Applied Microbiology and Biotechnology

, Volume 97, Issue 17, pp 7699–7709

A propionate CoA-transferase of Ralstonia eutropha H16 with broad substrate specificity catalyzing the CoA thioester formation of various carboxylic acids

Authors

  • Nicole Lindenkamp
    • Institut für Molekulare Mikrobiologie und BiotechnologieWestfälische Wilhelms-Universität Münster
  • Marc Schürmann
    • Institut für Molekulare Mikrobiologie und BiotechnologieWestfälische Wilhelms-Universität Münster
    • Institut für Molekulare Mikrobiologie und BiotechnologieWestfälische Wilhelms-Universität Münster
    • Environmental Sciences DepartmentKing Abdulaziz University
Biotechnologically relevant enzymes and proteins

DOI: 10.1007/s00253-012-4624-9

Cite this article as:
Lindenkamp, N., Schürmann, M. & Steinbüchel, A. Appl Microbiol Biotechnol (2013) 97: 7699. doi:10.1007/s00253-012-4624-9

Abstract

In this study, we have investigated a propionate CoA-transferase (Pct) homologue encoded in the genome of Ralstonia eutropha H16. The corresponding gene has been cloned into the vector pET-19b to yield a histidine-tagged enzyme which was expressed in Escherichia coli BL21 (DE3). After purification, high-performance liquid chromatography/mass spectrometry (HPLC/MS) analyses revealed that the enzyme exhibits a broad substrate specificity for carboxylic acids. The formation of the corresponding CoA-thioesters of acetate using propionyl-CoA as CoA donor, and of propionate, butyrate, 3-hydroxybutyrate, 3-hydroxypropionate, crotonate, acrylate, lactate, succinate and 4-hydroxybutyrate using acetyl-CoA as CoA donor could be shown. According to the substrate specificity, the enzyme can be allocated in the family I of CoA-transferases. The apparent molecular masses as determined by gel filtration and detected by SDS polyacrylamide gel electrophoresis were 228 and 64 kDa, respectively, and point to a quaternary structure of the native enzyme (α4). The enzyme exhibited similarities in sequence and structure to the well investigated Pct of Clostridium propionicum. It does not contain the typical conserved (S)ENG motif, but the derived motif sequence EXG with glutamate 342 to be, most likely, the catalytic residue. Due to the homo-oligomeric structure and the sequence differences with the subclasses IA–C of family I CoA-transferases, a fourth subclass of family I is proposed, comprising — amongst others — the Pcts of R. eutropha H16 and C. propionicum. A markerless precise-deletion mutant R. eutropha H16∆pct was generated. The growth and accumulation behaviour of this mutant on gluconate, gluconate plus 3,3′-dithiodipropionic acid (DTDP), acetate and propionate was investigated but resulted in no observable phenotype. Both, the wild type and the mutant showed the same growth and storage behaviour with these carbon sources. It is probable that R. eutropha H16 is upregulating other CoA-transferase(s) or CoA-synthetase(s), thereby compensating for the lacking Pct. The ability of R. eutropha H16 to substitute absent enzymes by isoenzymes has been already shown in different other studies in the past.

Keywords

PolyhydroxyalkanoatesPoly(3-hydroxybutyrate)Propionate-CoA-transferaseFamily I CoA-transferaseRalstonia eutropha H16

Introduction

Coenzyme A (CoA) transferases take part in a wide range of biochemical processes in prokaryotic and eukaryotic cells. They catalyze the reversible transfer of CoA between organic acids and based on their reaction mechanism and amino acid sequence, three families are distinguished (Heider 2001). CoA transferases of the first class are mostly involved in the fatty acid metabolism and use 3-oxoacids (Corthésy-Theulaz et al. 1997; Parales and Harwood 1992), glutaconate (Buckel et al. 1981; Jacob et al. 1997) and short-chain fatty acids as acceptors. The majority of the family I CoA-transferases contain two different subunits in different aggregation states (α2β2 or α4β4) and use succinyl-CoA or acetyl-CoA as CoA donors (Heider 2001). The reaction of family I CoA transferases proceeds via a ping-pong mechanism, in which an active-site glutamate residue acts as the acceptor of covalently bound intermediates (Solomon and Jencks 1968). Firstly, a covalently bound glutamyl-CoA thioester intermediate of the enzyme is formed by using a CoA thioester substrate. Secondly, the generated enzyme-CoA intermediate reacts with a suitable CoA acceptor (Mack and Buckel 1995; Selmer and Buckel 1999). Family II of CoA-transferases comprises also the transferase subunits of the enzymes citrate and citramalate lyase, which are composed of three subunits (Heider 2001). In contrast to enzymes of family I they do not form a covalent thioester intermediate, but the reaction proceeds via a ternary complex (Heider 2001). Most of the CoA-transferases belonging to the third family of CoA-transferases are present in anaerobic bacteria. These CoA transferases are, in contrast to the members of family I, very substrate- and stereospecific. They take part in the anaerobic catabolism of toluene, carnitine and oxalate (Heider 2001).

