb-TNFR and cTfRMAb-GDNF decreased infarct volume

mTNF and solTNF

[168]

  Cortical photothrombosis (i.v. Bengal Rose injection followed by 20 min focal illumination)

C57BL/6

Intracortical infusion of 1 μg/day sTNF-α- R1 for 1 week

sTNF-α- R1 preserved post-stroke deprivation-induced brain plasticity

solTNF (and tmTNF)

[98]

  Distal pMCAO (electrocoagulation)

BALB/c

i.p. or i.v. injection of 3 mg/kg TNF-bp immediately after occlusion

TNF-bp decreased infarct volume

tmTNF and solTNF

[120]

  Distal pMCAO (electrocoagulation)

BALB/c

Topic administration of 3 mg/kg TNF-bp immediately and 1 h after occlusion

TNF-bp decreased infarct volume

tmTNF and solTNF

[121]

 Rat

  Proximal tMCAO (90 min, filament)

Wistar

i.p. injection of 7 mg/kg chimeric anti-TNF mAb (infliximab) or 5 mg/kg anti-TNF (etanercept) 0 and 6 hrs after occlusion

Infliximab and etanercept decreased infarct volume

tmTNF and solTNF

[5]

  Proximal tMCAO (120 min, filament)

SD (diabetic and non-diabetic)

i.p. or i.v. injection of 300, 450, or 900 μg/kg anti-TNF (etanercept) within 24 hrs before or immediately after occlusion

Etanercept administered once before occlusion reduced infarct volume in non-diabetic rats and at 900 μg/kg/daily for 5 weeks prior to occlusion decreased infarct volume in diabetic rats

tmTNF and solTNF

[82]

   Distal tMCAO (occluded and cut)

SHR

10 μg TNF mAb or 12.5 μg solTNFR1, 30 min before and 3 and 6 h after occlusion

TNF mAb and solTNFR1 decreased infarct volumes

tmTNF and solTNF

[8]

   Proximal tMCAO (60 min, filament)

SD

i.v. injection of ex vivo-derived dendritic cells (exDCs) overexpressing solTNFR1 6 h after reperfusion

solTNFR1-exDCs decreased infarct size and inflammation

solTNF and (tmTNF)

[186]

   Proximal tMCAO (120 min, filament)

SD

i.v. injection of 15 mg/kg anti-TNF mAb immediately after reperfusion

Anti-TNF mAb decreased infarct volume and edema

tmTNF and solTNF

[79]

 Human

  Chronic stroke (13-36 months old)

 

Perispinal, interspinous, extrathecal injection of 25 mg anti-TNF (etanercept)

Neurological improvement in all patients (n = 3)

tmTNF and solTNF

[173]

  Chronic stroke (≤3 to >120 months)

 

Perispinal, interspinous, extrathecal injection of 25 mg anti-TNF (etanercept)

Improved motor impairment, spasticity, sensory impairment, cognition, psychological/behavioral function, aphasia, and pain (n=617)

tmTNF and solTNF

[174]

IL-1 system

 Mouse

  Distal tMCAO (30 and 45 min, filament)

C57BL/6

s.c. injection of 100 mg/kg IL-1Ra 30 or 180 min after

IL-1Ra decreased infarct size and neurological deficit and improved functional outcome

IL-1α, IL-1β

[106]

  Distal pMCAO (electrocoagulation)

BALB/c

s.c. injection of 100 mg/kg IL-1Ra 30 or 180 min after

  Distal pMCAO (electrocoagulation)

C57BL/6

i.v. injection of IL-1Ra-producing bone marrow-derived cells 30 min after occlusion

IL-1Ra-producing bone marrow-derived cells decreased infarct volumes and improved functional outcomes

IL-1α, IL-1β

[33]

   Proximal tMCAO (40 min, filament)

C57BL/6

i.v. injection of IL-1Ra-producing bone marrow-derived cells 30 min after reperfusion

  Proximal tMCAO (30 min, filament)

C57xSV129

i.c.v. injection of 2.5 μg IL-1Ra or 2.5 ng IL-1β 30 min before occlusion and 10 min after reperfusion

IL-1β increased, whereas IL-1Ra decreased infarct volumes

IL-1α, IL-1β

[175]

 Rats

  Proximal tMCAO (120 min, filament)

SD

i.v. injection of 50 mg/kg IL-1RA-PEP at the time of reperfusion

IL-1RA-PEP alleviated brain infarction, cerebral edema, neurological deficit score, and motor performance

IL-1β

[195]

  Proximal tMCAO (filament)

SD

i.v. injection of 10 mg at the time of occlusion followed by i.v. infusion 0.8 mg/h hIL-1Ra (anakinra) for 24 hrs

Anakinra reduced infarct volume

IL-1α, IL-1β

[28]

  Proximal tMCAO (120 min, filament)

Wistar

i.v. injection of 5, 10, or 20 mg/kg hIL-1Ra (anakinra) at 3, 6 or 12 hrs after after occlusion

Anakinra reduced infarct volume and improved neurological deficits dose- and time-dependently

IL-1α, IL-1β

[189]

  Proximal tMCAO (120 min, filament)

SD

i.v. injection of 50 mg/kg IL-1RA-PEP at the time of reperfusion

IL-1RA-PEP alleviated brain infarction, cerebral edema, neurological deficit score and motor performance

IL-1α, IL-1β

[195]

  Distal pMCAO (electrocoagulation)

SD

i.c.v. injection of 10 μg rhIL-1Ra 30 min before and 10 min after occlusion

rhIL-1Ra reduced infarct volumes

IL-1α, IL-1β

[138]

   Distal tMCAO (60 min, filament)

SD

i.c.v. injection of recombinant adenovirus vector carrying the human IL-1Ra cDNA (Ad.RSVIL-1ra) 5 days prior to experimental stroke

Ad.RSVIL-1ra reduced infarct volumes

IL-1α, IL-1β

[12]

  Proximal pMCAO (filament)

Wistar

i.v. injection of 100 mg/kg rhIL-1Ra immediately prior to and again s.c. 3 times per day for 7 days

rhIL-1Ra reduced infarct volumes and improved functional scores

IL-1α, IL-1β

[59]

  Distal pMCAO (electrocoagulation)

SD

s.c. injection of 100 mg/kg rhIL-1Ra at 0, 4, 8, 12, and 18 h after occlusion

rhIL-1Ra reduced infarct volumes dose- and time- dependently and inhibited cerebral edema at 24 hrs

IL-1α, IL-1β

[137]

 Human

  Acute stroke (< 6 h)

 

i.v. injection of 100 mg bolus rhIL-1Ra, followed by 2 mg/kg per hour for 72 h

rhIL-1Ra improved clinical outcomes (survival to 3 months, NIHSS, BI, and mRS scores) at 3 months (n=17)

IL-1α, IL-1β

[51]

  Acute stroke (< 6 h)

 

i.v. injection of 100 mg bolus rhIL-1Ra, followed by 2 mg/kg per hour for 72 h

rhIL-1Ra reversed peripheral innate immune suppression in the acute phase of stroke (n=17)

IL-1α, IL-1β

[158]

  Acute stroke (< 5 h)

 

s.c. injection of 100 mg rhIL-1Ra (anakinra) twice daily for 3 days

Anakinra reduced plasma inflammatory markers but did not affect mRS at 3 months (n=39)

IL-1α, IL-1β

[159]

IL-6 system

 Mouse

   Distal pMCAO (electrocoagulation)

C57BL/6

i.v. injection of 500 ng IL-6, solIL-6R, or 500 ng IL-6 followed by 500 ng solIL-6R 5 min or 5 and 60 min after occlusion

IL-6 injection improved behavioral outcome without affecting infarct size; co-administration of Il-6 and solIL-6R increased infarct volume, number of PMNs and impaired endurance

IL-6, IL-6R, gp130

[70]

  Proximal tMCAO (60 min, filament)

C57BL/6

i.c.v. injection of 10 ng anti-IL6 mAb or intranasal administration of 0.1 μg rIL-6 every 24 h for 2 weeks starting 14 days after occlusion

Anti-IL-6 mAb reduced proliferation and neuronal differentiation of neural progenitor cells in the ipsilateral SVZ, as well as functional recovery; rIL-6 conferred the opposite effect

IL-6

[111]

 Proximal tMCAO (45 min, filament)

C57BL/6

i.p. injection of 100 μg/g bodyweight IL-6Ra immediately after reperfusion

Anti-IL-6Ra increased infarct volume and affected neurological function.

IL-6R

[192]

 Rats

  Proximal tMCAO (120 min, filament)

SD

i.p. injection of 50 or 500 ng rIL-6

rIL-6 reduced infarct volumes

IL-6R

[53]

  Proximal pMCAO (electrocoagulation)

SD

i.c.v. injection of 2x50 or 2x500 ng rhIL-6 30 min prior to and again 15 min after occlusion

rhIL-6 reduced infarct volumes

IL-6R

[100]

IL-10 system

 Mouse

  Distal pMCAO (electrocoagulation)

C57BL/6

i.c.v. injection of 100 ng rmIL-10 5 min after occlusion

rmIL-10 reduced infarct volumes

IL-10R

[96]

  Proximal tMCAO (60 min, filament)

C57BL/6

i.v. infection of IL-10-producing B cells 24 h prior to or 4 h after occlusion

IL-10-producing B cells reduced infarct volumes and reduced post-stroke inflammation

IL-10R

[16]

 Rats

     

  Distal tMCAO (90 min, filament)

SD

i.v. injection of IL-10-overproducing mesenchymal stem cells 0 or 3 h after reperfusion

IL-10-overproducing mesenchymal stem cells reduced infarct volumes, improved motor functions and reduced inflammation

IL-10R

[119]

  Distal pMCAO (photothrombotic)

SHR

i.c.v. injection of adenoviral vectors encoding human IL-10 (AdlIL-10) 90 min after occlusion

AdlL10 reduced infarct volumes and leukocyte infiltration

IL-10R

[130]

  Distal pMCAO (electrocoagulation)

SHR

i.c.v. injection of 1 μg IL-10 30 min and 3 hours after occlusion and i.v. injection of 5 or 15 μg/h for 3 h starting 30 min after occlusion

IL-10 treatments reduced infarct volumes

IL-10R

[160]

Ab antibody, BI Barthel index, bp binding protein, cTfRMAb transferrin receptor monoclonal antibody, GDNF glial-derived neurotropic factor, h human, i.c.v intracerebroventricular, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1RI interleukin-1 receptor 1, IL-6R interleukin-6 receptor, IL-10R interleukin-10 receptor, i.p. intraperitoneal, i.v. intravenous, mAb monoclonal antibody, mRS modified rankin score, NIHSS National Institutes of Health Stroke Scale, pMCAO permanent middle cerebral artery occlusion, rh recombinant human, rm recombinant mouse, s.c. subcutaneous, SD Sprague–Dawley, SHR spontaneously hypertensive rats, solTNF soluble tumor necrosis factor, SVZ subventricular zone, tMCAO transient middle cerebral artery occlusion, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Table 2

Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Drug name

Class

Structure

Specificity

References

Etanercepta and biosimilars

Dimeric Fc-fusion protein

Hu TNFR2exc:IgG1-Fcγ1

solTNF, tmTNF, LTα3, & LTα2β1

 

Infliximaba and biosimilars

Monoclonal antibody

Mo/Hu chimeric IgG1/κ

solTNF & tmTNF

 

Adalimumaba and biosimilars

Monoclonal antibody

Hu IgG1/κ

solTNF & tmTNF

 

Certolizumab pegola

Monoclonal antibody fragment

PEGylated hu IgG1/κ Fab´

solTNF & tmTNF

 

Golimumaba

Monoclonal antibody

Hu IgG1/κ

solTNF & (tmTNF)

 

XPro1595

Dominant-negative inhibitor

TNF mutein

solTNF

[162]

XEN345

Dominant-negative inhibitor

TNF mutein

solTNF

[162]

cTfRMAb-TNFR

Fusion cTfR-protein

TNFR2exc:IgG1-cTfR

solTNF & tmTNF

[197]

R1antTNF

Inhibitor

TNFR1 selective mutein

TNFR1, solTNF?

