Skip to main content
SpringerLink
Log in

Genetic analysis of salt tolerance in a progeny derived from the citrus rootstocks Cleopatra mandarin and trifoliate orange

  • Original Article
  • Published:
Tree Genetics & Genomes Aims and scope Submit manuscript

Abstract

A total of 60 traits that could be related to salt tolerance were genetically analyzed using nucellar plants as repetitions of apomictic hybrids in a reference population derived from two common citrus rootstocks, Cleopatra mandarin (salt tolerant) and trifoliate orange (salt sensitive), in two experiments differing in duration (1 versus 3 years) [NaCl] (30 versus 25 mM) and environmental control (greenhouse versus screenhouse). In both experiments, the trifoliate parent always showed less aerial vegetative growth than Cleopatra, and under salinity, the trifoliate parent showed higher Na+ and Cl− leaf concentrations than the salt-tolerant parent. Salinity affected the relationships among traits, particularly those involving leaf water potential; leaf concentrations of Cl−, K+, B and Fe; and root [Na+]. Most traits showed heritabilities below 0.6, and their quantitative trait locus (QTL) analyses were carried out using three mapping procedures to obtain complementary genetic information on trait inheritance. A total of 98 QTLs were detected by interval mapping and multiple QTL mapping procedures. Fresh and dried weights of the leaf, studied in both experiments, showed common QTLs, remarking their repeatability. A cluster of QTLs governing plant vigour and leaf boron concentration pointed a genomic region in linkage group 3 as the most relevant one to improve salt tolerance using the Cleopatra parent as donor. Besides, a QTL genotype in linkage group 7, associated with the smallest leaf water potential and defoliation index under salinity, corresponded to the highest leaf [Na+] and the largest leaf area, suggesting the presence of a putative tissue salt tolerance QTL.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1
Fig. 2
Fig. 3
Fig. 4
Fig. 5
Fig. 6

Similar content being viewed by others

References

  • Asins MJ (2002) Present and future of QTL analysis in plant breeding. Plant Breed 121:281–291

    Article  Google Scholar 

  • Asins MJ, Raga V, Bernet GP, Carbonell EA (2015) Genetic analysis of reproductive, vegetative and fruit quality traits to improve Citrus varieties. Tree Genetics and Genomes 11:117

    Article  Google Scholar 

  • Balal RM, Khan MM, Shahid MA, Mattson NS, Abbas T, Ashfaq M, Garcia-Sanchez F, Ghazanfer U, Gimeno V, Iqbal Z (2012) Comparative studies on the physiobiochemical, enzymatic, and ionic modifications in salt-tolerant and salt-sensitive citrus rootstocks under NaCl stress. J Am Soc Hortic Sci 137:86–95

    CAS  Google Scholar 

  • Barciszewska-Pacak M, Milanowska K, Knop K, Bielewicz D, Nuc P, Plewka P, Vazquez F, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z (2015) Arabidopsis microRNA expression regulation in a wide range of abiotic stress responses. Frontiers in Plant Science 6:410

    Article  PubMed  PubMed Central  Google Scholar 

  • Bernet GP, Fernandez-Ribacoba J, Carbonell EA, Asins MJ (2010) Comparative genome-wide segregation analysis and map construction using a reciprocal cross design to facilitate citrus germplasm utilization. Mol Breed 25:659–673

    Article  Google Scholar 

  • Bingham ET, Mahler RJ, Parra J, Stolzy LH (1974) Long-term effects of irrigation-salinity management on a Valencia orange orchard. Soil Sci 117:369–377

    Article  CAS  Google Scholar 

  • Brumós J, Colmenero-Flores JM, Conesa A, Izquierdo P, Sánchez G, Iglesias DJ, López-Climent MF, Gómez-Cadenas A, Talón M (2009) Membrane transporters and carbon metabolism implicated in chloride homeostasis differentiate salt stress responses in tolerant and sensitive citrus rootstocks. Funct Integr Genomics 9:293–309

    Article  PubMed  Google Scholar 

  • Cai Q, Guy CL, Moore GA (1994) Extension of the linkage map in Citrus using random amplified polymorphic DNA (RAPD) markers and RFLP mapping of cold-acclimation-responsive loci. Theor Appl Genet 89:606–614

    Article  CAS  PubMed  Google Scholar 

  • Cerdá A, Nieves M, Guillén M (1990) Salt tolerance of lemon trees as affected by rootstocks. Irr Sci 11:245–249

    Article  Google Scholar 

  • Collins NC, Tardieu F, Tuberosa R (2008) Quantitative trait loci and crop performance under abiotic stress: where do we stand? Plant Physiol 147:469–486