The propionate CoA-transferase (PctCp) from Clostridium propionicum has been well characterized during the last three decades (Schweiger and Buckel 1984; Valentin and Steinbüchel 1994; Selmer et al. 2002). During fermentation of alanine to propionate, (R)-lactate is converted to (R)-lactoyl-CoA by this PctCp with propionyl-CoA acting as the CoA donor (Schweiger and Buckel 1984). The enzyme exhibits a homotetrameric structure (α4) with a molecular mass of 224 kDa consisting of four 57-kDa subunits (Schweiger and Buckel 1984; Selmer et al. 2002). The substrate specificity of PctCp is rather broad and comprises carboxylic acids like propionate, lactate, acrylate or butyrate (Schweiger and Buckel 1984). According to the used substrates and the amino acid sequence of PctCp, it was classified as a family I CoA transferase. However, Selmer et al. postulated that this protein might be a member of a novel subclass of CoA-transferases. The lack of the characteristic (S)ENG consensus motif adjacent to the active center glutamate (Mack et al. 1994), and the homotetrameric structure support this thesis (Selmer et al. 2002).

Ralstonia eutropha H16, a Gram-negative facultatively chemolithoautotrophic hydrogen-oxidizing beta-proteobacterium, accumulates poly(3-hydroxybutyrate) (poly[3HB]) as insoluble granules as a storage compound for carbon and energy in the cytoplasm. Under unbalanced cultivation conditions, when a carbon source is available in excess and if another macroelement like nitrogen is limiting growth at the same time, R. eutropha H16 accumulates poly(3HB) at a high level up to 90 % (w/w) of the dry weight of its cells (Anderson and Dawes 1990; Schlegel et al. 1961; Steinbüchel and Schlegel 1989). The genome of R. eutropha H16 is composed of one megaplasmid and two chromosomes, whose nucleotide sequences were published in 2003 and 2006 (Schwartz et al. 2003; Pohlmann et al. 2006). R. eutropha H16 harbors the PHA operon, which comprises three genes encoding a β-ketothiolase (phaA), an acetoacetyl-CoA-reductase (phaB), and a PHA synthase (phaC) (Schubert et al. 1988). Interestingly, a gene coding for a Pct (H16_A2718) was also found in the genome of R. eutropha H16. In this study, we provide first insights into the Pct of R. eutropha H16. We report on the cloning, the purification and initial characterization of the enzyme. Different substrates were tested, and the resulting CoA-thioesters were identified with HPLC/MS. Upon the deletion of pct in R. eutropha H16, the influence of Pct on growth and storage behaviour on different carbon sources was investigated.

Materials and methods

Bacterial strains and plasmids

Bacterial strains and plasmids used in this study are listed in Table 1.
Table 1

Bacterial strains and plasmids used in this study

Strains and plasmids

Description

Reference or source

Strains

  

Ralstonia eutropha

  

H16

Wild type

DSM 428

H16∆pct

pct precise-deletion gene replacement strain derived from R. eutropha H16

This study

Escherichia coli

  

Top10

FmcrA(mrr-hsdRMS-mcrBC) f80lacZM15lacX74 deoR recA1 araD139(ara-leu)7697 galU galK rpsL endA1 nupG

Invitrogen

S17-1

thi proA hsdR17 hasdM+recA RP4-tra-function

Simon et al. 1983

BL21 (DE3)

FompT hsdSB(rB, mB) gal dcm (DE3)

Novagen

Plasmids

  

pCR2.1TOPO

Apr KmrLacZ

Invitrogen

pCR2.1TOPO::pct

pCR2.1TOPO with pct as insert

This study

pCR2.1TOPO::pct_F1

pCR2.1TOPO with flanking region 1 (upstream) of pct

 

pCR2.1TOPO::pct_F2

pCR2.1TOPO with flanking region 2 (downstream) of pct

 

pJQ200mp18Tc

sacB oriV oriT traJ Tcr

Quandt and Hynes 1993

pJQ200mp18Tc::∆pct

pct gene replacement plasmid; Tcr

This study

pACYC Duet-1

E. coli expression vector (Kmr, T7 promoter)

Novagen

pACYC Duet-1::pct

pACYC Duet-1 with pct as NdeI/KpnI

This study

pET-19b

E. coli expression vector (Apr, T7 promoter)

Novagen

pET-19b::pct

pET-19b with pct as NdeI/XhoI fragment

This study

Media and growth conditions

R. eutropha cells were cultivated aerobically at 30 °C in 300-ml Erlenmeyer flasks with baffles containing 100 ml mineral salts medium (MSM) according to Schlegel et al. (1961). The concentration of ammonium chloride was reduced to 0.05 % (w/v) to provide conditions permissive for PHA accumulation. 1 % (w/v) sodium gluconate (Merck Schuchardt, Germany), 0.2 % (w/v) sodium acetate (Riedel-de Haën, Germany) or 0.2 % (w/v) sodium propionate (Sigma Aldrich, Germany) were added as carbon source. As precursor substrate for polythioester synthesis, 1 % (w/v) 3.3′-dithiodipropionic acid (DTDP) was added to the medium. Escherichia coli was cultivated in Luria–Bertani medium at 37 °C (Sambrook et al. 1989). If required for E. coli, ampicillin was added to a concentration of 100 μg/ml and tetracycline to a concentration of 12.5 μg/ml. For R. eutropha H16 tetracycline was added to a concentration of 25 μg/ml. Solid media contained 1.5 % (w/w) agar. Growth of cells was measured photometrically in a Klett–Summerson photometer (Manostat) using filter no. 54 (520 to 580 nm). All experiments were carried out in duplicate.