[155]

DMS5540

Monovalent domain antibody

TNFR1-dAb:Albu-dAb

TNFR1

[108]

TROS

Dimeric nanobody

Hu TNFR1-Nb:Alb-70-96-Nb IgG1

TNFR1

[163]

ATROSAB

Monoclonal antibody

Hu IgG1

TNFR1

[88]

EHD2-scTNFR2

Dimeric single-chain fusion protein

Hu TNFR2:EHD2 IgE

TNFR2

[44]

TNCscTNF80

Trimerized single-chain fusion protein

Chicken TNC:huTNFR2

TNFR2

[25]

Anakinraa

Recombinant protein

IL-1Ra mutein

IL-1R1

 

Rilonacepta

Dimeric fusion protein

Hu IL-1R1excIL-1RAcPexc:IgG1-Fc

IL-1α & IL-1β

 

Canakinumaba

Monoclonal antibody

Hu IgG1/κ

IL-1β

 

MEDI-8968

Monoclonal antibody

Hu IgG2

IL-1R1

[21]

Gevokizumab

Monoclonal antibody

Hu IgG2/κ

IL-1β

[144]

LY2189102

Monoclonal antibody

Hu IgG4

IL-1β

[156]

XOMA 052

Monoclonal antibody

Hu IgG2/κ

IL-1β

[144]

IL-1RA-PEP

Fusion protein

IL-1Ra:PEP-1

IL-1R1

[195]

Tocilizumaba

Monoclonal antibody

Hu IgG1/κ

tmIL-6R & solIL-6R

 

Siltuximaba

Monoclonal antibody

Mo/Hu chimeric IgG1/κ

IL-6

 

Sarilumaba

Monoclonal antibody

Hu IgG1/κ

IL-6R

 

Olokizumab

Monoclonal antibody

Hu IgG1/κ

IL-6, gp130

[154]

Elsilimomab

Monoclonal antibody

Hu IgG1/κ

IL-6

[184]

Sirukumab

Monoclonal antibody

Hu IgG1/κ

solIL-6

[190]

Clazakizumab

Monoclonal antibody

Hu IgG1/κ

IL-6

[110]

sgp130Fc (Olamkicept)

Fusion protein

Hu gp130exc:IgG1-Fc

IL-6/solIL-6R complex

[86]

Pegliodecakin (AM0010)

Pegylated recombinant protein

PEG-rHuIL-10

IL-10R

[118]

PEGylated-IL10

Pegylated recombinant protein

PEG-rMuIL-10

IL-10R

[50]

Albu anti-serum albumin, cTfR transferrin receptor, dAb domain antibody, gp130 glycoprotein 130, Hu human, IL Interleukin, IL-1R interleukin-1 receptor, IL-1Ra interleukin-1 receptor antagonist, IL-1RAcP IL-1 receptor accessory protein, LTα lymphotoxin-alpha, Mo mouse, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmIL-6R transmembrane interleukin-6 receptor, tmTNF transmembrane tumor necrosis factor, TNC tenascin, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

aFDA approved drug

Tumor necrosis factor

The most extensively studied cytokine in experimental stroke is the proinflammatory and immune regulatory cytokine TNF. It exists in a secreted form (solTNF) and a transmembrane form (tmTNF), which is also involved in reverse signaling [87]. solTNF is derived from tmTNF, which is cleaved by the protease ADAM-17, also known as TNF-alpha converting enzyme (TACE) [14]. tmTNF and solTNF signals are transmitted through two distinct receptors, TNFR1 and TNFR2, that differ significantly both in cellular expression and downstream effects. Although solTNF binds both receptors with high affinity, it preferentially binds to TNFR1 (dissociation constant [Kd] 20 pM) versus TNFR2 ([Kd] ~ 400 pM), owing to a 30-fold faster dissociation rate from TNFR2 than from TNFR1 [69]. This has given rise to a ligand-passing hypothesis, stating that solTNF binding to TNFR2 is quickly passed to TNFR1. Binding by TNFRs to tmTNF or even TNF antagonists can induce reverse signaling through tmTNF, leading to cell activation, cytokine suppression, or apoptosis of the tmTNF-bearing cell (reviewed in [49]). While TNFR1 is expressed on virtually all cells, TNFR2 expression is restricted to cells of the immune system, glial cells, and endothelial cells. TNF’s proinflammatory effects are likely mediated through solTNF–TNFR1 signaling, leading to activation of two major, well-understood pathways. One leads to the induction of anti-apoptotic genes, mainly through activation of the transcription factor nuclear factor-kappa B (NF-κB). The second signaling pathway results in activation of cellular suicide programs, including the prototype of programmed cell death, apoptosis, but also the execution of programmed necrosis (necroptosis) [179]. Under physiological conditions, TNF does not induce cell death unless transcription, translation, or specifically the NF-κB pathway are blocked. Unlike TNFR1, TNFR2 is not associated with induction of apoptosis but preferentially promotes cell growth, and regeneration through NF-κB activation. TNFR1 can be activated by binding of either solTNF or tmTNF, whereas TNFR2 is only fully activated by tmTNF [68, 69]. A further level of complexity is added by the proteolytic cleavage of the extracellular domains of both TNFR1 and TNFR2 [182], which is increased upon TNFR activation (reviewed by [1]). The soluble TNFR1 and solTNFR2 ectodomains that are shedded can bind to TNF, albeit with low affinity, and can thus act as natural inhibitors of TNF.

Lymphotoxin-alpha (LTα), another TNFR agonist with important roles in immune regulation, also binds TNFR1 and TNFR2 and mainly mediates NF-κB-mediated signaling [134].

Tumor necrosis factor in experimental stroke

The low baseline levels of TNF in the CNS under physiological conditions play an important role in neuronal function, by modulating glutamatergic synaptic transmission and plasticity [164]. Furthermore, TNF regulates neuronal networks involved in cognition and behavior [9], thereby attributing importance to TNF both in the healthy and stroke-lesioned CNS. Multiple checks are in place to finetune TNF’s production and activity, including regulation of TNF gene expression at transcriptional and translational levels, and the regulated shedding of TNF [117] and its receptors [135].

A particular role of TNF/TNFR1 in the etiopathogenesis of stroke is suggested by genome-wide association studies that found a polymorphism in the TNF gene that increases the susceptibility for stroke [178]. After pMCAO, TNF is acutely and significantly upregulated, peaks at 12–24 h (Fig. 2a), and remains elevated for days (Fig. 1d), making TNF a key player both in acute and chronic ischemia and in post-ischemic neuronal plasticity (reviewed by [91]). TNF is primarily produced by microglia in the early phase after experimental stroke and sustained by macrophages at later time points [20, 32, 92, 94], although other cell types like ependymal, astroglial and neuronal cells have also been reported to produce TNF during ischemic conditions (reviewed by [91]).
Fig. 2

Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [93, 94], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as [94]. The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from [33]. IL-6, IL-6R, and gp130 mRNA data have been obtained from [70]. Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LTα lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

The use of genetically modified mice has been invaluable for establishing the role of TNF in the pathogenesis of ischemic stroke. Conventional TNF-knock out (KO) mice [92] and conditional TNF-KO mice with ablation of TNF in myeloid cells, including microglia [31] have larger infarcts and worse behavioral deficits than control mice after pMCAO. This suggests a neuroprotective role of microglial-derived TNF in ischemic stroke, an effect which appears to be mediated via TNFR1 [92, 170]. Interestingly, mice with a loss of TACE-mediated cleavage preventing shedding of solTNF (and thus expressing only tmTNF) develop smaller infarcts than their littermates [104], suggesting that removal of solTNF but preservation of tmTNF is neuroprotective in ischemic stroke.

Finally, a polymorphism in the LTα gene (LTA) has been linked to increased susceptibility for stroke [178], suggesting that also LTα plays a role in the etiopathogenesis of stroke. However, LTα levels appear to remain relatively constant in the acute phase after pMCAO in mice (Fig. 2a, Lambertsen et al., unpublished data), suggesting that brain-derived LTα has no major role in the inflammatory response post-stroke.

Anti-tumor necrosis factor treatment in experimental stroke

The currently used FDA- and EMA-approved anti-TNF therapeutics block both solTNF and tmTNF (Table 2). These therapeutics appear to relieve fatigue and symptoms of depression that can be associated with chronic inflammatory diseases [177]. Despite reports of improved neurological outcome in patients with stroke or traumatic brain injury who are treated with perispinal etanercept [172, 174] (Table 1), none of the currently used anti-TNF therapeutics have so far been approved as a neuroprotective strategy in combination with tissue plasminogen activator treatment. This may be because targeting both solTNF and tmTNF can predispose patients to both cardiovascular and demyelinating diseases [151], which is in line with the finding that a single nucleotide polymorphism in the TNFR1 gene (TNFRSF1A) that mimics the effect of anti-TNF therapeutics, is a risk factor for developing multiple sclerosis [67]. In combination with the observation that not only TNF-KO mice but also TNF-R1 KO mice develop larger infarcts than wild-type mice [92, 170], this calls for precaution in using the currently approved anti-TNF therapeutics and emphasizes the need for more specific anti-TNF therapeutics.

There has been little preclinical testing of therapeutics that exclusively target solTNF (XPro1595, XEN345, and possibly R1antTNF) (Tables 1, 2 and Fig. 3a) and leave signaling via tmTNF–TNFR1/2 intact. A comparative study of a single i.v. dose of XPro1595 (a dominant-negative solTNF inhibitor) or etanercept, administered at a dose of 10 mg/kg, 30 min after pMCAO, showed that both compounds affected the inflammatory response and improved motor functions and motor learning skills compared to vehicle 1 and 5 days after pMCAO, but had no effect on infarct volume [30]. This indicates that targeting solTNF alone may be efficient for the treatment of post-stroke inflammation. Similarly, recent findings showed that topical, but not systemic administration, of XPro1595 can rescue tissue at risk after experimental spinal cord injury, while etanercept had no effect [129], suggesting that topical administration of XPro1595 can inhibit solTNF present locally in the CNS. Clearly, more studies are needed to clarify whether XPro1595 is able to rescue tissue at risk in the peri-infarct. However, given the prevalence of post-stroke infections in humans, leaving tmTNF signaling intact may decrease the risk of infections.
Fig. 3

Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. ac TNF (a), IL-1 (b), and IL-6 (c) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database (www.proteinlounge.com). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

While it seems relevant to retain the neuroprotective TNFR1 signaling in the acute phase after stroke, TNFR1 also plays a role in sustaining chronic inflammation in mouse models of multiple sclerosis and TNFR2 is important for remyelination [18]. Although more studies are clearly required to clarify the role of neuronal TNFR1 signaling in the acute phase post-stroke, it is possible that TNFR1-specific antagonists [R1antTNF, DMS5540, TROS (TNF receptor one silencer), ATROSAB (antagonistic TNF receptor one-specific antibody)] (Table 2) that preserve TNFR2 signaling, will be important in improving neuronal and synaptic remodeling in the chronic phase of stroke.

Due to their large size, many biologic TNF inhibitors do not cross the BBB and must be modified to enable BBB penetration and access to the brain parenchyma. One such drug is cTfRMAb-TNFR (Table 2), which ferries TNFR across the BBB using the transferrin receptor (TfR) [197]. In a preclinical study, i.v. injection of cTfRMAb-TNFR was compared to etanercept in a tMCAO model and when administered 90 min after occlusion resulted in reduced infarct volumes and reduced neural deficit 1 and 7 days post-stroke, whereas etanercept had no effect [167](Table 1). Despite the fact that both cTfRMAb-TNFR and etanercept are TNFR2 fusion proteins, the authors ascribed the beneficial effect of cTfRMAb-TNFR to the modification of this protein to allow it to be transported across the BBB [15].

In another preclinical study, sTNF-α R1 (solTNFR1) (Table 2) administered by intracortical infusion for 1 week after photothrombotic stroke was found to preserve deprivation-induced axonal plasticity in the cerebral cortex post-stroke [98] (Table 1). This effect was ascribed to sTNF-α R1 competing for solTNF with TNFR1 receptors, supporting the hypothesis that ablating solTNF is beneficial in ischemic stroke. This is in line with a preclinical study showing that intra-arterial injection of solTNFR1-overexpressing dendritic cells 6 h after tMCAO reduces infarct size and inflammation 3 days post-stroke [186] (Table 1).

Interleukin-1

The IL-1 family comprises 11 members (IL-1α, IL-1β, IL-1 receptor antagonist (IL-1Ra), IL-18, IL-33, IL-36α, IL-36β, IL-36γ, IL36-Ra, IL-37, and IL-38), forming a network of proinflammatory cytokines that regulate innate immune cells and function as key players in inflammation (review by [43]). Despite structural and functional similarities and evidence of a common ancestry [143], so far only IL-1α, IL-1β, and IL-1Ra have been studied extensively in ischemic stroke.

Both IL-1α and IL-1β are expressed and translated as precursor (pro) proteins. ProIL-1α is biologically active, but it lacks the signal peptide that allows it to leave the cell [143]. IL-1α is a ‘dual-function’ cytokine with both nuclear and cytoplasmic functions, but danger signals from necrotic cells can promote the secretion of IL-1α [48], causing neutrophil recruitment and exacerbation of inflammation [24]. Apoptosis causes IL-1α to translocate to the nucleus, where it binds to chromatin, a mechanism which is known to restrain inflammation [34]. IL-1α is considered to be an early danger signal that modulates a wide range of inflammatory reactions through the interleukin-1 receptor type 1 (IL-1R1) [48, 143]. Following injury, the proteolytic cleavage of IL-1α occurs through the actions of calpain, and possibly inflammasomes [194]. Membrane-bound, unprocessed IL-1α acts in a paracrine fashion on IL-1R expressing cells [42] to modulate angiogenesis, cell proliferation, senescence, apoptosis, and migration, and cytokine production ([149] and review by [43]).

In contrast to proIL-1α, proIL-1β is a biologically inactive protein, and both proIL-1β and mature IL-1β appear extracellularly [143], indicating that processing can take place after secretion. ProIL-1β is cleaved by caspase-1 (or IL-1 converting enzyme) [143], which gets activated by the assembly of the inflammasome, a process triggered in turn by damage-associated molecular pattern signals [72]. ProIL-1β can also be cleaved by neutrophil serine proteases such as proteinase 3 and elastase [123].

The natural regulator of IL-1 is IL-1Ra, which is found in two structural variants, secreted (s)IL-1Ra and intracellular IL-1Ra (icIL-1Ra), that both target the IL-1R1 [6]. The icIL-1Ra isoform is less explored but believed to exert multiple functions inside the cell [6], such as modulating the effect of IL-1α and/or acting as regulator of proIL-1β [102]. IL-1Ra is expressed by monocytes/macrophages, neutrophils [105], microglia [33], and other cells [42].

IL-1α/β induce their biological effects through IL-1R1, which is expressed in low numbers (< 100) on nearly all cells in the brain [42]. Binding of IL-1 to IL-1R1 allows the binding of the interleukin-1 receptor accessory protein (IL-1RAcP, IL-1R3), which is a key component of the receptor/agonist signaling complex [6, 143]. Recruitment and binding of IL-1RAcP converts the low-affinity binding between IL-1R1 and IL-1 to a high-affinity binding allowing further signal transduction [65]. IL-1 signaling is complex but potent with < 10 receptors/cell required to be occupied before a full response is triggered [166]. This means that IL-1Ra needs to be present in 100–1,000-fold molar excess to control its biological properties [42].