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  • Cooper WC, Olson EO, Maxwell N, Otey G (1956) Review of studies on adaptability of citrus varieties as rootstocks for grapefruit in Texas. J Río Grande Valley Hort Soc 10:6–19

    Google Scholar 

  • FAOSTAT (2015) Food and agriculture organization of the United Nations Statistics Division http://faostat3.fao.org/download/Q/QC/E. Accessed 07 March 2016

  • Forner-Giner MA, Rodriguez-Gamir J, Primo-Millo E, Iglesias DJ (2011) Hydraulic and chemical responses of citrus seedlings to drought and osmotic stress. J Plant Growth Regul 30:353–366

    Article  CAS  Google Scholar 

  • García MR, Asins MJ, Forner J, Carbonell EA (1999) Genetic analysis of apomixis in Citrus and Poncirus by molecular markers. Theor Appl Genet 99:511–518

    Article  PubMed  Google Scholar 

  • García MR, Bernet GP, Puchades J, Gómez I, Carbonell EA, Asins MJ (2002) Reliable and easy screening technique for salt tolerance of citrus rootstocks under controlled environments. Australian J Agric Res 53:653–662

    Article  Google Scholar 

  • García-Sanchez F, Syvertsen JP (2009) Substrate type and salinity affect growth allocation, tissue ion concentrations, and physiological responses of carrizo citrange seedlings. Hortscience 44:1432–1437

    Google Scholar 

  • Gilliam JW (1971) Rapid measurement of chloride in plant materials. Soil Sci Soc Amer Proc 75:512–513

    Article  Google Scholar 

  • Grattan SR, Diaz FJ, Pedrero F, Vivaldi GA (2015) Assessing the suitability of saline wastewaters for irrigation of Citrus spp.: emphasis on boron and specific-ion interactions. Agric Water Manag 157:48–58

    Article  Google Scholar 

  • Grattapaglia D, Sederoff RR (1994) Genetic linkage maps of Eucaliptus grandis and E. urophylla using a pseudo-testcross mapping strategy and RAPD markers. Genetics 137:1121–1137

    CAS  PubMed  PubMed Central  Google Scholar 

  • Herrero R, Asíns MJ, Carbonell EA, Navarro L (1996) Genetic diversity in the orange subfamily Aurantioideae. I. Intraspecies and intragenus genetic variability. Theor Appl Genet 92:99–609

    Article  Google Scholar 

  • HunterLab (1996) Hunter Lab color scale. Insight on color 8:9 (Aug. 1–15). Hunter Associates Laboratories, Reston

    Google Scholar 

  • Jones-Rhoades MJ, Bartel B, Bartel DP (2006) MicroRNA and their regulatory targets in plants. Annu Rev Plant Biol 57:19–53

    Article  CAS  PubMed  Google Scholar 

  • Khoshbakht D, Ramin AA, Baninasab B (2015) Effects of sodium chloride stress on gas exchange, chlorophyll content and nutrient concentrations of nine citrus rootstocks. Photosynthetica 53:241–249

    Article  CAS  Google Scholar 

  • King SR, Davis AR, Zhang X, Crosby K (2010) Genetics, breeding and selection of rootstocks for Solanaceae and Cucurbitaceae. Scentia Horticulturae 127:106–111

    Article  Google Scholar 

  • Kostopoulou Z, Therios I (2014) Growth and inorganic composition of ‘Nova’ mandarin plants grafted on two commercial rootstocks in response to salinity and silicon. Acta Physiol Plant 36:1363–1372

    Article  CAS  Google Scholar 

  • Maas EV (1993) Salinity and citriculture. Tree Physiol 12:195–216

    Article  CAS  PubMed  Google Scholar 

  • Miwa K, Fujiwara T (2010) Boron transport in plants: co-ordinated regulation of transporters. Ann Bot 105:1103–1108

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  • Morinaga K, Sykes SR (2001) Effect of salt and water stress on fruit quality, physiological responses, macro- and micro-element contents in leaves of Satsuma mandarin trees under greenhouse conditions. JARQ-Japan Agricultural Research Quarterly 35:53–58

    Google Scholar 

  • Nakano M, Shimizu T, Kuniga T, Nesumi H, Omura M (2008) Mapping and haplotyping of the flanking region of the polyembryony locus in Citrus unshiu Marcov. J Japan Soc Hort Sci 77:109–114

    Article  CAS  Google Scholar 

  • O’Neill MA, Ishii T, Albersheim P, Darvill AG (2004) Rhamnogalacturonan II: structure and function of a borate cross-linked cell wall pectic polysaccharide. Annu Rev Plant Biol 55:109–139

    Article  PubMed  Google Scholar 

  • Oron G, DeMalach Y, Gillerman L, David L, Lurie S (2002) Effect of water salinity and irrigation technology on yield and quality of pears. Biosyst Eng 81:237–247

