Key words

1 Introduction

Protein synthesis in yeast is carried out by the 80S ribosomes that translate genetic information from messenger RNA (mRNA) into functional proteins with the help of aminoacyl-tRNAs (aa-tRNA) and a large number of specific translation factors. Translation entails four steps, initiation , elongation , termination , and ribosome recycling [1, 2]. During the initiation phase, the ribosome selects a start codon and an open reading frame for translation . Eukaryotic initiation factor 2 (eIF2), in its active GTP-bound form, binds to initiator methionyl-tRNA (Met-tRNAi Met) to form a ternary complex that delivers the tRNA to the small ribosomal subunit (40S ). The 40S subunit together with eIF2–GTP–Met-tRNAi Met, eIF1, eIF1A, and eIF3 forms the 43S preinitiation complex (43S PIC) , which then interacts with the mRNA that is recruited by the eIF4/PABP complex to form the 48S complex (48S PIC ). Following scanning and start codon recognition, eIF2 hydrolyzes GTP using eIF5 as a GTPase activating protein, allowing the dissociation of eIF2–GDP and recruitment of eIF5B. After large ribosomal subunit (60S ) joining, eIF5B hydrolyzes GTP, the initiation factors dissociate and the 80S initiation complex (80S IC) is ready to enter elongation (Fig. 1). eIF2–GDP is recycled to its active GTP-bound form with the help of the nucleotide exchange factor eIF2B, whereas the nucleotide exchange in eIF5B occurs spontaneously [2,3,4]. In the subsequent step of elongation , the eukaryotic elongation factor eEF1A binds aa-tRNA in a GTP-dependent manner and delivers the aa-tRNA to the A site of the ribosome. Codon recognition by the aa-tRNA triggers GTP hydrolysis by eEF1A, releasing the factor, and enables the aa-tRNA to accommodate in the A site. Then, peptide bond forms between the peptidyl-tRNA in the P site and the aa-tRNA in the A site. In most cases, peptide bond formation occurs spontaneously at the peptidyl transferase center of the ribosome, but with some amino acids, for example, strings of consecutive prolines, it requires the help of eIF5A. eEF1A–GDP is recycled to its active GTP-bound form with the help of nucleotide exchange factor eEF1B. Following peptide bond formation, the ribosome moves along the mRNA by one codon in a process called translocation, which is facilitated by eEF2 in the GTP-bound state and the fungal-specific eEF3 in its ATP-bound state. Once the stop codon is reached, translation is terminated with the help of the release factors eRF1 and eRF3 (Fig. 1) [1, 5]. Ribosome recycling , which requires Rli1 , Ligatin and can also be promoted by eIF3j [6,7,8], results in the disassembly of the ribosome posttermination complex into ribosomal subunits, tRNA, and mRNA .

Fig. 1
figure 1

Schematic of components required to in vitro reconstitute yeast mRNA translation initiation and elongation using a short unstructured mRNA , which overcomes the requirement of eIF4F complex

Full size image

In this chapter, we describe the reconstitution of yeast translation system to study the initiation and elongation phases. In detail, we provide updated purification protocols for individual translation factors, ribosomes, and aa-tRNAs. Furthermore, we describe several assays for testing the activity of the purified components, the efficiency of the initiation complex formation and of peptide bond formation. This in vitro translation system utilizes an unstructured model mRNA , which overcomes the requirement for mRNA capping and for auxiliary cap-binding proteins.

2 Materials

2.1 Media

  1. 1.

    YPD media: 10 g/L yeast extract, 20 g/L peptone, 2% glucose (1.8% agar-agar for plates).

  2. 2.

    Selective media: 5.1 g/L (NH4)2SO4, 1.7 g/L yeast nitrogen base, 2% glucose, 0.67 g/L minimal media powder (-LEU -URA or -LEU) with 1.8% agar-agar for plates.

  3. 3.

    LB-media: 10 g/L tryptone; 10 g/L NaCl; 5 g/L yeast extract.

2.2 Antibiotics, DNase , and IPTG

  1. 1.

    100 mg/mL ampicillin sodium salt.

  2. 2.

    34 mg/mL chloramphenicol.

  3. 3.

    2 units/μL DNase .