IL-1R2 shares structural characteristics with IL-1R1, but it lacks the cytoplasmic domain that allows signal transduction. IL-1R2 binds IL-1 as a decoy receptor [42, 143]. IL-1R2 is expressed by the same cells as IL-1R1 but is particularly abundant on monocytes, and neutrophils [42, 45]. IL-1R2 binds IL-1α in the cytosol, preventing its interaction with IL-1R1 when released from necrotic cells [196]. All the IL-1Rs are also found in a soluble form [90].

Interleukin-1 in experimental stroke

IL-1 is a major player in stroke pathology (Fig. 1g, h). As for the TNF gene, a polymorphism in the IL-1A gene has been associated with an increased susceptibility for ischemic stroke [199] whereas a polymorphism in the IL-1B gene has been associated with lower stroke risk [13], although this is still controversial [193, 199]. Polymorphisms in the IL1RN gene do not affect the risk for stroke [199], but increased plasma IL-1α combined with a polymorphism in the IL1RN gene increases the risk of post-stroke infection [10].

So far, focus has been on understanding the role of IL-1β in experimental stroke models, however data suggests that also IL-1α, which is significantly upregulated in mice 6–24 h after pMCAO (Fig. 2b) [33] and 7 days after tMCAO [149], plays an important role in stroke-induced neuroinflammation [33, 171]. Following experimental stroke in rodents, IL-1α was shown to be expressed by platelets and microglia [33, 40]. The presence of platelet-derived IL-1α acutely (6 h) after experimental stroke [33] supports findings that IL-1α drives neurovascular inflammation and facilitates neutrophil infiltration into the ischemic brain [171]. At 24 h after pMCAO, microglia are the key producers of IL-1, with approximately 50% of the IL-1α producing microglia co-expressing IL-1Ra and 17% co-expressing IL-1β, demonstrating that IL-1β and IL-1α are largely produced by segregated populations of microglia in the ischemic brain [33]. It is, therefore, likely that IL-1α in platelets in addition to few IL-1α/β producing microglia impacts the balance between IL-1/IL-1Ra early after stroke onset [33]. Findings that IL-1α and IL-1Ra are co-expressed in microglia support the view that icIL-1Ra can regulate the action of intracellular IL-1α [113].

IL-1β is constitutively expressed in the CNS [42] where it exerts neurotrophic factor-like activity [161] or regulates both the expression and activity of ion channels [181]. IL-1β is upregulated acutely after ischemic stroke (Fig. 1)[32, 33, 37] and peaks at 12-24 h (Fig. 2b) primarily in microglia and macrophages [32, 37], and later in astroglial-like cells [183].

IL-1 has been shown to aggravate stroke pathology (Table 1) as demonstrated by findings in transgenic mice overexpressing a dominant-negative form of caspase-1 in neurons [54], caspase-1 KO mice [73], and IL-1α/β KO mice [17], which all show reduced infarct volumes after experimental stroke. Additional support comes from early studies demonstrating that administration of recombinant IL-1β exacerbated damage [99] as does intracerebroventricular (i.c.v.) delivery of an IL-1Ra antiserum [101]. Systemic administration of IL-1β just before tMCAO worsened outcome in rodents through neutrophil- and platelet-dependent mechanisms reducing reperfusion [109].

In addition, IL-1Ra is an acute phase protein [55] that blocks the action of IL-1. Administration of IL-1Ra reduced ischemic brain damage after both tMCAO and pMCAO in rats [59, 137] and mice [175] (Table 1) and IL-1Ra-overexpressing mice show reduced infarct volumes, whereas IL-1Ra KO mice display increased infarct volumes compared to littermate mice after pMCAO [33].

Anti-interleukin-1 treatment in experimental and human ischemic stroke

IL-1Ra is the only therapeutic agent directed against IL-1-induced inflammation (Fig. 3b) that has been tested in randomized clinical trials in ischemic stroke (Table 1). In pre-clinical stroke models, recombinant (r)IL-1Ra is protective after central [137] and peripheral [59] administration and, similar to i.c.v. injection of anti-IL-1β antibody (Ab) [191] or IL-1Ra, was shown to reduce infarct volumes after MCAO in rats [99, 137] and pMCAO in mice [121].

Although IL-1Ra can reach the brain after systemic administration in the rat [66] and modulates long-term functional recovery after experimental stroke [62], its use in stroke patients has proven challenging. Pharmacokinetic studies have shown that rIL-1Ra crosses the BBB slowly [71] and has a very short half-life in the circulation [64], and thus it is difficult to achieve therapeutic IL-1Ra concentrations in the brain [57].

The first randomized, double-blind, placebo-controlled trial using i.v. injected recombinant human (rh)IL-1Ra in acute stroke patients (given within the first 6 h of stroke onset) showed a reduction in neutrophil count, plasma CRP, and IL-6 compared to placebo, and exploratory efficacy analysis indicated that patients receiving rhIL-1Ra had minimal to no disability three months after stroke [51]. Recently, the SCIL-STROKE (subcutaneous interleukin-1 receptor antagonist in ischemic stroke) phase II trial, using subcutaneous (s.c.) injections of IL-1Ra in combination with i.v. thrombolysis, showed reduced plasma IL-6 levels, whereas neurological recovery three months after stroke was unaffected [159]. Exploratory efficacy analysis suggested that the expected beneficial effect of IL-1Ra on clinical outcome by reducing inflammation might have been counteracted by a negative effect, which could represent an interaction with alteplase [159].

Interleukin-6

Another potent proinflammatory cytokine with pleiotropic functions is IL-6, which is expressed on many cell types, including monocytes, neurons and glial cells (Fig. 1j, k)[52, 70]. The pleiotropism of IL-6 may be explained by IL-6 eliciting fundamentally different cellular responses depending on whether the classic or the trans-signaling pathway is activated [152]. This depends on the IL-6 receptor system that consists of the IL-6 receptor (IL-6R) as well as soluble IL-6R (sIL-6R) and glycoprotein 130 (gp130), which due to its cytoplasmic domain is responsible for the signal transduction. Soluble IL-6R is formed by cleavage from the IL-6R by TACE/ADAM17 [141] or by translation of different IL-6R mRNA splice variants [103].

In classic signaling, IL-6 binds to and forms a complex with membrane-bound IL-6R, which then recruits gp130. Trans-signaling occurs when IL-6 binds sIL-6R, which then binds to membrane-anchored gp130 [141]. Unlike IL-6R, which is expressed by neurons, microglia, neutrophils, monocytes, hepatocytes and CD4+ T cells and thus limits classic signaling to only a few tissues [58], gp130 is ubiquitously expressed in the body (reviewed by [145]), increasing the spectrum of IL-6 target cells. Trans-signaling is normally tightly regulated [185] and can be counteracted by a soluble form of gp130 (sgp130), which is generated by alternative splicing of gp130 mRNA and is present in serum [85]. Once IL-6 is released into the blood it can bind sIL-6R but also sgp130 [150], which immediately interferes with IL-6 trans-signaling [58]. As sgp130 levels are much higher than sIL-6R, trans-signaling does not occur under physiological conditions.

Classic IL-6 signaling is believed to be anti-inflammatory and protective [185], while trans-signaling is responsible for the pro-inflammatory effects mediated by IL-6 [147, 152].

Interleukin-6 in experimental stroke

IL-6 is expressed in the normal CNS, where it influences neuronal homeostasis by acting as a neurotrophic factor via the classical signaling pathway (reviewed by [147]). Ischemic stroke in mice and rats leads to a significant increase in the levels of IL-6 from 6 to 12 h (Fig. 1 and 2c), and in both IL-6R and gp130 from 3 days [3, 70]. IL-6 has been shown to be neuroprotective in experimental stroke [192] although this is still debated [29]. In human stroke, IL-6 serum levels increase within the first 24 h and have been shown to correlate significantly with infarct size and survival [11, 157]. A similar correlation has not been observed for sIL-6R [46, 70]. While studies of IL-6 expression in the ischemic brain post-mortem are sparse, one study showed that IL-6 levels were elevated in the infarct already in the acute phase after stroke and remained elevated at later time points [126]. Supporting the neuroprotective effect of brain-derived IL-6 are findings showing a positive effect of IL-6 on post-stroke neurogenesis, leading to long-term functional recovery [111].

Anti-interleukin-6 treatment in ischemic stroke

Similar to patients treated with nonspecific TNF antagonists, non-neurological patients treated with IL-6 inhibitors are at increased risk of infections (reviewed in [169]). Clinical stroke studies show that sIL-6R correlates with the degree of leukocyte infiltration [85] and that sIL-6R neutralizing antibodies are beneficial [146]. In comparison, anti-IL-6R antibodies target both the membrane-bound form of IL-6R and sIL-6R, and therefore, affect classical and trans-signaling equally (Fig. 3c and Table 2).

If classical IL-6 signaling is protective and trans-signaling detrimental, selective neutralization of the potential, detrimental trans-signaling is possible by administration of the chimeric protein sgp130Fc (Fig. 3c and Table 2). Sgp130Fc is a fusion protein that contains the extracellular domain of human gp130 and the Fc-fragment of human IgG1. This allows sgp130Fc to bind to the IL-6/solIL-6R complex, but not to sIL-6R alone [86], whereby spg130Fc blocks trans-signaling [52] (Fig. 2c). Such specific inhibition of the trans-signaling pathway using, i.e. sgp130, which does not compromise classic signaling, could be a promising therapeutic tool in future stroke research.

Interleukin-10 in clinical and experimental stroke

IL-10 is a pleiotropic anti-inflammatory cytokine mainly produced by type-2 helper T cells, which in turn regulate inflammatory reactions. IL-10 binds to IL-10 receptors (IL-10R) to reduce inflammation and limiting apoptosis [148]. In the CNS, astrocytes, neurons, and microglia have been reported to produce IL-10 [114, 188].

A meta-analysis investigating the association of IL10 gene polymorphism with the risk of ischemic stroke showed no overall significant association between IL-10 and the risk of ischemic stroke, but an association was found with large vessel disease and small vessel disease [89], suggesting that some subtypes of ischemic stroke are associated with IL10 gene polymorphisms.

In experimental stroke, IL-10 mRNA and protein and IL-10R mRNA levels are increased, with IL-10 noted in microglia and IL-10R on astrocytes in the peri-infarct area [126, 132]. In transgenic mice overexpressing IL-10, infarct volumes were reduced, and apoptosis decreased 4 days after pMCAO [38]. Furthermore, low IL-10 levels were associated with poor stroke outcome and a delayed, exacerbated inflammatory response after pMCAO that was ameliorated by IL-10 administration after pMCAO [132] (Table 1). Therapeutic administration of IL-10 has been shown to be neuroprotective in experimental stroke and to limit post-stroke inflammation [96, 97, 130, 139, 160, 165] (Table 1),

Low plasma IL-10 levels in patients with subcortical or lacunar stroke are associated with neurological worsening within the first 48 h [180], attributing IL-10 a role in the acute neuroinflammatory response after stroke. This is in line with findings by Protti et al. showing that patients with low IL-10 levels deteriorated neurologically within the first 3 days post-stroke [136]. Stroke patients are prone to infection due to stroke-induced immunodepression, however, and increased serum IL-10 levels have been identified as an independent predictor of post-stroke infection [22, 187]. Women have poorer recovery after ischemic stroke than men, even after controlling for age and stroke severity [19, 80]. This may be partly due to the increased IL-10 levels 24 h post-stroke and an associated higher incidence of post-stroke urinary tract infection and poorer overall outcomes in women have been suggested to be a contributing factor [35]. Overall, these studies indicate that an excessive IL-10 response can lead to post-stroke immunosuppression and worsen neurological outcome, suggesting that IL-10 therapeutics should be given with caution. Future studies should be aimed at differentiating between central and peripheral IL-10 effects post-stroke.

Concluding remarks

The dual role of inflammation in both injury and repair complicates attempts to target inflammatory signals in stroke patients. “Single-target” therapies appear insufficient because ischemic stroke involves several mechanisms. Therapeutic approaches should, therefore, most likely target several cell types and different post-ischemic phases to promote protection and recovery.

A possible new approach is to enhance proinflammatory cytokine inhibition either by simultaneous targeting of more than one cytokine or using a more selective targeting approach where only part of the signaling cascade initiated by a given cytokine is inhibited. More selective targeting can be achieved because some of the detrimental and beneficial signals diverge at the level of ligand (e.g. solTNF or tmTNF and IL-1 or IL-1Ra) and at the level of the receptor (e.g. TNFR1 or TNFR2 and IL-6R or sIL-6R). Accordingly, specific inhibition of solTNF, IL-1, or IL-6 trans-signaling might be sufficient to inhibit the pathological consequences of deregulated cytokine signaling while leaving beneficial signaling pathways intact.

The differential roles of cytokine and cytokine receptors, and the function of cytokines derived from specific cell subsets make it clear that the use of anti-cytokine drugs can be improved or adjusted to the specific disease context. A novel approach to block detrimental inflammation following experimental ischemia is the use of cell-type-restricted targeting of cytokines, or the creation of Activity-on-Target cytokines (AcTakines), which is immunotherapy consisting of mutated cytokines with reduced binding affinity coupled to a targeting moiety that guides cytokines to the desired cell target [60]. Recently, Nedospasov and colleagues designed myeloid cell-specific TNF inhibitors (MYSTIs), which are recombinant mini-antibodies with dual specificity, that can bind to the surface molecule F4/80 or CD11b on myeloid cells and to solTNF and were found to be beneficial in in vivo models of acute hepatotoxicity and arthritis [47, 128].