    Article  Google Scholar 

  • Ortuño MF, Alarcon JJ, Nicolas E, Torrecillas A (2004) Interpreting trunk diameter changes in young lemon trees under deficit irrigation. Plant Sci 167:275–280

    Article  Google Scholar 

  • Paranychianakis NV, Chartzoulakis KS (2005) Irrigation of Mediterranean crops with saline water: from physiology to management practices. Agric Ecosys Environment 106:171–187

    Article  CAS  Google Scholar 

  • Pedroso FKJV, Prudente DA, Bueno ACR, Machado EC, Ribeiro RV (2014) Drought tolerance in citrus trees is enhanced by rootstock-dependent changes in root growth and carbohydrate availability. Environ Exp Bot 101:26–35

    Article  CAS  Google Scholar 

  • Raga V, Bernet GP, Carbonell EA, Asins MJ (2012) Segregation and linkage analyses in two complex populations derived from the citrus rootstock Cleopatra mandarin. Inheritance of seed reproductive traits. Tree Genetics and Genomes 8:1061–1071

    Article  Google Scholar 

  • Raga V, Bernet GP, Carbonell EA, Asins MJ (2014) Inheritance of rootstock effects and their association with salt-tolerance candidate genes in a progeny derived from ‘Volkamer’ lemon. J Amer Soc Hort Sci 139:1–11

    Google Scholar 

  • Rodriguez-Gamir J, Ancillo G, Aparicio F, Bordas M, Primo-Millo E, Forner-Giner MA (2011) Water-deficit tolerance in citrus is mediated by the down regulation of PIP gene expression in the roots. Plant Soil 347:1–2

    Article  Google Scholar 

  • Ruiz C, Asins MJ (2003) Comparison between Poncirus and Citrus genetic linkage maps. Theor Appl Genet 106:826–836

    CAS  PubMed  Google Scholar 

  • Ruiz C, Bretó MP, Asins MJ (2000) An efficient methodology to identify sexual seedlings in citrus breeding programs using SSR markers. Euphytica 112:89–94

    Article  CAS  Google Scholar 

  • Sahin-Çevik M, Moore GA (2012) Quantitative trait loci analysis of morphological traits in Citrus. Plant Biotechnology Reports 6:47–57

    Article  Google Scholar 

  • Savé R, Biel C, Domingo R, Ruizsanchez MC, Torrecillas A (1995) Some physiological and morphological-characteristics of citrus plants for drought resistance. Plant Sci 110:167–172

    Article  Google Scholar 

  • Scholander PF, Bradstreet ED, Hemmingsen EA, Hammel HT (1965) Sap pressure in vascular plants. Science 148:339–345

    Article  CAS  PubMed  Google Scholar 

  • Song C, Fang J, Li X, Liu H, Chao CT (2009) Identification and characterization of 27 conserved microRNA in citrus. Planta 230:671–685

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  • Sykes SR (2011) Chloride and sodium excluding capacities of citrus rootstock germplasm introduced to Australia from the People’s Republic of China. Scientia Hort 128:443–449

    Article  CAS  Google Scholar 

  • Syvertsen J, Levy Y (2005) Salinity interactions with other abiotic and biotic stresses in citrus. HortTechnology 15:100–103

    Google Scholar 

  • Tozlu I, Guy CL, Moore GA (1999a) QTL analysis of morphological traits in an intergeneric BC1 progeny of Citrus and Poncirus under saline and non-saline environments. Genome 42:1020–1029

    Article  CAS  Google Scholar 

  • Tozlu I, Guy CL, Moore GA (1999b) QTL analysis of Na+ and Cl− accumulation related traits in an intergeneric BC1 progeny of Citrus and Poncirus under saline and non-saline environments. Genome 42:692–705

    Article  CAS  Google Scholar 

  • Turner NC (1981) Techniques and experimental approaches for the measurement of plant water status. Plant Soil 58:339–366

    Article  Google Scholar 

  • Van Ooijen JW (2009) MapQTL 6 software for the mapping of quantitative trait loci in experimental populations of diploid species. Kyazma, Wageningen

    Google Scholar 

  • Villalta I, Bernet GP, Carbonell EA, Asins MJ (2007) Comparative QTL analysis of salinity tolerance in terms of fruit yield using two Solanum populations of F7 lines. Theor Appl Genet 114:1001–1017

    Article  CAS  PubMed  Google Scholar 

  • Visser T (1970) The relation between growth, juvenile period and fruiting of apple seedlings and its use to improve breeding efficiency. Euphytica 19:293–302

    Article  Google Scholar 

  • Wang N, Yang C, Pan Z, Liu Y, Peng S (2015) Boron deficiency in woody plants: various responses and tolerance mechanisms. Front Plant Sci 6:916