  4. 4.

    1 mM puromycin.

  5. 5.

    1 M Isopropyl β-d-1-thiogalactopyranoside (IPTG ).

2.3 Buffers

  1. 1.

    Buffer 1: 10× Ribo Buffer A: 200 mM HEPES–KOH pH 7.5, 1 M KOAc, 25 mM Mg(OAc)2.

  2. 2.

    Buffer 2: 1× Buffer 1, 1 mg/mL heparin sodium salt, 2 mM DTT.

  3. 3.

    Buffer 3: 1× Buffer 1, 400 mM KCl, 1 M sucrose, 2 mM DTT.

  4. 4.

    Buffer 4: 1× Buffer 1, 400 mM KCl, 1 mg/mL heparin sodium salt, 2 mM DTT.

  5. 5.

    Buffer 5: 50 mM HEPES–KOH pH 7.5, 500 mM KCl, 2 mM MgCl2, 2 mM DTT.

  6. 6.

    Buffer 6: Same as buffer 5 with 5 mM MgCl2, 0.1 mM ethylenediaminetetraacetic acid (EDTA) pH 8.0, 5% or 30% sucrose.

  7. 7.

    Buffer 7: 50 mM HEPES–KOH, 100 mM KCl, 250 mM sucrose, 2.5 mM MgCl2, 2 mM DTT.

  8. 8.

    Buffer 8: 20 mM HEPES–NaOH pH 7.5, 150 mM NaCl, 5% glycerol, 4 mM ß-mercaptoethanol (ß-me).

  9. 9.

    Buffer 9: Same as buffer 8 with 1 M NaCl.

  10. 10.

    Buffer 10: 20 mM HEPES–KOH pH 7.5, 200 mM KCl, 2 mM DTT.

  11. 11.

    Buffer 11: Same as buffer 8 without NaCl and glycerol.

  12. 12.

    Buffer 12: 20 mM HEPES–NaOH pH 7.5, 500 mM NaCl, 5% glycerol, 4 mM ß-me.

  13. 13.

    Buffer 13: Same as buffer 12 with 150 mM NaCl.

  14. 14.

    Buffer 14: Same as buffer 13 with 30 mM l-glutathione reduced.

  15. 15.

    Buffer 15: Same as buffer 12 with 1 M NaCl.

  16. 16.

    Buffer 16: 20 mM HEPES–KOH pH 7.5, 100 mM KCl, 2 mM DTT.

  17. 17.

    Buffer 17: 50 mM HEPES–NaOH pH 7.5, 400 mM NaCl, 5% glycerol, 4 mM ß-me.

  18. 18.

    Buffer 18: 20 mM HEPES–NaOH pH 7.5, 500 mM NaCl, 30 mM l-glutathione reduced. 5% glycerol, 4 mM ß-me.

  19. 19.

    Buffer 19: 20 mM HEPES–NaOH pH 7.5, 275 mM NaCl, 5% glycerol, 4 mM ß-me.

  20. 20.

    Buffer 20: 20 mM HEPES–KOH pH 7.5, 200 mM KCl, 2 mM DTT.

  21. 21.

    Buffer 21: 20 mM HEPES–KOH pH 7.5, 500 mM KCl, 10% glycerol, 3 mM ß-me.

  22. 22.

    Buffer 22: Same as buffer 21 with 30 mM L-glutathione reduced.

  23. 23.

    Buffer 23: 20 mM HEPES–KOH pH 7.5, 200 mM KCl, 10% glycerol, 2 mM DTT.

  24. 24.

    Buffer 24: 20 mM HEPES–KOH pH 7.5, 100 mM KCl, 5% glycerol, 2 mM DTT.

  25. 25.

    Buffer 25: 20 mM 3-(N-morpholino)propane sulfonic acid (MOPS)–KOH pH 6.7, 500 mM KCl, 10% glycerol, 3 mM ß-me.

  26. 26.

    Buffer 26: Same as buffer 25 with 30 mM l-glutathione reduced.

  27. 27.

    Buffer 27: 20 mM HEPES–KOH pH 7.5, 200 mM KCl, 10% glycerol, 2 mM DTT.

  28. 28.