For anti-inflammatory therapies to be successful in stroke treatment, a better understanding is needed of both the temporal and spatial dynamics of resident microglia and recruited inflammatory cells. Despite intense investigation, there are still numerous controversies concerning the time course of leukocyte recruitment in acute stroke. An improved understanding of the heterogeneity of the inflammatory response in this disease also demands better imaging studies of stroke patients, using tracers to identify both infiltrating cells and functional, relevant cytokine receptors. The heterogenic roles that microglia play in stroke make it challenging to identify strategies that modulate microglial function, but promising results of pre-clinical studies suggest that this should be a major focus of attention in future stroke research.

As evidenced above, post-stroke neuroinflammation is both a tool and a target for therapy. However, care must be taken as to when, where, and how to intervene with neuroinflammatory responses. Taken altogether, this calls for further translational stroke research.

Notes

Acknowledgements

Silas Arlt Tvingsholm is acknowledged for help with graphical design and Claire Gudex for proof-reading. This work was supported by the Danish Council for Independent Research, Medical Sciences (DFF-4183-00033 to KLL), the Hoerslev Foundation (BHC), the Lundbeck Foundation (R54-A5539 and R173-2014-955 to KLL, R67-A6383 to BHC and R126-A11512 to BF), and the Novo Nordic Foundation (NNF12OC0002215 to BF).