    PubMed  PubMed Central  Google Scholar 

  • Yang Z-N, Ye X-R, Choi S, Molina J, Moonan F, Wing RA, Roose ML, Mirkov TE (2001) Construction of a 1.2-Mb contig including the citrus tristeza virus resistance gene locus using a bacterial artificial chromosome library of Poncirus trifoliata (L.) Raf. Genome 44:382–393

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgments

This work has been partially supported by grants AGL2008-00197/AGR, RTA2011-00132-C02 and AGL2014-56675-R from the Spanish Government (Ministerio de Economia y Competitividad) and Fondo Social Europeo (GPB). Authors thank Mr. J. Puchades and Dr. Alida Ballester for the technical assistance.

Data archiving statement

The SSR primer sequences are available upon request from http://www.ivia.es/deps/biot/labgen/request.html. The genetic linkage maps have been submitted to the Citrus Genome Database (https://www.citrusgenomedb.org/). Concerning markers derived from salt tolerance candidate genes, COR15 and Aquapor correspond to contig6158 (ATTATCAATT AATTTATAAA AGAAAATTAG TTTCTTTTTT TTTTTT) and contig2599 (TGGGGAAAAC TGCCTTGAAA GGAACCCCTT TTAATTCTT), respectively, from the KCl-salt1 library at Valencian Implemented Citrus EST and NucleoTide (VICENT sequences database). Mygbg2 and EREBP1 correspond to transcription factors from the NCBI database, accessions EF071983 and FJ544914, respectively. Marker 42C corresponds to a lectin gene obtained by PCR select and overexpressed in Cleopatra roots under salinity (forward primer: AGATCAAGCAGCAGATCC; reverse primer: AGCAAGCTCTTACTGTGACC). The parents of the progeny are kept at the Citrus Germplasm Bank, and the accession references are as follows: IVIA-385 (Cleopatra mandarin), IVIA-537 (Flying Dragon trifoliate orange) and IVIA-236 (Rich trifoliate orange).

Author information

Authors and Affiliations

  1. Instituto Valenciano de Investigaciones Agrarias, Apdo. Oficial, 46113, Moncada, Valencia, Spain

    V. Raga & M. J. Asins

  2. Centro de Edafología y Biología Aplicada del Segura, Consejo Superior de Investigaciones Científicas, Campus de Espinardo, 30100, Espinardo, Murcia, Spain

    D. S. Intrigliolo

  3. Sistemas Genómicos S.L, Parque Tecnológico de Valencia Ronda G. Marconi 6, 46980, Paterna, Valencia, Spain

    G. P. Bernet

  4. Unidad de Biometría, Instituto Valenciano de Investigaciones Agrarias, Apdo. Oficial, 46113, Moncada, Valencia, Spain

    E. A. Carbonell

Authors
  1. V. Raga
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. D. S. Intrigliolo
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. G. P. Bernet
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. E. A. Carbonell
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. M. J. Asins
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to M. J. Asins.

Additional information

Communicated by W.-W. Guo

Electronic supplementary material

Below is the link to the electronic supplementary material.

ESM 1

Online Resource 1- Pearson coefficients of significantly (p < 0.05) correlated traits (trait abbreviations in Table 1) under both control (Pears_C) and salinity (Pears_S). Common traits between experiments with yellow background. Traits whose correlation change from control to salinity are in bold. (PDF 61 kb)

ESM 2

Online Resource 2- Significant (p < 0.02) trait correlations under control (C) and salinity (S). Consistent trait correlations in bold. Trait abbreviations in Table 1 (PDF 98 kb)

ESM 3

Online Resource 3- List of significant trait-locus associations (the highest significant locus) and corresponding genotypic means depending on the genome where they were detected: Cleopatra mandarin (r: nn and np), trifoliate orange (p: ll and lm) or both parents (r + p: ac, ad, bc, and bd). K is the Kruskal-Wallis statistic provided by MapQTL 6 software. Trait abbreviations in Table 1. (PDF 60 kb)

ESM 4

Online Resource 4- Distributions of trait heritabilities (a) and total number of detected QTLs per trait (b). Absolute frequencies of each class is indicated at the Y axis. Control, or salinity, indicated by white or grey bars, respectively. (PDF 10 kb)

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Raga, V., Intrigliolo, D.S., Bernet, G.P. et al. Genetic analysis of salt tolerance in a progeny derived from the citrus rootstocks Cleopatra mandarin and trifoliate orange. Tree Genetics & Genomes 12, 34 (2016). https://doi.org/10.1007/s11295-016-0991-1

Download citation

  • Received:

  • Revised:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1007/s11295-016-0991-1

Keywords

Search

Navigation