Isolation and manipulation of DNA

Genomic DNA of R. eutropha H16 was isolated using the method of Marmur (1961). Plasmid DNA was isolated by using the peqGOLD Plasmid Miniprep Kit from Peqlab according to the manufacturer's manual. DNA restriction fragments were purified from agarose gels using the peqGOLD Gel Extraction Kit (Peqlab, Erlangen, Germany) following the instructions of the manufacturer. T4 DNA Ligase and restriction endonucleases (Fermentas, St. Leon-Rot, Germany) were used according to the manufacturer`s instructions.

Transfer of DNA

Competent cells of E. coli were prepared and transformed with plasmids by the CaCl2 procedure as described by Hanahan (1983). Spot agar mating of R. eutropha H16 with E. coli S17-1 as plasmid donor was carried out on nutrient broth (NB) agar plates at 30 °C. The sacB gene selection was performed on NB agar plates supplemented with 10 % (w/v) sucrose at 30 °C.

PCR amplification

Amplification of DNA by PCR was done according to Sambrook, using Taq-DNA polymerase (Invitrogen, Darmstadt, Germany) in an Omnigene HBTR3CM DNA thermocycler (Hybaid) (Sambrook et al. 1989). The oligonucleotides employed for amplification were synthesized by MWG-Biotech AG (Ebersberg, Germany) and are listed in Table 2.
Table 2

Oligonucleotides used in this study

Oligonucleotide

Sequencea

Location

pct_NdeI_fw

aaacatatgaaggtgatcaccgcacg

5′ end of pct

pct_Kpn_rv

aaaggtaccaatgacaggattacaggtgcag

3′ end of pct

pct_XbaI_fw (flanking region 1)

acgtagccgttgtgctctagagtcagcag

5′ end of flanking region 1 (upstream of pct)

pct_EcoRI_rv (flanking region 1)

gaattcgttgtgccgtcccgcatc

3′ end of flanking region 1 (upstream of pct)

pct_EcoRI_fw (flanking region 2)

catatgcatcagtcagaattcccggc

5′ end of flanking region 2 (downstream of pct)

pct_XbaI_rv (flanking region 2)

cacaaacggatacgcgtctagaactcatc

3′ end of flanking region 2 (downstream of pct)

pct_fw (control)

aagtaggcatagccgagctctatcac

5′ end of region upstream of pct

pct_rv (control)

gtgcagacattcgacagctttgg

3′ end of region upstream of pct

pct_int_fw (control)

tctacccgagcttcccgatc

5′ end of fragment within pct

pct_int_rv (control)

atgttgataaagccgccgac

3′ end of fragment within pct

aRestriction sites are underlined

DNA sequencing

Sequencing reactions of DNA fragments were carried out according to standard procedures by the Sequence Laboratories Göttingen GmbH (Göttingen, Germany).

Cloning and expression of pct

The pct gene was amplified from total genomic DNA of R. eutropha H16 by PCR using Taq DNA polymerase (Invitrogen) and the oligonucleotides pct_NdeI_fw and pct_KpnI_rv (Table 2). The PCR cycle conditions were as follows: 5 min denaturation step at 94 °C, 30 s annealing step at 58 °C, 1 min 45 s elongation step at 72 °C, and 5 min final extension step at 72 °C. The PCR product was isolated from an agarose gel using the peqGOLD gel extraction kit (Peqlab) and ligated with the vector pCR2.1TOPO (Invitrogen). The ligation products were transformed into competent E. coli One Shot® Mach1™ (Invitrogen) cells, and selection was carried out on LB agar plates containing isopropyl β-d-thiogalactopyranoside (IPTG), X-Gal and ampicillin. After sequencing, plasmid pCR1TOPO::pct DNA was fragmentized with NdeI and KpnI, and the resulting 1,649-bp fragment was purified from an agarose gel. For heterologous expression the fragment was ligated into the vector pACYCDuet-1. After unsuccessful expression pct was subcloned at the restriction sites NdeI/XhoI into the vector pET-19b. E. coli BL21 (DE3) harboring pET-19b::pct was grown at 37 °C for 3 h in 100 ml LB medium containing 100 μg/ml ampicillin, and Pct formation was induced by addition of 0.1 mM IPTG for 4 h at 30 °C.

Purification of Pct

The Pct of R. eutropha H16 was expressed as soluble protein with an N-terminal (His)10-tag. Cells were harvested by centrifugation at 4,000 × g for 15 min and washed two times with 0.9 % (w/v) NaCl. The cell pellet was resuspended in 1 ml 100 mM Tris–HCl buffer (pH 7.4) containing 500 mM NaCl, plus 0.2 mg/ml lysozyme, 20 μg/ml DNase and 1 mM EDTA-free Protease inhibitor Cocktail (Roche) added. After 30 min incubation at room temperature, the cells were disrupted by sonification. Purification of Pct was carried out with a Ni Sepharose column (His SpinTrap™; GE Healthcare, Munich, Germany) under non-denaturating conditions according to the manufacturer's manual. Pct bound to the column was eluted with elution buffer containing 200 mM imidazole. The purified enzyme was stored at 4 °C. The purity of the enzyme was confirmed by one dimensional polyacrylamide gel electrophoresis (PAGE). The protein concentration was measured using the method of Bradford (1976). The protein samples (5 μg protein) were resuspended in gel loading buffer (0.6 % [w/v] sodium dodecyl sulfate [SDS], 1.25 % [v/v] β-mercaptoethanol, 0.25 mM EDTA, 10 % [v/v] glycerol, 0.001 % [w/v] bromophenol blue, 12.5 mM Tris–HCl [pH 6.8]) and were separated in 12.5 % (w/v) SDS-polyacrylamide gels as described by Laemmli (1970). The proteins were stained with Coomassie brilliant blue R-250 (Weber and Osborn 1969).