References

  1. 1.
    Aderka D (1996) The potential biological and clinical significance of the soluble tumor necrosis factor receptors. Cytokine Growth Factor Rev 7:231–240CrossRefPubMedGoogle Scholar
  2. 2.
    Albers GW, Marks MP, Lansberg MG (2018) Thrombectomy for stroke with selection by perfusion imaging. N Engl J Med 378:1849–1850.  https://doi.org/10.1056/NEJMc1803856 CrossRefPubMedGoogle Scholar
  3. 3.
    Ali C, Nicole O, Docagne F, Lesne S, MacKenzie ET, Nouvelot A et al (2000) Ischemia-induced interleukin-6 as a potential endogenous neuroprotective cytokine against NMDA receptor-mediated excitotoxicity in the brain. J Cereb Blood Flow Metab 20:956–966CrossRefPubMedGoogle Scholar
  4. 4.
    Allen C, Thornton P, Denes A, McColl BW, Pierozynski A, Monestier M et al (2012) Neutrophil cerebrovascular transmigration triggers rapid neurotoxicity through release of proteases associated with decondensed DNA. J Immunol 189:381–392.  https://doi.org/10.4049/jimmunol.1200409 CrossRefPubMedPubMedCentralGoogle Scholar
  5. 5.
    Arango-Davila CA, Vera A, Londono AC, Echeverri AF, Canas F, Cardozo CF et al (2015) Soluble or soluble/membrane TNF-alpha inhibitors protect the brain from focal ischemic injury in rats. Int J Neurosci 125:936–940.  https://doi.org/10.3109/00207454.2014.980906 CrossRefPubMedGoogle Scholar
  6. 6.
    Arend WP, Malyak M, Guthridge CJ, Gabay C (1998) Interleukin-1 receptor antagonist: role in biology. Annu Rev Immunol 16:27–55.  https://doi.org/10.1146/annurev.immunol.16.1.27 CrossRefPubMedGoogle Scholar
  7. 7.
    Astrup J, Siesjo BK, Symon L (1981) Thresholds in cerebral ischemia - the ischemic penumbra. Stroke 12:723–725CrossRefPubMedGoogle Scholar
  8. 8.
    Barone FC, Arvin B, White RF, Miller A, Webb CL, Willette RN et al (1997) Tumor necrosis factor-alpha. A mediator of focal ischemic brain injury. Stroke 28:1233–1244CrossRefPubMedGoogle Scholar
  9. 9.
    Baune BT, Wiede F, Braun A, Golledge J, Arolt V, Koerner H (2008) Cognitive dysfunction in mice deficient for TNF- and its receptors. Am J Med Genet B Neuropsychiatr Genet 147B:1056–1064.  https://doi.org/10.1002/ajmg.b.30712 CrossRefPubMedGoogle Scholar
  10. 10.
    Becker KJ, Dankwa D, Lee R, Schulze J, Zierath D, Tanzi P et al (2014) Stroke, IL-1ra, IL1RN, infection and outcome. Neurocrit Care 21:140–146.  https://doi.org/10.1007/s12028-013-9899-x CrossRefPubMedPubMedCentralGoogle Scholar
  11. 11.
    Beridze M, Sanikidze T, Shakarishvili R, Intskirveli N, Bornstein NM (2011) Selected acute phase CSF factors in ischemic stroke: findings and prognostic value. BMC neurology 11:41.  https://doi.org/10.1186/1471-2377-11-41 CrossRefPubMedPubMedCentralGoogle Scholar
  12. 12.
    Betz AL, Yang GY, Davidson BL (1995) Attenuation of stroke size in rats using an adenoviral vector to induce overexpression of interleukin-1 receptor antagonist in brain. J Cereb Blood Flow Metab 15:547–551.  https://doi.org/10.1038/jcbfm.1995.68 CrossRefPubMedPubMedCentralGoogle Scholar
  13. 13.
    Bis JC, Heckbert SR, Smith NL, Reiner AP, Rice K, Lumley T et al (2008) Variation in inflammation-related genes and risk of incident nonfatal myocardial infarction or ischemic stroke. Atherosclerosis 198:166–173.  https://doi.org/10.1016/j.atherosclerosis.2007.09.031 CrossRefPubMedGoogle Scholar
  14. 14.
    Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Wolfson MF et al (1997) A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature 385:729–733CrossRefPubMedGoogle Scholar
  15. 15.
    Boado RJ, Hui EK, Lu JZ, Zhou QH, Pardridge WM (2010) Selective targeting of a TNFR decoy receptor pharmaceutical to the primate brain as a receptor-specific IgG fusion protein. J Biotechnol 146:84–91.  https://doi.org/10.1016/j.jbiotec.2010.01.011 CrossRefPubMedPubMedCentralGoogle Scholar
  16. 16.
    Bodhankar S, Chen Y, Vandenbark AA, Murphy SJ, Offner H (2014) Treatment of experimental stroke with IL-10-producing B-cells reduces infarct size and peripheral and CNS inflammation in wild-type B-cell-sufficient mice. Metab Brain Dis 29:59–73.  https://doi.org/10.1007/s11011-013-9474-3 CrossRefPubMedGoogle Scholar
  17. 17.
    Boutin H, LeFeuvre RA, Horai R, Asano M, Iwakura Y, Rothwell NJ (2001) Role of IL-1alpha and IL-1beta in ischemic brain damage. J Neurosci 21:5528–5534CrossRefPubMedGoogle Scholar
  18. 18.
    Brambilla R, Ashbaugh JJ, Magliozzi R, Dellarole A, Karmally S, Szymkowski DE et al (2011) Inhibition of soluble tumour necrosis factor is therapeutic in experimental autoimmune encephalomyelitis and promotes axon preservation and remyelination. Brain 134:2736–2754.  https://doi.org/10.1093/brain/awr199 CrossRefPubMedPubMedCentralGoogle Scholar
  19. 19.
    Bushnell C, McCullough LD, Awad IA, Chireau MV, Fedder WN, Furie KL et al (2014) Guidelines for the prevention of stroke in women: a statement for healthcare professionals from the American Heart Association/American Stroke Association. Stroke 45:1545–1588.  https://doi.org/10.1161/01.str.0000442009.06663.48 CrossRefPubMedGoogle Scholar
  20. 20.
    Buttini M, Appel K, Sauter A, Gebicke-Haerter PJ, Boddeke HW (1996) Expression of tumor necrosis factor alpha after focal cerebral ischaemia in the rat. Neuroscience 71:1–16CrossRefPubMedGoogle Scholar
  21. 21.
    Calverley PMA, Sethi S, Dawson M, Ward CK, Finch DK, Penney M (2017) A randomised, placebo-controlled trial of anti-interleukin-1 receptor 1 monoclonal antibody MEDI8968 in chronic obstructive pulmonary disease. Respir Res 18:153.  https://doi.org/10.1186/s12931-017-0633-7 CrossRefPubMedPubMedCentralGoogle Scholar
  22. 22.
    Chamorro A, Amaro S, Vargas M, Obach V, Cervera A, Torres F et al(2006) Interleukin 10, monocytes and increased risk of early infection in ischaemic stroke. J Neurol Neurosurg Psychiatry 77:1279–1281.  https://doi.org/10.1136/jnnp.2006.100800 CrossRefPubMedPubMedCentralGoogle Scholar
  23. 23.
    Chamorro A, Dirnagl U, Urra X, Planas AM (2016) Neuroprotection in acute stroke: targeting excitotoxicity, oxidative and nitrosative stress, and inflammation. Lancet Neurol 15:869–881.  https://doi.org/10.1016/S1474-4422(16)00114-9 CrossRefPubMedGoogle Scholar
  24. 24.
    Chen CJ, Kono H, Golenbock D, Reed G, Akira S, Rock KL (2007) Identification of a key pathway required for the sterile inflammatory response triggered by dying cells. Nat Med 13:851–856.  https://doi.org/10.1038/nm1603 CrossRefPubMedGoogle Scholar
  25. 25.
    Chopra M, Biehl M, Steinfatt T, Brandl A, Kums J, Amich J et al (2016) Exogenous TNFR2 activation protects from acute GvHD via host T reg cell expansion. J Exp Med 213:1881–1900.  https://doi.org/10.1084/jem.20151563 CrossRefPubMedPubMedCentralGoogle Scholar
  26. 26.
    Chu HX, Arumugam TV, Gelderblom M, Magnus T, Drummond GR, Sobey CG (2014) Role of CCR2 in inflammatory conditions of the central nervous system. J Cereb Blood Flow Metab 34:1425–1429.  https://doi.org/10.1038/jcbfm.2014.120 CrossRefPubMedPubMedCentralGoogle Scholar
  27. 27.
    Chu HX, Broughton BR, Kim HA, Lee S, Drummond GR, Sobey CG (2015) Evidence that Ly6C(hi) monocytes are protective in acute ischemic stroke by promoting M2 macrophage polarization. Stroke 46:1929–1937.  https://doi.org/10.1161/STROKEAHA.115.009426 CrossRefPubMedGoogle Scholar
  28. 28.
    Clark SR, McMahon CJ, Gueorguieva I, Rowland M, Scarth S, Georgiou R et al (2008) Interleukin-1 receptor antagonist penetrates human brain at experimentally therapeutic concentrations. J Cereb Blood Flow Metab 28:387–394.  https://doi.org/10.1038/sj.jcbfm.9600537 CrossRefPubMedGoogle Scholar
  29. 29.
    Clark WM, Rinker LG, Lessov NS, Hazel K, Hill JK, Stenzel-Poore M et al (2000) Lack of interleukin-6 expression is not protective against focal central nervous system ischemia. Stroke 31:1715–1720CrossRefPubMedGoogle Scholar
  30. 30.
    Clausen B, Degn M, Martin N, Couch Y, Karimi L, Ormhoj M et al (2014) Systemically administered anti-TNF therapy ameliorates functional outcomes after focal cerebral ischemia. J Neuroinflammation 11:203.  https://doi.org/10.1186/PREACCEPT-2982253041347736 CrossRefPubMedPubMedCentralGoogle Scholar
  31. 31.
    Clausen BH, Degn M, Sivasaravanaparan M, Fogtmann T, Andersen MG, Trojanowsky MD et al (2016) Conditional ablation of myeloid TNF increases lesion volume after experimental stroke in mice, possibly via altered ERK1/2 signaling. Scientific reports 6:29291.  https://doi.org/10.1038/srep29291 CrossRefPubMedPubMedCentralGoogle Scholar
  32. 32.
    Clausen BH, Lambertsen KL, Babcock AA, Holm TH, Dagnaes-Hansen F, Finsen B (2008) Interleukin-1beta and tumor necrosis factor-alpha are expressed by different subsets of microglia and macrophages after ischemic stroke in mice. J Neuroinflammation 5:46.  https://doi.org/10.1186/1742-2094-5-46 CrossRefPubMedPubMedCentralGoogle Scholar
  33. 33.
    Clausen BH, Lambertsen KL, Dagnaes-Hansen F, Babcock AA, von Linstow CU, Meldgaard M et al (2016) Cell therapy centered on IL-1Ra is neuroprotective in experimental stroke. Acta Neuropathol.  https://doi.org/10.1007/s00401-016-1541-5 CrossRefPubMedPubMedCentralGoogle Scholar
  34. 34.
    Cohen I, Rider P, Carmi Y, Braiman A, Dotan S, White MR et al (2010) Differential release of chromatin-bound IL-1alpha discriminates between necrotic and apoptotic cell death by the ability to induce sterile inflammation. Proc Natl Acad Sci USA 107:2574–2579.  https://doi.org/10.1073/pnas.0915018107 CrossRefPubMedGoogle Scholar
  35. 35.
    Conway SE, Roy-O’Reilly M, Friedler B, Staff I, Fortunato G, McCullough LD (2015) Sex differences and the role of IL-10 in ischemic stroke recovery. Biol Sex Differ 6:17.  https://doi.org/10.1186/s13293-015-0035-9 CrossRefPubMedPubMedCentralGoogle Scholar
  36. 36.
    Cuartero MI, Ballesteros I, Moraga A, Nombela F, Vivancos J, Hamilton JA et al (2013) N2 neutrophils, novel players in brain inflammation after stroke: modulation by the PPARgamma agonist rosiglitazone. Stroke 44:3498–3508.  https://doi.org/10.1161/STROKEAHA.113.002470 CrossRefPubMedGoogle Scholar
  37. 37.
    Davies CA, Loddick SA, Toulmond S, Stroemer RP, Hunt J, Rothwell NJ (1999) The progression and topographic distribution of interleukin-1beta expression after permanent middle cerebral artery occlusion in the rat. J Cereb Blood Flow Metab 19:87–98CrossRefPubMedGoogle Scholar
  38. 38.
    de Bilbao F, Arsenijevic D, Moll T, Garcia-Gabay I, Vallet P, Langhans W et al (2009) In vivo over-expression of interleukin-10 increases resistance to focal brain ischemia in mice. J Neurochem 110:12–22.  https://doi.org/10.1111/j.1471-4159.2009.06098.x CrossRefPubMedGoogle Scholar
  39. 39.
    del Zoppo GJ, Mabuchi T (2003) Cerebral microvessel responses to focal ischemia. J Cereb Blood Flow Metab 23:879–894.  https://doi.org/10.1097/01.WCB.0000078322.96027.78 CrossRefPubMedGoogle Scholar
  40. 40.
    Denes A, Ferenczi S, Kovacs KJ (2011) Systemic inflammatory challenges compromise survival after experimental stroke via augmenting brain inflammation, blood- brain barrier damage and brain oedema independently of infarct size. J Neuroinflammation 8:164.  https://doi.org/10.1186/1742-2094-8-164 CrossRefPubMedPubMedCentralGoogle Scholar
  41. 41.
    Dimitrijevic OB, Stamatovic SM, Keep RF, Andjelkovic AV (2007) Absence of the chemokine receptor CCR2 protects against cerebral ischemia/reperfusion injury in mice. Stroke 38:1345–1353.  https://doi.org/10.1161/01.STR.0000259709.16654.8f CrossRefPubMedGoogle Scholar
  42. 42.
    Dinarello CA (1996) Biologic basis for interleukin-1 in disease. Blood 87:2095–2147PubMedGoogle Scholar
  43. 43.
    Dinarello CA (2011) Interleukin-1 in the pathogenesis and treatment of inflammatory diseases. Blood 117:3720–3732.  https://doi.org/10.1182/blood-2010-07-273417 CrossRefPubMedPubMedCentralGoogle Scholar
  44. 44.
    Dong Y, Fischer R, Naude PJ, Maier O, Nyakas C, Duffey M et al (2016) Essential protective role of tumor necrosis factor receptor 2 in neurodegeneration. Proc Natl Acad Sci USA 113:12304–12309.  https://doi.org/10.1073/pnas.1605195113 CrossRefPubMedGoogle Scholar
  45. 45.
    Dubois CM, Ruscetti FW, Keller JR, Oppenheim JJ, Hestdal K, Chizzonite R et al (1991) In vivo interleukin-1 (IL-1) administration indirectly promotes type II IL-1 receptor expression on hematopoietic bone marrow cells: novel mechanism for the hematopoietic effects of IL-1. Blood 78:2841–2847PubMedGoogle Scholar
  46. 46.
    Dziedzic T, Gryz EA, Turaj W, Slowik A, Szczudlik A (2004) Serum interleukin-6 soluble receptor in relation to interleukin-6 in stroke patients. J Mol Neurosci 24:293–298.  https://doi.org/10.1385/JMN:24:2:293 CrossRefPubMedGoogle Scholar
  47. 47.
    Efimov GA, Kruglov AA, Khlopchatnikova ZV, Rozov FN, Mokhonov VV, Rose-John S et al (2016) Cell-type-restricted anti-cytokine therapy: TNF inhibition from one pathogenic source. Proc Natl Acad Sci USA 113:3006–3011.  https://doi.org/10.1073/pnas.1520175113 CrossRefPubMedGoogle Scholar
  48. 48.
    Eigenbrod T, Park JH, Harder J, Iwakura Y, Nunez G (2008) Cutting edge: critical role for mesothelial cells in necrosis-induced inflammation through the recognition of IL-1 alpha released from dying cells. J Immunol 181:8194–8198CrossRefPubMedPubMedCentralGoogle Scholar
  49. 49.
    Eissner G, Kolch W, Scheurich P (2004) Ligands working as receptors: reverse signaling by members of the TNF superfamily enhance the plasticity of the immune system. Cytokine Growth Factor Rev 15:353–366.  https://doi.org/10.1016/j.cytogfr.2004.03.011 CrossRefPubMedPubMedCentralGoogle Scholar
  50. 50.
    Emmerich J, Mumm JB, Chan IH, LaFace D, Truong H, McClanahan T et al (2012) IL-10 directly activates and expands tumor-resident CD8(+) T cells without de novo infiltration from secondary lymphoid organs. Cancer Res 72:3570–3581.  https://doi.org/10.1158/0008-5472.CAN-12-0721 CrossRefPubMedGoogle Scholar