    Buffer 28: 20 mM HEPES–KOH pH 7.5, 100 mM KCl, 5% glycerol, 2 mM DTT.

  29. 29.

    Buffer 29: 75 mM HEPES–KOH pH 7.6, 100 mM KCl, 100 μM GDP, 10 mM ß-me.

  30. 30.

    Buffer 30: 20 mM HEPES–KOH pH 7.6, 500 mM KCl, 20 mM imidazole, 10% glycerol, 0.1 mM MgCl2, 10 μM GDP, 10 mM ß-me.

  31. 31.

    Buffer 31: Same as buffer 30 with 250 mM imidazole.

  32. 32.

    Buffer 32: 20 mM HEPES–KOH pH 7.6, 100 mM KCl, 10% glycerol, 0.1 mM MgCl2, 10 μM GDP, 2 mM DTT.

  33. 33.

    Buffer 33: Same as buffer 32 with 1 M KCl.

  34. 34.

    Buffer 34: 20 mM HEPES–KOH pH 7.6, 100 mM KOAc, 0.1 mM Mg(OAc)2, 10% glycerol, 2 mM DTT.

  35. 35.

    Buffer 35: 20 mM HEPES–KOH pH 7.6, 2 mM DTT, 10 μM GDP.

  36. 36.

    Buffer 36: 20 mM Tris–HCl pH 7.5, 350 mM KCl, 5 mM MgCl2, 1 mM PMSF, 10% glycerol, 20 mM imidazole, 0.5 mM ß-me.

  37. 37.

    Buffer 37: Same as buffer 36 with 450 mM KCl.

  38. 38.

    Buffer 38: Same as buffer 37 with 250 mM imidazole.

  39. 39.

    Buffer 39: 20 mM Tris–HCl pH 7.5, 75 mM KCl, 10% glycerol, 2 mM DTT.

  40. 40.

    Buffer 40: 50 mM Tris–HCl pH 7.5, 5 mM MgCl2, 50 mM NH4Cl, 0.2 mM PMSF, 10% glycerol, 0.1 mM EDTA pH 8.0, 1 mM DTT.

  41. 41.

    Buffer 41: 20 mM Tris–HCl pH 7.5, 50 mM KCl, 0.1 mM EDTA pH 8.0, 0.2 mM PMSF, 25% glycerol, 1 mM DTT.

  42. 42.

    Buffer 42: Same as buffer 41 with 500 mM KCl.

  43. 43.

    Buffer 43: 20 mM Tris–HCl pH 7.5, 0.1 mM EDTA pH 8.0, 200 mM KCl, 25% glycerol, 1 mM DTT.

  44. 44.

    Buffer 44: 50 mM potassium phosphate pH 8.0, 1 M KCl, 0.2 mM PMSF, 1% Tween 20, 10 mM imidazole.

  45. 45.

    Buffer 45: Same as buffer 44 with 20 mM imidazole.

  46. 46.

    Buffer 46: Same as buffer 44 with 500 mM imidazole.

  47. 47.

    Buffer 47: 20 mM Tris–HCl pH 7.5, 100 mM KCl, 0.1 mM EDTA pH 8.0, 10% glycerol, 0.2 mM PMSF, 1 mM DTT.

  48. 48.

    Buffer 48: 20 mM HEPES–KOH pH 7.5, 500 mM KCl, 20 mM imidazole, 10% glycerol, 2 mM ß-me.

  49. 49.

    Buffer 49: 20 mM HEPES- KOH pH 7.5, 100 mM KCl, 250 mM imidazole, 10% glycerol, 2 mM ß-me.

  50. 50.

    Buffer 50: 20 mM HEPES- KOH pH 7.5, 100 mM KCl, 10% glycerol, 2 mM DTT.

  51. 51.

    Buffer 51: 20 mM Tris–HCl pH 7.5, 100 mM KCl, 1 mM DTT.

  52. 52.

    Buffer 52: 20 mM HEPES- KOH pH 7.5, 100 mM KCl, 2 mM DTT.

  53. 53.

    Buffer 53: Same as buffer 52 with 250 mM imidazole.

  54. 54.

    Buffer 54: YT buffer: 30 mM HEPES–KOH pH 7.5, 100 mM KOAc, 3 mM MgCl2.