Enzyme assays

The activity of the propionate CoA-transferase was measured as previously described in analogy to the glutaconate CoA-transferase assay with slight modification (Buckel et al. 1981). The reaction contained 100 mM Tris–HCl (pH 7.4), 200 mM sodium acetate, 1 mM oxaloacetate, 0.1 mM propionyl-CoA, 1 mM 5.5′-dithiobis-(2-nitrobenzoate) (DTNB), 10 μg citrate synthase (Sigma Aldrich), and the reaction was started by adding 5 μg of the purified Pct. The reaction was carried out at 25 °C. The absorbance was measured at 412 nm for 5 min. One unit of enzyme activity was defined as the formation of 1 μmol acetyl-CoA from propionyl-CoA and acetate.

Relative activities toward the substrates propionate, lactate (2-hydroxypropionate), 3-hydroxypropionate (3HP), acrylate, butyrate, 3-hydroxybutyrate (3HB), 4-hydroxybutyrate (4HB), crotonate or succinate were tested in a two step enzyme assay. The residual amount of acetyl-CoA after incubation of PctRe with one of the substrates was measured. When the added substrate is converted to its CoA thioester, the amount of acetyl-CoA diminishes and less free CoA is generated in this system. Each assay was carried out in 100 mM Tris–HCL (pH 7.4). First, 0.1 mM acetyl-CoA and 1 mM of each substrate was incubated with 5 μg of purified PctRe for 15 min at 30 °C. After denaturation of the PctRe (90 s at 95 °C), 0.1 mM oxaloacetate, 5 μg citrate synthase and 0.5 mM DTNB were added, and the reaction was further incubated for 15 min at 30 °C until no more change in absorbance was detectable. The amount of generated CoASH was determined by measuring the absorbance at 412 nm. All reactions have been carried out in triplicates.

Determination of the molecular mass

The molecular mass of Pct was determined on a Superdex 200 HR 10/30 column (Amersham Pharmacia Biotech) at a flow rate of 0.5 ml/min in 100 mM Tris–HCl buffer (pH 7.4) containing 100 mM NaCl. About 100 μg of purified protein was applied to the column, and the procedure was repeated tree times.

Analysis of the substrate specificity of Pct by high-performance liquid chromatography (HPLC)/mass spectrometry (MS)

After purification of Pct, the formation of CoA thioesters by the enzyme, using acetyl-CoA as CoA donor, was confirmed by employing an UltiMate® 3000 HPLC apparatus (Dionex GmbH, Idstein, Germany) connected directly to an LXQ™ Finnigan™ (ThermoScientific, Dreieich, Germany) mass spectrometer. An Acclaim 120 C18 Reversed-Phase LC Column (4.6 × 250 mm, 5 μm, 120 Å pores; Dionex GmbH) was used at 30 °C based on a method described earlier (Schürmann et al. 2011). A gradient system was used, with 50 mM ammonium acetate, pH 5.0 adjusted with acetic acid (A), and 100 % (v/v) methanol (B) as eluents. Elution occurred at a flow rate of 0.3 ml/min. Ramping was performed as follows: equilibration with 90 % A for 2 min before injection and afterwards a change from 90 % to 0 % eluent A in 40 min, followed by holding for 2 min and then returning to 90 % eluent A within 5 min. CoA-esters were detected at 259 nm by a photodiode array detector. Tuning of the instrument was achieved by direct infusion of a solution of 0.4 mM CoA at a flow rate of 10 μl/min into the ion source of the mass spectrometer to optimize the ESI-MS system for maximum generation of protonated molecular ions (parents) of CoA derivatives. The following tuning parameters were retained for optimum detection of CoA thioesters: capillary temperature 300 °C; sheet gas flow, 12 l/h; auxiliary gas flow, 6 l/h; sweep gas flow, 1 l/h. The mass range was set to m/z 50–1,100 Da in the positive and in the negative scan mode. The synthesized CoA thioesters of propionate, lactate, 3HP, 3-mercaptopropionate (3MP), acrylate, butyrate, 3HB, 4HB, crotonate or succinate from acetyl-CoA as the CoA donor were detected, respectively. The enzyme reaction was performed twice for each substrate using 15 μg of purified Pct for 45 min at 30 °C in 100 mM Tris–HCl buffer (pH 7.4) containing 1 mM acetyl-CoA and 5 mM of the above-mentioned substrates, respectively. The reactions were stopped by adding 30 μl of 15 % (w/v) trifluoroacetic acid.