  51. 51.
    Emsley HC, Smith CJ, Georgiou RF, Vail A, Hopkins SJ, Rothwell NJ et al (2005) A randomised phase II study of interleukin-1 receptor antagonist in acute stroke patients. J Neurol Neurosurg Psychiatry 76:1366–1372.  https://doi.org/10.1136/jnnp.2004.054882 CrossRefPubMedPubMedCentralGoogle Scholar
  52. 52.
    Erta M, Quintana A, Hidalgo J (2012) Interleukin-6, a major cytokine in the central nervous system. Int J Biol Sci 8:1254–1266.  https://doi.org/10.7150/ijbs.4679 CrossRefPubMedPubMedCentralGoogle Scholar
  53. 53.
    Feng Q, Wang YI, Yang Y (2015) Neuroprotective effect of interleukin-6 in a rat model of cerebral ischemia. Exp Ther Med 9:1695–1701.  https://doi.org/10.3892/etm.2015.2363 CrossRefPubMedPubMedCentralGoogle Scholar
  54. 54.
    Friedlander RM, Gagliardini V, Hara H, Fink KB, Li W, MacDonald G et al (1997) Expression of a dominant negative mutant of interleukin-1 beta converting enzyme in transgenic mice prevents neuronal cell death induced by trophic factor withdrawal and ischemic brain injury. J Exp Med 185:933–940CrossRefPubMedPubMedCentralGoogle Scholar
  55. 55.
    Gabay C, Smith MF, Eidlen D, Arend WP (1997) Interleukin 1 receptor antagonist (IL-1Ra) is an acute-phase protein. J Clin Invest 99:2930–2940.  https://doi.org/10.1172/JCI119488 CrossRefPubMedPubMedCentralGoogle Scholar
  56. 56.
    Galatro TF, Holtman IR, Lerario AM, Vainchtein ID, Brouwer N, Sola PR et al (2017) Transcriptomic analysis of purified human cortical microglia reveals age-associated changes. Nat Neurosci 20:1162–1171.  https://doi.org/10.1038/nn.4597 CrossRefPubMedGoogle Scholar
  57. 57.
    Galea J, Ogungbenro K, Hulme S, Greenhalgh A, Aarons L, Scarth S et al (2011) Intravenous anakinra can achieve experimentally effective concentrations in the central nervous system within a therapeutic time window: results of a dose-ranging study. J Cereb Blood Flow Metab 31:439–447.  https://doi.org/10.1038/jcbfm.2010.103 CrossRefPubMedGoogle Scholar
  58. 58.
    Garbers C, Thaiss W, Jones GW, Waetzig GH, Lorenzen I, Guilhot F et al (2011) Inhibition of classic signaling is a novel function of soluble glycoprotein 130 (sgp130), which is controlled by the ratio of interleukin 6 and soluble interleukin 6 receptor. J Biol Chem 286:42959–42970.  https://doi.org/10.1074/jbc.M111.295758 CrossRefPubMedPubMedCentralGoogle Scholar
  59. 59.
    Garcia JH, Liu KF, Relton JK (1995) Interleukin-1 receptor antagonist decreases the number of necrotic neurons in rats with middle cerebral artery occlusion. Am J Pathol 147:1477–1486PubMedPubMedCentralGoogle Scholar
  60. 60.
    Garcin G, Paul F, Staufenbiel M, Bordat Y, Van der Heyden J, Wilmes S et al (2014) High efficiency cell-specific targeting of cytokine activity. Nature communications 5:3016.  https://doi.org/10.1038/ncomms4016 CrossRefPubMedGoogle Scholar
  61. 61.
    Girard S, Brough D, Lopez-Castejon G, Giles J, Rothwell NJ, Allan SM (2013) Microglia and macrophages differentially modulate cell death after brain injury caused by oxygen-glucose deprivation in organotypic brain slices. Glia 61:813–824.  https://doi.org/10.1002/glia.22478 CrossRefPubMedPubMedCentralGoogle Scholar
  62. 62.
    Girard S, Murray KN, Rothwell NJ, Metz GA, Allan SM (2014) Long-term functional recovery and compensation after cerebral ischemia in rats. Behav Brain Res 270:18–28.  https://doi.org/10.1016/j.bbr.2014.05.008 CrossRefPubMedPubMedCentralGoogle Scholar
  63. 63.
    Gliem M, Mausberg AK, Lee JI, Simiantonakis I, van Rooijen N, Hartung HP et al (2012) Macrophages prevent hemorrhagic infarct transformation in murine stroke models. Ann Neurol 71:743–752.  https://doi.org/10.1002/ana.23529 CrossRefPubMedGoogle Scholar
  64. 64.
    Granowitz EV, Porat R, Mier JW, Pribble JP, Stiles DM, Bloedow DC et al (1992) Pharmacokinetics, safety and immunomodulatory effects of human recombinant interleukin-1 receptor antagonist in healthy humans. Cytokine 4:353–360CrossRefPubMedGoogle Scholar
  65. 65.
    Greenfeder SA, Nunes P, Kwee L, Labow M, Chizzonite RA, Ju G (1995) Molecular cloning and characterization of a second subunit of the interleukin 1 receptor complex. J Biol Chem 270:13757–13765CrossRefPubMedGoogle Scholar
  66. 66.
    Greenhalgh AD, Galea J, Denes A, Tyrrell PJ, Rothwell NJ (2010) Rapid brain penetration of interleukin-1 receptor antagonist in rat cerebral ischaemia: pharmacokinetics, distribution, protection. Br J Pharmacol 160:153–159.  https://doi.org/10.1111/j.1476-5381.2010.00684.x CrossRefPubMedPubMedCentralGoogle Scholar
  67. 67.
    Gregory AP, Dendrou CA, Attfield KE, Haghikia A, Xifara DK, Butter F et al (2012) TNF receptor 1 genetic risk mirrors outcome of anti-TNF therapy in multiple sclerosis. Nature 488:508–511.  https://doi.org/10.1038/nature11307 CrossRefPubMedPubMedCentralGoogle Scholar
  68. 68.
    Grell M, Douni E, Wajant H, Lohden M, Clauss M, Maxeiner B et al (1995) The transmembrane form of tumor necrosis factor is the prime activating ligand of the 80 kDa tumor necrosis factor receptor. Cell 83:793–802CrossRefPubMedGoogle Scholar
  69. 69.
    Grell M, Wajant H, Zimmermann G, Scheurich P (1998) The type 1 receptor (CD120a) is the high-affinity receptor for soluble tumor necrosis factor. Proc Natl Acad Sci USA 95:570–575CrossRefPubMedGoogle Scholar
  70. 70.
    Gronhoj MH, Clausen BH, Fenger CD, Lambertsen KL, Finsen B (2017) Beneficial potential of intravenously administered IL-6 in improving outcome after murine experimental stroke. Brain Behav Immun 65:296–311.  https://doi.org/10.1016/j.bbi.2017.05.019 CrossRefPubMedGoogle Scholar
  71. 71.
    Gueorguieva I, Clark SR, McMahon CJ, Scarth S, Rothwell NJ, Tyrrell PJ et al (2008) Pharmacokinetic modelling of interleukin-1 receptor antagonist in plasma and cerebrospinal fluid of patients following subarachnoid haemorrhage. Br J Clin Pharmacol 65:317–325.  https://doi.org/10.1111/j.1365-2125.2007.03026.x CrossRefPubMedGoogle Scholar
  72. 72.
    Guo H, Callaway JB, Ting JP (2015) Inflammasomes: mechanism of action, role in disease, and therapeutics. Nat Med 21:677–687.  https://doi.org/10.1038/nm.3893 CrossRefPubMedPubMedCentralGoogle Scholar
  73. 73.
    Hara H, Friedlander RM, Gagliardini V, Ayata C, Fink K, Huang Z et al (1997) Inhibition of interleukin 1beta converting enzyme family proteases reduces ischemic and excitotoxic neuronal damage. Proc Natl Acad Sci USA 94:2007–2012CrossRefPubMedGoogle Scholar
  74. 74.
    Hata R, Maeda K, Hermann D, Mies G, Hossmann KA (2000) Dynamics of regional brain metabolism and gene expression after middle cerebral artery occlusion in mice. J Cereb Blood Flow Metab 20:306–315.  https://doi.org/10.1097/00004647-200002000-00012 CrossRefPubMedGoogle Scholar
  75. 75.
    Hata R, Maeda K, Hermann D, Mies G, Hossmann KA (2000) Evolution of brain infarction after transient focal cerebral ischemia in mice. J Cereb Blood Flow Metab 20:937–946CrossRefPubMedGoogle Scholar
  76. 76.
    Hayward NJ, Elliott PJ, Sawyer SD, Bronson RT, Bartus RT (1996) Lack of evidence for neutrophil participation during infarct formation following focal cerebral ischemia in the rat. Exp Neurol 139:188–202CrossRefPubMedGoogle Scholar
  77. 77.
    Heiss WD, Zaro Weber O (2017) Validation of MRI determination of the penumbra by PET measurements in ischemic stroke. J Nuclear Med 58:187–193.  https://doi.org/10.2967/jnumed.116.185975 CrossRefGoogle Scholar
  78. 78.
    Hickman SE, Kingery ND, Ohsumi TK, Borowsky ML, Wang LC, Means TK et al (2013) The microglial sensome revealed by direct RNA sequencing. Nat Neurosci 16:1896–1905.  https://doi.org/10.1038/nn.3554 CrossRefPubMedPubMedCentralGoogle Scholar
  79. 79.
    Hosomi N, Ban CR, Naya T, Takahashi T, Guo P, Song XY et al (2005) Tumor necrosis factor-alpha neutralization reduced cerebral edema through inhibition of matrix metalloproteinase production after transient focal cerebral ischemia. J Cereb Blood Flow Metab 25:959–967.  https://doi.org/10.1038/sj.jcbfm.9600086 CrossRefPubMedGoogle Scholar
  80. 80.
    Howe MD, McCullough LD (2015) Prevention and management of stroke in women. Expert Rev Cardiovasc Ther 13:403–415.  https://doi.org/10.1586/14779072.2015.1020300 CrossRefPubMedGoogle Scholar
  81. 81.
    Ito D, Tanaka K, Suzuki S, Dembo T, Fukuuchi Y (2001) Enhanced expression of Iba1, ionized calcium-binding adapter molecule 1, after transient focal cerebral ischemia in rat brain. Stroke 32:1208–1215CrossRefPubMedGoogle Scholar
  82. 82.
    Iwata N, Takayama H, Xuan M, Kamiuchi S, Matsuzaki H, Okazaki M et al (2015) Effects of etanercept against transient cerebral ischemia in diabetic rats. Biomed Res Int 2015:189292.  https://doi.org/10.1155/2015/189292 CrossRefPubMedPubMedCentralGoogle Scholar
  83. 83.
    Jickling GC, Liu D, Ander BP, Stamova B, Zhan X, Sharp FR (2015) Targeting neutrophils in ischemic stroke: translational insights from experimental studies. J Cereb Blood Flow Metab 35:888–901.  https://doi.org/10.1038/jcbfm.2015.45 CrossRefPubMedPubMedCentralGoogle Scholar
  84. 84.
    Johnson W, Onuma O, Owolabi M, Sachdev S (2016) Stroke: a global response is needed. Bull World Health Organ 94:634–634A.  https://doi.org/10.2471/BLT.16.181636 CrossRefPubMedPubMedCentralGoogle Scholar
  85. 85.
    Jones SA, Rose-John S (2002) The role of soluble receptors in cytokine biology: the agonistic properties of the sIL-6R/IL-6 complex. Biochim Biophys Acta 1592:251–263CrossRefPubMedGoogle Scholar
  86. 86.
    Jostock T, Mullberg J, Ozbek S, Atreya R, Blinn G, Voltz N et al (2001) Soluble gp130 is the natural inhibitor of soluble interleukin-6 receptor transsignaling responses. Eur J Biochem 268:160–167CrossRefPubMedGoogle Scholar
  87. 87.
    Kirchner S, Boldt S, Kolch W, Haffner S, Kazak S, Janosch P et al (2004) LPS resistance in monocytic cells caused by reverse signaling through transmembrane TNF (mTNF) is mediated by the MAPK/ERK pathway. J Leukoc Biol 75:324–331.  https://doi.org/10.1189/jlb.0703343 CrossRefPubMedGoogle Scholar
  88. 88.
    Kontermann RE, Munkel S, Neumeyer J, Muller D, Branschadel M, Scheurich P et al (2008) A humanized tumor necrosis factor receptor 1 (TNFR1)-specific antagonistic antibody for selective inhibition of tumor necrosis factor (TNF) action. J Immunother 31:225–234.  https://doi.org/10.1097/CJI.0b013e31816a88f9 CrossRefPubMedGoogle Scholar
  89. 89.
    Kumar P, Yadav AK, Misra S, Kumar A, Chakravarty K, Prasad K (2016) Role of Interleukin-10 (-1082A/G) gene polymorphism with the risk of ischemic stroke: a meta-analysis. Neurol Res 38:823–830.  https://doi.org/10.1080/01616412.2016.1202395 CrossRefPubMedGoogle Scholar
  90. 90.
    Kuno K, Matsushima K (1994) The IL-1 receptor signaling pathway. J Leukoc Biol 56:542–547CrossRefPubMedGoogle Scholar
  91. 91.
    Lambertsen KL, Biber K, Finsen B (2012) Inflammatory cytokines in experimental and human stroke. J Cereb Blood Flow Metab 32:1677–1698.  https://doi.org/10.1038/jcbfm.2012.88 CrossRefPubMedPubMedCentralGoogle Scholar
  92. 92.
    Lambertsen KL, Clausen BH, Babcock AA, Gregersen R, Fenger C, Nielsen HH et al (2009) Microglia protect neurons against ischemia by synthesis of tumor necrosis factor. J Neurosci 29:1319–1330.  https://doi.org/10.1523/JNEUROSCI.5505-08.2009 CrossRefPubMedPubMedCentralGoogle Scholar
  93. 93.
    Lambertsen KL, Clausen BH, Fenger C, Wulf H, Owens T, Dagnaes-Hansen F et al (2007) Microglia and macrophages express tumor necrosis factor receptor p75 following middle cerebral artery occlusion in mice. Neuroscience 144:934–949.  https://doi.org/10.1016/j.neuroscience.2006.10.046 CrossRefPubMedGoogle Scholar
  94. 94.
    Lambertsen KL, Meldgaard M, Ladeby R, Finsen B (2005) A quantitative study of microglial-macrophage synthesis of tumor necrosis factor during acute and late focal cerebral ischemia in mice. J Cereb Blood Flow Metab 25:119–135.  https://doi.org/10.1038/sj.jcbfm.9600014 CrossRefPubMedGoogle Scholar
  95. 95.
    Leigh R, Knutsson L, Zhou J, van Zijl PC (2017) Imaging the physiological evolution of the ischemic penumbra in acute ischemic stroke. J Cereb Blood Flow Metab.  https://doi.org/10.1177/0271678x17700913
  96. 96.
    Liesz A, Bauer A, Hoheisel JD, Veltkamp R (2014) Intracerebral interleukin-10 injection modulates post-ischemic neuroinflammation: an experimental microarray study. Neurosci Lett 579:18–23.  https://doi.org/10.1016/j.neulet.2014.07.003 CrossRefPubMedGoogle Scholar
  97. 97.
    Liesz A, Zhou W, Na SY, Hammerling GJ, Garbi N, Karcher S et al (2013) Boosting regulatory T cells limits neuroinflammation in permanent cortical stroke. J Neurosci 33:17350–17362.  https://doi.org/10.1523/JNEUROSCI.4901-12.2013 CrossRefPubMedPubMedCentralGoogle Scholar
  98. 98.
    Liguz-Lecznar M, Zakrzewska R, Kossut M (2015) Inhibition of Tnf-alpha R1 signaling can rescue functional cortical plasticity impaired in early post-stroke period. Neurobiol Aging 36:2877–2884.  https://doi.org/10.1016/j.neurobiolaging.2015.06.015 CrossRefPubMedGoogle Scholar
  99. 99.
    Loddick SA, Rothwell NJ (1996) Neuroprotective effects of human recombinant interleukin-1 receptor antagonist in focal cerebral ischaemia in the rat. J Cereb Blood Flow Metab 16:932–940CrossRefPubMedGoogle Scholar
  100. 100.
    Loddick SA, Turnbull AV, Rothwell NJ (1998) Cerebral interleukin-6 is neuroprotective during permanent focal cerebral ischemia in the rat. J Cereb Blood Flow Metab 18:176–179.  https://doi.org/10.1097/00004647-199802000-00008 CrossRefPubMedGoogle Scholar
  101. 101.
    Loddick SA, Wong ML, Bongiorno PB, Gold PW, Licinio J, Rothwell NJ (1997) Endogenous interleukin-1 receptor antagonist is neuroprotective. Biochem Biophys Res Commun 234:211–215CrossRefPubMedGoogle Scholar
  102. 102.