Generation of a pct gene replacement strain employing the sacB system

The flanking regions upstream (355 bp) and downstream (548 bp) of the target gene pct were amplified by PCR with the primer pairs pct_XbaI_fw/pct_EcoRI_rv and pct_EcoRI_fw/pct_XbaI_rv, respectively (Table 2). The obtained fragments were subcloned into the cloning vector pCR2.1TOPO (Invitrogen). The resulting plasmids pCR2.1TOPO::pct_F1 and pCR2.1TOPO::pct_F2 were digested with EcoRI and XbaI. The two fragments were purified from an agarose gel and were ligated to yield an approximately 900-bp fragment. This fragment was then cloned into the XbaI site of plasmid pJQ200mp18Tc. The resulting precise deletion gene replacement plasmid pJQ200mp18Tc::∆pct was then used to generate the corresponding deletion mutant R. eutropha H16∆pct by application of standard protocols (Pötter et al. 2005; Quandt and Hynes 1993). The donor strain E. coli S17-1 was then transformed with this suicide plasmid, and from there the plasmid was mobilized into the R. eutropha H16 recipient strain (Hogrefe et al. 1981). The identification of the mutant was carried out on NB agar plates supplemented with 10 % (w/v) sucrose and MSM agar plates containing 25 μg/ml tetracycline (Pötter et al. 2005; Quandt and Hynes 1993). The sacB system from Bacillus subtilis, which is encoded on pJQ200mp18Tc and is lethal when expressed in Gram-negative bacteria, was induced by adding sucrose to the medium (Quandt and Hynes 1993). The tetracycline resistance was only used for the selection of homogenotes of R. eutropha H16 cells still harboring the suicide vector. The correct pct gene replacement strain was confirmed by PCR analysis and DNA sequencing employing primers (pct_fw [control]/pct_rv [control]) which bind beyond the primers used for the construction of the deletion gene replacement plasmids, as well as internal gene primers (pct_int_fw [control]/pct_int_rv [control]) to detect objectionable recombination events in other positions of the chromosome.

Analysis of PHA/PTE contents

Cells of R. eutropha H16 were harvested by centrifugation (15 min, 6,000 × g, 4 °C), washed in 0.9 % (w/v) sodium chloride and then lyophilized for 24 h. The polymer contents of the cells were determined upon methanolysis of 5–10 mg lyophilized cells in presence of 85 % (v/v) methanol and 15 % (v/v) sulfuric acid. The resulting methyl esters of 3HB, 3-hydroxyvalerate (3HV) and 3MP were analyzed by gas chromatography as described previously (Brandl et al. 1988; Timm and Steinbüchel 1990).

Sequence data analysis

For the determination of amino acid identity the program BlastP from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) was used (Altschul et al. 1997). Protein sequences were aligned using ClustalW with Pct from R. eutropha H16 as the reference.

Results

Purification of Pct from R. eutropha H16 (PctRe)

The pct gene was amplified from genomic DNA of R. eutropha H16 and cloned into the expression vector yielding pET-19b::pct as described in Materials and methods. To facilitate purification of the enzyme, PctRe was tagged with a decahistidine tag (His10-tag) at the N terminus. The recombinant PctRe was expressed in E. coli BL21 (DE3) as soluble protein after induction with 0.1 mM IPTG. The purity of the enzyme was confirmed by applying 5 μg of the protein to a SDS-PAGE (Fig. 1). The activity of the PctRe was tested by measuring the formation of acetyl-CoA from propionyl-CoA and acetate as described in Materials and methods. The specific activity of the purified PctRe was 1.3 ± 0.07 U/mg protein.
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-012-4624-9/MediaObjects/253_2012_4624_Fig1_HTML.gif
Fig. 1

Purified recombinant PctRe of R. eutropha H16. Purification was carried out with a Ni Sepharose column as described in the Materials and methods section. The protein concentration was measured using the method of Bradford (1976). Five micrograms of the purified protein was applied to the SDS-polyacrylamide gel (12.5 % [w/v] acrylamide). The SDS gel was stained with Coomassie brilliant blue

According to SDS-PAGE analysis, the enzyme had an apparent molecular weight of ~64 kDa, which is slightly higher than the calculated theoretical weight of 57 kDa. The molecular mass as determined by gel filtration was 228 kDa. Thus, the quaternary structure of the native enzyme is presumably a homotetramer (α4). These data are comparable to those gained previously from analysis of the PctCp of C. propionicum (Schweiger and Buckel 1984; Selmer et al. 2002).

Substrate specificity of PctRe

To get an overview of the substrate specificity of the purified PctRe, different acids were applied in the enzyme assays using acetyl-CoA as the CoA donor. The residual amount of acetyl-CoA after incubation of Pct with propionate, lactate, 3HP, acrylate, butyrate, 3HB, 4HB, crotonate or succinate as potential substrate was measured using a two-step photometric enzyme assay as described in Materials and methods. In the first step, the purified PctRe was incubated with acetyl-CoA and a potential substrate. Any acid added to the first reaction, lead to a CoA derivative of the added substrate, respectively, and thereby the amount of acetyl-CoA was diminished. In the second step of the enzyme assay, the acetyl-CoA is converted to citrate after addition of oxaloacetate and citrate synthase. Thereby CoASH is generated and photometrically measured with DTNB. The amount of released CoASH resembled the residual amount of acetyl-CoA which was not used to form the substrate's CoA thioester in the first step of the enzyme assay. Compared to the reaction without any substrate (100 % acetyl-CoA), the lowest residual quantity of 36 % acetyl-CoA was detected with propionate as substrate, followed by 3HP, 3HB and acrylate (Table 3). Thus, propionate was found to be the best substrate for the PctRe.
Table 3

Residual acetyl-CoA (%) and relative activities (%) with different potential substrates of the propionate CoA-transferasea

Acids added

Residual acetyl-CoA (%)

Relative activityb (%)

Propionate

36

100

3-Hydroxypropionate

49

80

3-Hydroxybutyrate

52

75

Acrylate

66

69

Succinate

69

48

Lactate

77

36

Butyrate

82

28

Crotonate

82

28

4-Hydroxybutyrate

88

19

None

100

0

aEach assay was carried out in two steps in 100 mM Tris–HCL (pH 7.4). First, 0.1 mM acetyl-CoA and 1 mM of the indicated substrate was incubated for 15 min at 30 °C with 5 μg of purified PctRe. After denaturation of the PctRe (90 s at 95 °C), 0.1 mM oxaloacetate, 5 μg citrate synthase and 0.5 mM 5.5′-dithiobis-(2-nitrobenzoate) were added, and the reaction vessel was further incubated for 15 min at 30 °C. The released CoASH, which resembles the residual amount of acetyl-CoA, was detected by measuring the absorbance at 412 nm

bA 100 % relative activity is the activity with the best substrate propionate

The resulting CoA thioesters of the respective substrates and 3MP were also confirmed by HPLC/MS. Recently, our laboratory investigated the microbial catabolism of organic sulfur compounds with DNA microarrays (Peplinski et al. 2010). Transcriptome analyses were carried out comparing transcripts of R. eutropha H16 during growth on gluconate, gluconate plus 3,3′-thiodipropionic acid (TDP) and gluconate plus DTDP. These data revealed that the pct gene is transcribed during all growth phases and conditions, and that an upregulation of 2.5-fold in the stationary phase during growth on gluconate plus DTDP occurred when compared to growth on gluconate alone (data not shown). Therefore, 3MP was also applied as substrate for the purified PctRe. Unfortunately, 3MP could not be used as a substrate for the photometric enzyme assay as the sulfhydryl group of 3MP reacts with DTNB.

For the detection of formed CoA-thioesters with HPLC/MS, each substrate was added to the reaction mixture containing acetyl-CoA. The CoA-thioester propionyl-CoA, butyryl-CoA, acrylyl-CoA and 3HP-CoA showed strong signals (Fig. 2). 3HB-CoA, Crotonyl-CoA, lactoyl-CoA (LA-CoA), succinyl-CoA and 4HB-CoA could be detected, but showed lower signals than the above mentioned substrates. 3MP-CoA occurred only in traces.
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-012-4624-9/MediaObjects/253_2012_4624_Fig2_HTML.gif
Fig. 2

Substrate specificity of PctRe. Samples were analyzed by HPLC/MS as described in Materials and methods. a Acetyl-CoA standard omitting PctRe. Acetyl-CoA was detected after a retention time (Rt) of 20.3 min. b Upon addition of propionate, propionyl-CoA was detected at Rt 24.0 min. c Butyryl-CoA was detected at Rt 28.0 min when butyrate was added as a substrate to the assay mixture. d After addition of acrylate, acrylyl-CoA was detected with a retention time of Rt 22.7 min. e 3HP-CoA was detectable at an Rt of 20.4 min upon addition of 3-hydroxypropionate (3HP). CoA thioesters were identified according to the mass spectrum

Analysis of the PctRe sequence

In silico analysis of the PctRe of R. eutropha H16 was done by comparing the amino acid sequence (542 amino acids) to other proteins using the BLAST algorithm (Altschul et al. 1997). Highest similarities were found with putative gene products encoded by members of the genus Cupriavidus: A Pct of C. necator N-1 (98 % identity), a CoA-transferase of C. taiwanensis LMG 19424 (93 % identity), a Pct of C. basilensis OR16 (85 % identity) and an acetyl-CoA:acetoacetyl-CoA transferase of C. metallidurans CH34 (85 % identity). Due to the substrate specificity, the PctRe could be identified as a CoA-transferase belonging to the family I.

Most CoA-transferases of family I exhibit hetero-oligomeric structures, and the catalytic glutamate residue is located within a (S)ENG motif (Mack et al. 1994). Recently, Tielens and coworkers postulated at least three different subfamilies existing in family I CoA-transferases (Tielens et al. 2010). A conserved EXG motif, which derived obviously from the (S)ENG motif and is containing the catalytic glutamate residue, and the conserved motif GXGGXXD as part of the oxyanion hole, were found in all three subclasses (Tielens et al. 2010; Rangarajan et al. 2005; Fig. 3a). However, the acyl-CoA transferase Ydif from E. coli exhibited the conserved motifs GXGG(A/F) for the oxyanion region and EXGXXG for the catalytic glutamate residue (Rangarajan et al. 2005). These two sequence motifs were also found in PctRe and in close homologues (Fig. 3b).
https://static-content.springer.com/image/art%3A10.1007%2Fs00253-012-4624-9/MediaObjects/253_2012_4624_Fig3_HTML.gif
Fig. 3

Amino acid sequence alignment of the conserved regions of the different subfamilies within the family I of CoA-transferases (a) and different propionate CoA-transferases/CoA-transferases (b). a Dark-colored amino acids indicate residues that are conserved in all subfamilies, whereas grey-colored amino acids indicate conserved residues within each subfamily, respectively. b The PctRe of R. eutropha H16 (Reut) is compared to a Pct of C. necator N-1 (Cnec), a CoA-transferase of C. taiwanensis LMG 19424 (Ctai), a Pct of C. basilensis OR16 (Cbas), an acetyl-CoA:acetoacetyl-CoA-transferase of C. metallidurans (Cmet) and the PctCp of C. propionicum (Cpro). The asterisks indicate complete conservation, colons indicate conserved and dots semi-conserved substitutions; the catalytic glutamate in the EXGXXG region and the conserved sequence motif GXGGF for the oxyanion hole are marked by boxes. The sequences have been aligned using ClustalW