    Luheshi NM, Rothwell NJ, Brough D (2009) The dynamics and mechanisms of interleukin-1alpha and beta nuclear import. Traffic 10:16–25.  https://doi.org/10.1111/j.1600-0854.2008.00840.x CrossRefPubMedGoogle Scholar
  103. 103.
    Lust JA, Donovan KA, Kline MP, Greipp PR, Kyle RA, Maihle NJ (1992) Isolation of an mRNA encoding a soluble form of the human interleukin-6 receptor. Cytokine 4:96–100CrossRefPubMedGoogle Scholar
  104. 104.
    Madsen PM, Clausen BH, Degn M, Thyssen S, Kristensen LK, Svensson M et al (2016) Genetic ablation of soluble tumor necrosis factor with preservation of membrane tumor necrosis factor is associated with neuroprotection after focal cerebral ischemia. J Cereb Blood Flow Metab 36:1553–1569.  https://doi.org/10.1177/0271678X15610339 CrossRefPubMedGoogle Scholar
  105. 105.
    Malyak M, Smith MF Jr, Abel AA, Hance KR, Arend WP (1998) The differential production of three forms of IL-1 receptor antagonist by human neutrophils and monocytes. J Immunol 161:2004–2010PubMedGoogle Scholar
  106. 106.
    Maysami S, Wong R, Pradillo JM, Denes A, Dhungana H, Malm T et al (2016) A cross-laboratory preclinical study on the effectiveness of interleukin-1 receptor antagonist in stroke. J Cereb Blood Flow Metab 36:596–605.  https://doi.org/10.1177/0271678X15606714 CrossRefPubMedGoogle Scholar
  107. 107.
    McCabe C, Arroja MM, Reid E, Macrae IM (2018) Animal models of ischaemic stroke and characterisation of the ischaemic penumbra. Neuropharmacology 134:169–177.  https://doi.org/10.1016/j.neuropharm.2017.09.022 CrossRefPubMedGoogle Scholar
  108. 108.
    McCann FE, Perocheau DP, Ruspi G, Blazek K, Davies ML, Feldmann M et al (2014) Selective tumor necrosis factor receptor I blockade is antiinflammatory and reveals immunoregulatory role of tumor necrosis factor receptor II in collagen-induced arthritis. Arthritis Rheumatol 66:2728–2738.  https://doi.org/10.1002/art.38755 CrossRefPubMedGoogle Scholar
  109. 109.
    McColl BW, Rothwell NJ, Allan SM (2007) Systemic inflammatory stimulus potentiates the acute phase and CXC chemokine responses to experimental stroke and exacerbates brain damage via interleukin-1- and neutrophil-dependent mechanisms. J Neurosci 27:4403–4412.  https://doi.org/10.1523/JNEUROSCI.5376-06.2007 CrossRefPubMedGoogle Scholar
  110. 110.
    Mease PJ, Gottlieb AB, Berman A, Drescher E, Xing J, Wong R et al (2016) The efficacy and safety of clazakizumab, an anti-interleukin-6 monoclonal antibody, in a phase IIb study of adults with active psoriatic arthritis. Arthritis Rheumatol 68:2163–2173.  https://doi.org/10.1002/art.39700 CrossRefPubMedGoogle Scholar
  111. 111.
    Meng C, Zhang JC, Shi RL, Zhang SH, Yuan SY (2015) Inhibition of interleukin-6 abolishes the promoting effects of pair housing on post-stroke neurogenesis. Neuroscience 307:160–170.  https://doi.org/10.1016/j.neuroscience.2015.08.055 CrossRefPubMedGoogle Scholar
  112. 112.
    Meng X, Fisher M, Shen Q, Sotak CH, Duong TQ (2004) Characterizing the diffusion/perfusion mismatch in experimental focal cerebral ischemia. Ann Neurol 55:207–212.  https://doi.org/10.1002/ana.10803 CrossRefPubMedPubMedCentralGoogle Scholar
  113. 113.
    Merhi-Soussi F, Berti M, Wehrle-Haller B, Gabay C (2005) Intracellular interleukin-1 receptor antagonist type 1 antagonizes the stimulatory effect of interleukin-1 alpha precursor on cell motility. Cytokine 32:163–170.  https://doi.org/10.1016/j.cyto.2005.09.004 CrossRefPubMedGoogle Scholar
  114. 114.
    Mesples B, Plaisant F, Gressens P (2003) Effects of interleukin-10 on neonatal excitotoxic brain lesions in mice. Brain Res Dev Brain Res 141:25–32CrossRefPubMedGoogle Scholar
  115. 115.
    Michelucci A, Heurtaux T, Grandbarbe L, Morga E, Heuschling P (2009) Characterization of the microglial phenotype under specific pro-inflammatory and anti-inflammatory conditions: effects of oligomeric and fibrillar amyloid-beta. J Neuroimmunol 210:3–12.  https://doi.org/10.1016/j.jneuroim.2009.02.003 CrossRefPubMedGoogle Scholar
  116. 116.
    Miro-Mur F, Perez-de-Puig I, Ferrer-Ferrer M, Urra X, Justicia C, Chamorro A et al (2016) Immature monocytes recruited to the ischemic mouse brain differentiate into macrophages with features of alternative activation. Brain Behav Immun 53:18–33.  https://doi.org/10.1016/j.bbi.2015.08.010 CrossRefPubMedGoogle Scholar
  117. 117.
    Mohammed FF, Smookler DS, Taylor SE, Fingleton B, Kassiri Z, Sanchez OH et al (2004) Abnormal TNF activity in Timp3−/− mice leads to chronic hepatic inflammation and failure of liver regeneration. Nat Genet 36:969–977.  https://doi.org/10.1038/ng1413 CrossRefPubMedGoogle Scholar
  118. 118.
    Naing A, Papadopoulos KP, Autio KA, Ott PA, Patel MR, Wong DJ et al (2016) Safety, antitumor activity, and immune activation of pegylated recombinant human interleukin-10 (AM0010) in patients with advanced solid tumors. J Clin Oncol 34:3562–3569.  https://doi.org/10.1200/JCO.2016.68.1106 CrossRefPubMedPubMedCentralGoogle Scholar
  119. 119.
    Nakajima M, Nito C, Sowa K, Suda S, Nishiyama Y, Nakamura-Takahashi A et al (2017) Mesenchymal stem cells overexpressing interleukin-10 promote neuroprotection in experimental acute ischemic stroke. Mol Ther Methods Clin Dev 6:102–111.  https://doi.org/10.1016/j.omtm.2017.06.005 CrossRefPubMedPubMedCentralGoogle Scholar
  120. 120.
    Nawashiro H, Martin D, Hallenbeck JM (1997) Inhibition of tumor necrosis factor and amelioration of brain infarction in mice. J Cereb Blood Flow Metab 17:229–232.  https://doi.org/10.1097/00004647-199702000-00013 CrossRefPubMedGoogle Scholar
  121. 121.
    Nawashiro H, Martin D, Hallenbeck JM (1997) Neuroprotective effects of TNF binding protein in focal cerebral ischemia. Brain Res 778:265–271CrossRefPubMedGoogle Scholar
  122. 122.
    Neher JJ, Emmrich JV, Fricker M, Mander PK, Thery C, Brown GC (2013) Phagocytosis executes delayed neuronal death after focal brain ischemia. Proc Natl Acad Sci USA 110:E4098–4107.  https://doi.org/10.1073/pnas.1308679110 CrossRefPubMedGoogle Scholar
  123. 123.
    Netea MG, van de Veerdonk FL, van der Meer JW, Dinarello CA, Joosten LA (2015) Inflammasome-independent regulation of IL-1-family cytokines. Annu Rev Immunol 33:49–77.  https://doi.org/10.1146/annurev-immunol-032414-112306 CrossRefPubMedGoogle Scholar
  124. 124.
    Neumann H, Kotter MR, Franklin RJ (2009) Debris clearance by microglia: an essential link between degeneration and regeneration. Brain 132:288–295.  https://doi.org/10.1093/brain/awn109 CrossRefPubMedGoogle Scholar
  125. 125.
    Neumann J, Riek-Burchardt M, Herz J, Doeppner TR, Konig R, Hutten H et al (2015) Very-late-antigen-4 (VLA-4)-mediated brain invasion by neutrophils leads to interactions with microglia, increased ischemic injury and impaired behavior in experimental stroke. Acta Neuropathol 129:259–277.  https://doi.org/10.1007/s00401-014-1355-2 CrossRefPubMedGoogle Scholar
  126. 126.
    Nguyen TV, Frye JB, Zbesko JC, Stepanovic K, Hayes M, Urzua A et al (2016) Multiplex immunoassay characterization and species comparison of inflammation in acute and non-acute ischemic infarcts in human and mouse brain tissue. Acta Neuropathol Commun 4:100.  https://doi.org/10.1186/s40478-016-0371-y CrossRefPubMedPubMedCentralGoogle Scholar
  127. 127.
    Nogueira RG, Jadhav AP, Haussen DC, Bonafe A, Budzik RF, Bhuva P et al (2018) Thrombectomy 6 to 24 hours after stroke with a mismatch between deficit and infarct. N Engl J Med 378:11–21.  https://doi.org/10.1056/NEJMoa1706442 CrossRefGoogle Scholar
  128. 128.
    Nosenko MA, Atretkhany KN, Mokhonov VV, Efimov GA, Kruglov AA, Tillib SV et al (2017) VHH-based bispecific antibodies targeting cytokine production. Front Immunol 8:1073.  https://doi.org/10.3389/fimmu.2017.01073 CrossRefPubMedPubMedCentralGoogle Scholar
  129. 129.
    Novrup HG, Bracchi-Ricard V, Ellman DG, Ricard J, Jain A, Runko E et al (2014) Central but not systemic administration of XPro1595 is therapeutic following moderate spinal cord injury in mice. J Neuroinflammation 11:159.  https://doi.org/10.1186/s12974-014-0159-6 CrossRefPubMedPubMedCentralGoogle Scholar
  130. 130.
    Ooboshi H, Ibayashi S, Shichita T, Kumai Y, Takada J, Ago T et al (2005) Postischemic gene transfer of interleukin-10 protects against both focal and global brain ischemia. Circulation 111:913–919.  https://doi.org/10.1161/01.CIR.0000155622.68580.DC CrossRefPubMedGoogle Scholar
  131. 131.
    Perego C, Fumagalli S, De Simoni MG (2011) Temporal pattern of expression and colocalization of microglia/macrophage phenotype markers following brain ischemic injury in mice. J Neuroinflammation 8:174.  https://doi.org/10.1186/1742-2094-8-174 CrossRefPubMedPubMedCentralGoogle Scholar
  132. 132.
    Perez-de Puig I, Miro F, Salas-Perdomo A, Bonfill-Teixidor E, Ferrer-Ferrer M, Marquez-Kisinousky L et al (2013) IL-10 deficiency exacerbates the brain inflammatory response to permanent ischemia without preventing resolution of the lesion. J Cereb Blood Flow Metab 33:1955–1966.  https://doi.org/10.1038/jcbfm.2013.155 CrossRefPubMedPubMedCentralGoogle Scholar
  133. 133.
    Perez-de-Puig I, Miro-Mur F, Ferrer-Ferrer M, Gelpi E, Pedragosa J, Justicia C et al (2015) Neutrophil recruitment to the brain in mouse and human ischemic stroke. Acta Neuropathol 129:239–257.  https://doi.org/10.1007/s00401-014-1381-0 CrossRefPubMedGoogle Scholar
  134. 134.
    Pfeffer K (2003) Biological functions of tumor necrosis factor cytokines and their receptors. Cytokine Growth Factor Rev 14:185–191CrossRefPubMedGoogle Scholar
  135. 135.
    Porteu F, Hieblot C (1994) Tumor necrosis factor induces a selective shedding of its p75 receptor from human neutrophils. J Biol Chem 269:2834–2840PubMedGoogle Scholar
  136. 136.
    Protti GG, Gagliardi RJ, Forte WC, Sprovieri SR (2013) Interleukin-10 may protect against progressing injury during the acute phase of ischemic stroke. Arq Neuropsiquiatr 71:846–851.  https://doi.org/10.1590/0004-282X20130168 CrossRefPubMedGoogle Scholar
  137. 137.
    Relton JK, Martin D, Thompson RC, Russell DA (1996) Peripheral administration of Interleukin-1 Receptor antagonist inhibits brain damage after focal cerebral ischemia in the rat. Exp Neurol 138:206–213CrossRefPubMedGoogle Scholar
  138. 138.
    Relton JK, Rothwell NJ (1992) Interleukin-1 receptor antagonist inhibits ischaemic and excitotoxic neuronal damage in the rat. Brain Res Bull 29:243–246CrossRefPubMedGoogle Scholar
  139. 139.
    Ren X, Akiyoshi K, Dziennis S, Vandenbark AA, Herson PS, Hurn PD et al (2011) Regulatory B cells limit CNS inflammation and neurologic deficits in murine experimental stroke. J Neurosci 31:8556–8563.  https://doi.org/10.1523/JNEUROSCI.1623-11.2011 CrossRefPubMedPubMedCentralGoogle Scholar
  140. 140.
    Rewell SS, Churilov L, Sidon TK, Aleksoska E, Cox SF, Macleod MR et al (2017) Evolution of ischemic damage and behavioural deficit over 6 months after MCAo in the rat: selecting the optimal outcomes and statistical power for multi-centre preclinical trials. PLoS ONE 12:e0171688.  https://doi.org/10.1371/journal.pone.0171688 CrossRefPubMedPubMedCentralGoogle Scholar
  141. 141.
    Riethmueller S, Ehlers JC, Lokau J, Dusterhoft S, Knittler K, Dombrowsky G et al (2016) Cleavage site localization differentially controls interleukin-6 receptor proteolysis by ADAM10 and ADAM17. Sci Rep 6:25550.  https://doi.org/10.1038/srep25550 CrossRefPubMedPubMedCentralGoogle Scholar
  142. 142.
    Rivers CS, Wardlaw JM, Armitage PA, Bastin ME, Carpenter TK, Cvoro V (2006) Persistent infarct hyperintensity on diffusion-weighted imaging late after stroke indicates heterogeneous, delayed, infarct evolution. Stroke 37:1418–1423.  https://doi.org/10.1161/01.STR.0000221294.90068.c4 CrossRefPubMedGoogle Scholar
  143. 143.
    Rivers-Auty J, Daniels MJD, Colliver I, Robertson DL, Brough D (2018) Redefining the ancestral origins of the interleukin-1 superfamily. Nature Commun 9:1156.  https://doi.org/10.1038/s41467-018-03362-1 CrossRefGoogle Scholar
  144. 144.
    Roell MK, Issafras H, Bauer RJ, Michelson KS, Mendoza N, Vanegas SI et al (2010) Kinetic approach to pathway attenuation using XOMA 052, a regulatory therapeutic antibody that modulates interleukin-1beta activity. J Biol Chem 285:20607–20614.  https://doi.org/10.1074/jbc.M110.115790 CrossRefPubMedPubMedCentralGoogle Scholar
  145. 145.
    Rose-John S, Scheller J, Elson G, Jones SA (2006) Interleukin-6 biology is coordinated by membrane-bound and soluble receptors: role in inflammation and cancer. J Leukoc Biol 80:227–236.  https://doi.org/10.1189/jlb.1105674 CrossRefPubMedGoogle Scholar
  146. 146.
    Rose-John S, Waetzig GH, Scheller J, Grotzinger J, Seegert D (2007) The IL-6/sIL-6R complex as a novel target for therapeutic approaches. Expert Opin Ther Targets 11:613–624.  https://doi.org/10.1517/14728222.11.5.613 CrossRefPubMedGoogle Scholar
  147. 147.
    Rothaug M, Becker-Pauly C, Rose-John S (2016) The role of interleukin-6 signaling in nervous tissue. Biochim Biophys Acta 1863:1218–1227.  https://doi.org/10.1016/j.bbamcr.2016.03.018 CrossRefPubMedGoogle Scholar
  148. 148.
    Sabat R, Grutz G, Warszawska K, Kirsch S, Witte E, Wolk K et al (2010) Biology of interleukin-10. Cytokine Growth Factor Rev 21:331–344.  https://doi.org/10.1016/j.cytogfr.2010.09.002 CrossRefPubMedGoogle Scholar
  149. 149.
    Salmeron K, Aihara T, Redondo-Castro E, Pinteaux E, Bix G (2016) IL-1alpha induces angiogenesis in brain endothelial cells in vitro: implications for brain angiogenesis after acute injury. J Neurochem 136:573–580.  https://doi.org/10.1111/jnc.13422 CrossRefPubMedGoogle Scholar
  150. 150.
    Sawada M, Itoh Y, Suzumura A, Marunouchi T (1993) Expression of cytokine receptors in cultured neuronal and glial cells. Neurosci Lett 160:131–134CrossRefPubMedGoogle Scholar
  151. 151.