So far, the Pct of C. propionicum (PctCp) is experimentally the best studied Pct and does not exhibit the whole (S)ENG motif but the derived EXG motif (Selmer et al. 2002). As described in this study, both, the PctRe and the previously investigated PctCp, exhibit a homotetrameric structure and share similar substrate specificities. For this reason, an amino acid alignment around the above described two conserved domains was done, including PctRe, its next homologues and PctCp (Fig. 3b). The PctCp exhibited a similarity of 44 % sequence identity to PctRe. All proteins of the Cupriavidus genus did not show the characteristic (S)ENG motif, but shared the EXGXXG consensus with PctCp (Fig. 3b). The most probable candidate for the catalytic glutamate of PctRe is the glutamate at position 342. The sequence motif of the oxyanion hole in all aligned sequences is GXGGF (Fig. 3b).

Generation and analysis of the precise gene deletion mutant R. eutropha H16∆pct

The mutant R. eutropha H16∆pct is a precise-deletion mutant and was generated by gene replacement as described in the Materials and methods section. To analyze the growth and storage behaviour, cultivation experiments in MSM were carried out with the wild type R. eutropha H16 and the mutant R. eutrophaH16∆pct as described in Materials and methods. No significant differences in the growth behaviour of the wild type R. eutropha H16 and the mutant R. eutropha H16∆pct was observed under any cultivation conditions investigated. The lack of PctRe did not affect the ability to metabolize the different carbon sources. During cultivation with 1 % gluconate (w/v) gluconate, the highest cell densities of about 700 Klett Units (KU) were reached whereas the lowest cell densities of about 450 KU were obtained during cultivation with 0.2 % (w/v) of sodium acetate after 50 h of cultivation time (data not shown). Additionally, gluconate plus 1 % (w/v) DTDP were used in order to investigate if the Pct is involved in the formation of 3MP-CoA during the synthesis of poly(3HB-co-3MP). Generally, DTDP is cleaved into two molecules of 3MP (Wübbeler et al. 2010), which are then activated to 3MP-CoA by a so far unknown enzyme. Cell growth of both strains with gluconate plus DTDP was diminished in comparison to growth of cells grown only in presence of gluconate.

When the cells were analyzed for PHA contents and composition by gas chromatography, also no significant differences between the wild type and the pct deletion mutant were detected. After 50 h of cultivation of the cells in presence of gluconate comparable poly(3HB) contents of about 66 % (w/w) of the cell dry weight (CDW) for the wild type and of about 63 % (w/w) for the mutant lacking the pct gene were measured. Similar polyester contents in the wild type and the mutant occurred also when cells were cultivated in presence of acetate with approximately 20 % (w/w of CDW) poly(3HB) for the wild type and 21 % (w/w of CDW) for the mutant R. eutropha H16∆pct. As expected, the copolymers poly(3HB-co-3MP) and poly(3-hydroxybutyrate-co-3-hydroxyvalerate) [poly(3HB-co-3HV)] were synthesized when gluconate plus DTDP or propionate, respectively, were used as carbon source during cultivation. The mutant R. eutropha H16∆pct was not impaired in the incorporation of 3MP into the copolyester poly(3HB-co-3MP). With DTDP, copolymer contents of 57 % (w/w of CDW) in the wild type and 52 % (w/w of CDW) in the mutant were obtained, consisting of 18 mol% or 20 mol% 3MP, respectively. With propionate, both strains reached a copolyester contents of about 40 % (w/w of CDW) consisting of approximately 22 mol% 3HV.

Discussion

In this study we report the cloning, purification and characterization of a propionate CoA-transferase from R. eutropha H16. The expression of the recombinant enzyme in E. coli succeeded well, which is in contrast to previous attempts to express the PctCp in E. coli (Selmer et al. 2002). By adding a decahistidine tag to the N terminus of the PctRe, the enzyme could be easily purified in only one step to a high degree of purity (Fig. 1). The enzyme showed a broad substrate specificity for carboxylic acids, while propionate was the best substrate, followed by 3HP, 3HB and acrylate (Fig. 2, Table 3). Substrates, which possess a hydroxyl group at the third carbon atom, seem to be preferred by PctRe, while 3MP containing a sulfhydryl group at this position gave hardly detectable amounts of 3MP-CoA. Besides monocarboxylic acids like propionate or butyrate, also the dicarboxylic acid succinate is accepted as a substrate by PctRe. The used substrates correspond to the typical substrates of enzymes belonging to family I CoA-transferases (Heider 2001). Most enzymes belonging to this family contain two dissimilar subunits in different aggregation states (Heider 2001). However, the size of 228 kDa for PctRe, as determined by gel filtration, indicates a homotetrameric quaternary structure. This is in agreement with the findings earlier described for the PctCp (Schweiger and Buckel 1984; Selmer et al. 2002).

During sequence analysis, it could be demonstrated that the typical (S)ENG consensus motif, containing the active glutamate residue, is lacking in PctRe (Fig. 3b). Very recently, the sequences of several representatives of the family I were investigated in more detail, and the family was divided into three different subclasses (Tielens et al. 2010). Whereas the first subclass (IA) exhibits the typical (S)ENG motif, it is remodeled to the active site motif EXG in classes IB and IC (Tielens et al. 2010; Fig. 3a). This altered motif could also be identified during this study in the PctRe and previously in the PctCp (Selmer et al. 2002), containing the active glutamate residue at position 342 or 324, respectively (Fig. 3a and b). The catalytic sites of the Acyl-CoA transferase YdiF from E. coli O157:H7 have been identified to possess the conserved sequences EXGXXG and GXGG(A/F). The latter is involved in the formation of the oxyanion hole (Rangarajan et al. 2005). PctRe and PctCp exhibit the same conserved sequence motives EXGXXG and GXGGF (Fig. 3a). From the three described subclasses, only subclass IA possesses the consensus sequence GXGGA, but contains the whole (S)ENG sequence (Tielens et al. 2010; Fig. 3a). In 2002, Selmer et al. postulated that PctCp and its next homologues form a novel subclass of CoA-transferases of the family I due to the differences in sequence and structure. According to the sequence differences to the subclasses IA–C, we would propose that there is a fourth subclass of CoA-transferases in family I, comprising — amongst others — PctRe and the PctCp.

The deletion of the pct gene in R. eutropha H16 resulted in no significant phenotypic changes of the mutant. Neither growth nor the storage behaviour was altered when PctRe was lacking during cultivation on the carbon sources gluconate, gluconate plus DTDP, acetate or propionate, respectively. The incorporation of 3MP or 3HV into the corresponding copolyesters poly(3HB-co-3MP) or poly(3HB-co-3HV) was also not slower or even impaired in the mutant R. eutropha H16∆pct, although microarray analyses indicated the upregulation of Pct during growth on DTDP. It could be demonstrated in the past, that R. eutropha H16 is able to replace lacking enzymes by isoenzymes, and that the deletion of single genes does not always result in an observable phenotype. Recent studies revealed for example that the β-ketothiolases PhaA, BktB and H16_A0170 contribute majorly to PHA biosynthesis in R. eutropha H16. However, the organism was only impaired in PHA accumulation when at least phaA and bktB were deleted in a double mutant (Lindenkamp et al. 2010). Such a compensation effect was also observed during a study on the utilization of plant oils and fatty acids as carbon sources for R. eutropha H16 (Brigham et al. 2010). Two fatty acid β-oxidation operons were detected in R eutropha H16, and after the deletion of only one of the two operons the mutant was still able to use palm oil or crude palm kernel oil as sole carbon source. Only a double mutant, lacking both β-oxidation operons, was unable to grow under the mentioned conditions (Brigham et al. 2010). This is very likely to be the case here, so that the deletion of only pct alone does not result in a detectable phenotype. In R. eutropha H16 the PctRe could be involved in the acetate or propionate metabolism. Absence of PctRe might firstly be compensated by an acetyl-CoA transferase during acetate metabolism. In R. eutropha H16, two acetyl-CoA transferase homologues were identified (H16_A1358, H16_B1368) which could mediate the formation of acetyl-CoA from acetate. Alternatively, an acetyl-CoA synthetase could form acetyl-CoA. In propionate metabolism, also two different enzymes could mediate the formation of propionyl-CoA from propionate in R. eutropha H16: an acetyl-CoA synthetase or a propionyl-CoA synthetase, respectively.

Propionate CoA-transferases are employed in several different biotechnological studies. The best investigated propionate CoA-transferase is PctCp. It has been characterized in detail (Schweiger and Buckel 1984; Selmer et al. 2002). Different short-chain-length hydroxyl fatty acid CoA thioesters were synthesized in the past using purified PctCp (Valentin and Steinbüchel 1994). In this study, we demonstrated, that also the PctRe exhibits a great potential for the in vitro formation of such CoA thioesters for studies, like they have been done in the past, e.g., the testing of substrate specificities of different PHA synthases (Valentin and Steinbüchel 1994; Han et al. 2011; Tajima et al. 2012). Polylactic acid (PLA) gains more and more interest as biodegradable polyesters as an alternative to petroleum-based plastics. The mechanical properties of PLA can be compared to those of poly(ethylene terephthalate) (PET) and are therefore used as packaging materials (Auras et al. 2004). Here, also, Pct takes a central role in the biosynthesis of these polyesters. PctCp and also the Pct from Megasphaera elsdenii have been employed in the production of lactate containing polyesters in recombinant strains of Escherichia coli (Jung et al. 2010; Yamada et al. 2010; Yang et al. 2010). During the production of PLA in engineered E. coli, the PctCp acts as the intracellular supplier of LA-CoA, which is then polymerized by an engineered polyhydroxyalkanoate (PHA) synthase from Pseudomonas sp. 61–3 (Matsumoto and Taguchi 2010; Taguchi et al. 2008). Very recently, an acetyl-CoA regenerating pathway has been established for the synthesis of (R)-3-hydroxybutyrate from glucose by using PhaA, PhaB and the PctCp (Matsumoto et al. 2012). In another study, the PctCp was used to enhance the 3HV content in engineered cells of E. coli heterologously expressing the PctCp in addition to a β-ketothiolase (BktB), PhaB and PhaC from R. eutropha H16 (Yang et al. 2012).

Thus, as discussed above, the use of propionate CoA-transferases in engineered E. coli to produce different polyesters and, in particular, PLA, is an interesting approach. Due to our findings in this study, the PctRe could be another promising candidate for applications in this field of biotechnology.

Acknowledgements

This study was supported by a grant provided by the Bundesministerium für Bildung und Forschung (BMBF; Förderkennzeichen 0313751E).

Copyright information

© Springer-Verlag Berlin Heidelberg 2012