    Scheinfeld N (2004) A comprehensive review and evaluation of the side effects of the tumor necrosis factor alpha blockers etanercept, infliximab and adalimumab. J Dermatolog Treat 15:280–294.  https://doi.org/10.1080/09546630410017275A6NLET3WGCNW1D14 CrossRefPubMedGoogle Scholar
  152. 152.
    Scheller J, Chalaris A, Schmidt-Arras D, Rose-John S (2011) The pro- and anti-inflammatory properties of the cytokine interleukin-6. Biochim Biophys Acta 1813:878–888.  https://doi.org/10.1016/j.bbamcr.2011.01.034 CrossRefPubMedGoogle Scholar
  153. 153.
    Selvaraj UM, Stowe AM (2017) Long-term T cell responses in the brain after an ischemic stroke. Discov Med 24:323–333PubMedPubMedCentralGoogle Scholar
  154. 154.
    Shaw S, Bourne T, Meier C, Carrington B, Gelinas R, Henry A et al (2014) Discovery and characterization of olokizumab: a humanized antibody targeting interleukin-6 and neutralizing gp130-signaling. MAbs 6:774–782.  https://doi.org/10.4161/mabs.28612 CrossRefPubMedGoogle Scholar
  155. 155.
    Shibata H, Yoshioka Y, Ohkawa A, Minowa K, Mukai Y, Abe Y et al (2008) Creation and X-ray structure analysis of the tumor necrosis factor receptor-1-selective mutant of a tumor necrosis factor-alpha antagonist. J Biol Chem 283:998–1007.  https://doi.org/10.1074/jbc.M707933200 CrossRefPubMedGoogle Scholar
  156. 156.
    Sloan-Lancaster J, Abu-Raddad E, Polzer J, Miller JW, Scherer JC, De Gaetano A (2013) Double-blind, randomized study evaluating the glycemic and anti-inflammatory effects of subcutaneous LY2189102, a neutralizing IL-1beta antibody, in patients with type 2 diabetes. Diabetes Care 36:2239–2246.  https://doi.org/10.2337/dc12-1835 CrossRefPubMedPubMedCentralGoogle Scholar
  157. 157.
    Smith CJ, Emsley HC, Gavin CM, Georgiou RF, Vail A, Barberan EM et al (2004) Peak plasma interleukin-6 and other peripheral markers of inflammation in the first week of ischaemic stroke correlate with brain infarct volume, stroke severity and long-term outcome. BMC Neurol 4:2.  https://doi.org/10.1186/1471-2377-4-2 CrossRefPubMedPubMedCentralGoogle Scholar
  158. 158.
    Smith CJ, Emsley HC, Udeh CT, Vail A, Hoadley ME, Rothwell NJ et al (2012) Interleukin-1 receptor antagonist reverses stroke-associated peripheral immune suppression. Cytokine 58:384–389.  https://doi.org/10.1016/j.cyto.2012.02.016 CrossRefPubMedGoogle Scholar
  159. 159.
    Smith CJ, Hulme S, Vail A, Heal C, Parry-Jones AR, Scarth S et al (2018) SCIL-STROKE (subcutaneous interleukin-1 receptor antagonist in ischemic stroke): a randomized controlled phase 2 trial. Stroke 49:1210–1216.  https://doi.org/10.1161/STROKEAHA.118.020750 CrossRefPubMedGoogle Scholar
  160. 160.
    Spera PA, Ellison JA, Feuerstein GZ, Barone FC (1998) IL-10 reduces rat brain injury following focal stroke. Neurosci Lett 251:189–192CrossRefPubMedGoogle Scholar
  161. 161.
    Spulber S, Bartfai T, Schultzberg M (2009) IL-1/IL-1ra balance in the brain revisited—evidence from transgenic mouse models. Brain Behav Immun 23:573–579.  https://doi.org/10.1016/j.bbi.2009.02.015 CrossRefPubMedGoogle Scholar
  162. 162.
    Steed PM, Tansey MG, Zalevsky J, Zhukovsky EA, Desjarlais JR, Szymkowski DE et al (2003) Inactivation of TNF signaling by rationally designed dominant-negative TNF variants. Science 301:1895–1898.  https://doi.org/10.1126/science.1081297 CrossRefPubMedGoogle Scholar
  163. 163.
    Steeland S, Puimege L, Vandenbroucke RE, Van Hauwermeiren F, Haustraete J, Devoogdt N et al (2015) Generation and characterization of small single domain antibodies inhibiting human tumor necrosis factor receptor 1. J Biol Chem 290:4022–4037.  https://doi.org/10.1074/jbc.M114.617787 CrossRefPubMedGoogle Scholar
  164. 164.
    Stellwagen D, Malenka RC (2006) Synaptic scaling mediated by glial TNF-alpha. Nature 440:1054–1059CrossRefPubMedPubMedCentralGoogle Scholar
  165. 165.
    Strle K, Zhou JH, Shen WH, Broussard SR, Johnson RW, Freund GG et al (2001) Interleukin-10 in the brain. Crit Rev Immunol 21:427–449CrossRefPubMedPubMedCentralGoogle Scholar
  166. 166.
    Stylianou E, O’Neill LA, Rawlinson L, Edbrooke MR, Woo P, Saklatvala J (1992) Interleukin 1 induces NF-kappa B through its type I but not its type II receptor in lymphocytes. J Biol Chem 267:15836–15841PubMedGoogle Scholar
  167. 167.
    Sumbria RK, Boado RJ, Pardridge WM (2012) Brain protection from stroke with intravenous TNFalpha decoy receptor-Trojan horse fusion protein. J Cereb Blood Flow Metab 32:1933–1938.  https://doi.org/10.1038/jcbfm.2012.97 CrossRefPubMedPubMedCentralGoogle Scholar
  168. 168.
    Sumbria RK, Boado RJ, Pardridge WM (2013) Combination stroke therapy in the mouse with blood-brain barrier penetrating IgG-GDNF and IgG-TNF decoy receptor fusion proteins. Brain Res 1507:91–96.  https://doi.org/10.1016/j.brainres.2013.02.022 CrossRefPubMedGoogle Scholar
  169. 169.
    Tanaka T, Narazaki M, Ogata A, Kishimoto T (2014) A new era for the treatment of inflammatory autoimmune diseases by interleukin-6 blockade strategy. Semin Immunol 26:88–96.  https://doi.org/10.1016/j.smim.2014.01.009 CrossRefPubMedGoogle Scholar
  170. 170.
    Taoufik E, Petit E, Divoux D, Tseveleki V, Mengozzi M, Roberts ML et al (2008) TNF receptor I sensitizes neurons to erythropoietin- and VEGF-mediated neuroprotection after ischemic and excitotoxic injury. Proc Natl Acad Sci USA 105:6185–6190.  https://doi.org/10.1073/pnas.0801447105 CrossRefPubMedGoogle Scholar
  171. 171.
    Thornton P, McColl BW, Greenhalgh A, Denes A, Allan SM, Rothwell NJ (2010) Platelet interleukin-1alpha drives cerebrovascular inflammation. Blood 115:3632–3639.  https://doi.org/10.1182/blood-2009-11-252643 CrossRefPubMedGoogle Scholar
  172. 172.
    Tobinick E (2010) Perispinal etanercept: a new therapeutic paradigm in neurology. Expert Rev Neurother 10:985–1002.  https://doi.org/10.1586/ern.10.52 CrossRefPubMedGoogle Scholar
  173. 173.
    Tobinick E (2011) Rapid improvement of chronic stroke deficits after perispinal etanercept: three consecutive cases. CNS Drugs 25:145–155.  https://doi.org/10.2165/11588400-000000000-00000 CrossRefPubMedGoogle Scholar
  174. 174.
    Tobinick E, Kim NM, Reyzin G, Rodriguez-Romanacce H, DePuy V (2012) Selective TNF inhibition for chronic stroke and traumatic brain injury: an observational study involving 629 consecutive patients treated with perispinal etanercept. CNS Drugs 26:1051–1070.  https://doi.org/10.1007/s40263-012-0013-2 CrossRefPubMedGoogle Scholar
  175. 175.
    Touzani O, Boutin H, LeFeuvre R, Parker L, Miller A, Luheshi G et al (2002) Interleukin-1 influences ischemic brain damage in the mouse independently of the interleukin-1 type I receptor. J Neurosci 22:38–43CrossRefPubMedGoogle Scholar
  176. 176.
    Tu XK, Yang WZ, Shi SS, Wang CH, Zhang GL, Ni TR et al (2010) Spatio-temporal distribution of inflammatory reaction and expression of TLR2/4 signaling pathway in rat brain following permanent focal cerebral ischemia. Neurochem Res 35:1147–1155.  https://doi.org/10.1007/s11064-010-0167-6 CrossRefPubMedGoogle Scholar
  177. 177.
    Tyring S, Gottlieb A, Papp K, Gordon K, Leonardi C, Wang A R et al (2006) Etanercept and clinical outcomes, fatigue, and depression in psoriasis: double-blind placebo-controlled randomised phase III trial. Lancet 367:29–35.  https://doi.org/10.1016/S0140-6736(05)67763-X CrossRefPubMedGoogle Scholar
  178. 178.
    Um JY, An NH, Kim HM (2003) TNF-alpha and TNF-beta gene polymorphisms in cerebral infarction. J Mol Neurosci 21:167–171CrossRefPubMedGoogle Scholar
  179. 179.
    Vanden Berghe T, Linkermann A, Jouan-Lanhouet S, Walczak H, Vandenabeele P (2014) Regulated necrosis: the expanding network of non-apoptotic cell death pathways. Nat Rev 15:135–147.  https://doi.org/10.1038/nrm3737 CrossRefGoogle Scholar
  180. 180.
    Vila N, Castillo J, Davalos A, Esteve A, Planas AM, Chamorro A (2003) Levels of anti-inflammatory cytokines and neurological worsening in acute ischemic stroke. Stroke 34:671–675.  https://doi.org/10.1161/01.STR.0000057976.53301.69 CrossRefPubMedGoogle Scholar
  181. 181.
    Viviani B, Bartesaghi S, Gardoni F, Vezzani A, Behrens MM, Bartfai T et al (2003) Interleukin-1beta enhances NMDA receptor-mediated intracellular calcium increase through activation of the Src family of kinases. J Neurosci 23:8692–8700CrossRefPubMedGoogle Scholar
  182. 182.
    Wallach D, Engelmann H, Nophar Y, Aderka D, Kemper O, Hornik V et al (1991) Soluble and cell surface receptors for tumor necrosis factor. Agents Actions Suppl 35:51–57PubMedGoogle Scholar
  183. 183.
    Wang X, Li X, Currie RW, Willette RN, Barone FC, Feuerstein GZ (2000) Application of real-time polymerase chain reaction to quantitate induced expression of interleukin-1beta mRNA in ischemic brain tolerance. J Neurosci Res 59:238–246CrossRefPubMedGoogle Scholar
  184. 184.
    Wijdenes J, Clement C, Klein B, Morel-Fourrier B, Vita N, Ferrara P et al (1991) Human recombinant dimeric IL-6 binds to its receptor as detected by anti-IL-6 monoclonal antibodies. Mol Immunol 28:1183–1192CrossRefPubMedGoogle Scholar
  185. 185.
    Wolf J, Rose-John S, Garbers C (2014) Interleukin-6 and its receptors: a highly regulated and dynamic system. Cytokine 70:11–20.  https://doi.org/10.1016/j.cyto.2014.05.024 CrossRefPubMedGoogle Scholar
  186. 186.
    Works MG, Koenig JB, Sapolsky RM (2013) Soluble TNF receptor 1-secreting ex vivo-derived dendritic cells reduce injury after stroke. J Cereb Blood Flow Metab 33:1376–1385.  https://doi.org/10.1038/jcbfm.2013.100 CrossRefPubMedPubMedCentralGoogle Scholar
  187. 187.
    Worthmann H, Tryc AB, Dirks M, Schuppner R, Brand K, Klawonn F et al (2015) Lipopolysaccharide binding protein, interleukin-10, interleukin-6 and C-reactive protein blood levels in acute ischemic stroke patients with post-stroke infection. J Neuroinflammation 12:13.  https://doi.org/10.1186/s12974-014-0231-2 CrossRefPubMedPubMedCentralGoogle Scholar
  188. 188.
    Wu Z, Zhang J, Nakanishi H (2005) Leptomeningeal cells activate microglia and astrocytes to induce IL-10 production by releasing pro-inflammatory cytokines during systemic inflammation. J Neuroimmunol 167:90–98.  https://doi.org/10.1016/j.jneuroim.2005.06.025 CrossRefPubMedGoogle Scholar
  189. 189.
    Xia YY, Song SW, Min Y, Zhong Y, Sheng YC, Li RP et al (2014) The effects of anakinra on focal cerebral ischemic injury in rats. CNS Neurosci Ther 20:879–881.  https://doi.org/10.1111/cns.12310 CrossRefPubMedPubMedCentralGoogle Scholar
  190. 190.
    Xu Z, Bouman-Thio E, Comisar C, Frederick B, Van Hartingsveldt B, Marini JC et al (2011) Pharmacokinetics, pharmacodynamics and safety of a human anti-IL-6 monoclonal antibody (sirukumab) in healthy subjects in a first-in-human study. Br J Clin Pharmacol 72:270–281.  https://doi.org/10.1111/j.1365-2125.2011.03964.x CrossRefPubMedPubMedCentralGoogle Scholar
  191. 191.
    Yamasaki Y, Matsuura N, Shozuhara H, Onodera H, Itoyama Y, Kogure K (1995) Interleukin-1 as a pathogenetic mediator of ischemic brain damage in rats. Stroke 26:676–680; discussion 681Google Scholar
  192. 192.
    Yamashita T, Sawamoto K, Suzuki S, Suzuki N, Adachi K, Kawase T et al (2005) Blockade of interleukin-6 signaling aggravates ischemic cerebral damage in mice: possible involvement of Stat3 activation in the protection of neurons. J Neurochem 94:459–468.  https://doi.org/10.1111/j.1471-4159.2005.03227.x CrossRefPubMedGoogle Scholar
  193. 193.
    Yan W, Chen ZY, Chen JQ, Chen HM (2016) Association between the interleukin-1beta gene -511C/T polymorphism and ischemic stroke: an updated meta-analysis. Genet Mol Res.  https://doi.org/10.4238/gmr.15027580
  194. 194.
    Yazdi AS, Drexler SK (2013) Regulation of interleukin 1alpha secretion by inflammasomes. Ann Rheum Dis 72(Suppl 2):ii96–ii99.  https://doi.org/10.1136/annrheumdis-2012-202252 CrossRefPubMedGoogle Scholar
  195. 195.
    Zhang DD, Zou MJ, Zhang YT, Fu WL, Xu T, Wang JX et al (2017) A novel IL-1RA-PEP fusion protein with enhanced brain penetration ameliorates cerebral ischemia-reperfusion injury by inhibition of oxidative stress and neuroinflammation. Exp Neurol 297:1–13.  https://doi.org/10.1016/j.expneurol.2017.06.012 CrossRefPubMedGoogle Scholar
  196. 196.
    Zheng Y, Humphry M, Maguire JJ, Bennett MR, Clarke MC (2013) Intracellular interleukin-1 receptor 2 binding prevents cleavage and activity of interleukin-1alpha, controlling necrosis-induced sterile inflammation. Immunity 38:285–295.  https://doi.org/10.1016/j.immuni.2013.01.008 CrossRefPubMedPubMedCentralGoogle Scholar
  197. 197.
    Zhou QH, Boado RJ, Hui EK, Lu JZ, Pardridge WM (2011) Brain-penetrating tumor necrosis factor decoy receptor in the mouse. Drug Metab Dispos 39:71–76.  https://doi.org/10.1124/dmd.110.036012 CrossRefPubMedPubMedCentralGoogle Scholar
  198. 198.
    Zhou W, Liesz A, Bauer H, Sommer C, Lahrmann B, Valous N et al (2013) Postischemic brain infiltration of leukocyte subpopulations differs among murine permanent and transient focal cerebral ischemia models. Brain Pathol 23:34–44.  https://doi.org/10.1111/j.1750-3639.2012.00614.x CrossRefPubMedGoogle Scholar
  199. 199.
    Zou L, Zhao H, Gong X, Jiang A, Guan S, Wang L et al (2015) The association between three promoter polymorphisms of IL-1 and stroke: a meta-analysis. Gene 567:36–44.  https://doi.org/10.1016/j.gene.2015.04.054 CrossRefPubMedGoogle Scholar

Copyright information

© The Author(s) 2018

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  1. 1.Department of Neurobiology Research, Institute of Molecular MedicineUniversity of Southern DenmarkOdenseDenmark
  2. 2.Department of Clinical Research, BRIDGE-Brain Research-Inter-Disciplinary Guided ExcellenceUniversity of Southern DenmarkOdense CDenmark
  3. 3.Department of NeurologyOdense University HospitalOdenseDenmark

Personalised recommendations