  55. 55.

    Buffer 55: YT9 buffer: 30 mM HEPES–KOH pH 7.5, 100 mM KOAc, 9 mM MgCl2.

  56. 56.

    Buffer 56: YT0 buffer: 30 mM HEPES–KOH pH 7.5, 100 mM KOAc.

  57. 57.

    Buffer 57: 30 mM Bis-Tris pH 6.0, 10 mM MgCl2, 300 mM NaCl.

  58. 58.

    Buffer 58: Same as buffer 57 with 1 M NaCl.

  59. 59.

    Buffer 59: HAKM7: 30 mM HEPES–NaOH pH 7.5, 70 mM NH4Cl, 30 mM KCl, 7 mM MgCl2.

  60. 60.

    Buffer 60: HPLC purification buffer: A 20 mM NH4OAc, 10 mM MgCl2, 400 mM NaCl, 5% ethanol.

  61. 61.

    Buffer 61: HPLC purification buffer B: 20 mM NH4OAc, 10 mM MgCl2, 400 mM NaCl, 15% ethanol.

  62. 62.

    Buffer 62: HPLC-buffer A: 0.1% trifluoroacetic acid (TFA).

  63. 63.

    Buffer 63: HPLC-buffer B: 0.1% TFA; 65% acetonitrile.

2.4 Strains and Plasmids

Protein

Expression host

Genotype/Description

References

eIF1

E. coli

PT7; eIF1 cloned NdeI/XhoI; ApR

Kind gift from Dr. Ralf Ficner

eIF1A

E. coli

Ptac; GST-tag; eIF1A cloned BamHI/XhoI; ApR

This work

eIF5

E. coli

Ptac; GST-tag; eIF5 cloned BamHI/XhoI; ApR

This work

eIF5B

E. coli

Ptac; GST-tag; eIF5B cloned BamHI/XhoI; ApR

This work

eIF2

S. cerevisiae

MATα leu2-3 leu2-112 ura3-52 ino1 gcn2Δ pep4::LEU2 sui2Δ HIS4-lacZ pAV1089[SUI2 SUI3 His-tagged GCD11 URA3]

[9]

eIF3

S. cerevisiae

MATa/α ura3-52/ura3-52 trp1/trp1 leu2-Δ1/leu2-Δ1 his3-Δ200/his3-Δ200 pep::HIS4/pep::HIS4 prb1-Δ1.6/prb1-Δ1.6 can1/can1 GAL +(pLPY-PRT1His-TIF34HA-TIF35Flag)/(pLPY-TIF32-NIP1)

[10]

eIF5A

(see Note 1 )

E. coli

Ptac; GST-tag; eIF5A cloned BamHI/XhoI; ApR

This work

DYS1-LIA1

E. coli

Ptac; His-tag; DYS1 and LIA1 cloned PacI/SwaI; ApR

This work

eEF2

S. cerevisiae

MATa ade2 leu2 ura3 his3 leu2 trp1 eft1::HIS3 eft2::TRP1 pEFT2-6xHis LEU2 CEN

[11]

eEF1A and Ribosomal subunits (YAS2488)

S. cerevisiae

MATa leu2-3112 his4-539 trp1 ura3-52 cup1::LEU2/PGK1pG/MFA2pG

[12]

3 Methods

3.1 Purification of Ribosomal Subunits from S. Cerevisiae

  1. 1.

    Streak the YAS2488 strain on a YPD plate and incubate for 2 days at 30 °C (see Note 2 ). Inoculate a preculture of 200 mL YPD media overnight in a shaker at 30 °C with 180 rpm. Inoculate 100 L YPD culture with the preculture at a starting OD600 of 0.1 and grow until mid-log phase in a bioreactor . Harvest the cells, wash the pellets with MilliQ water and suspend the cell pellets in 1 mL/g of cells in buffer 2. Prepare frozen cell droplets by dropping the lysate using a syringe or serological pipette in liquid nitrogen. Grind the cell droplets using an ultracentrifugal mill prechilled with liquid nitrogen. Collect the powder and store in −80 °C freezer.

  2. 2.

    Thaw 200 g (~400 mL lysate) of grinded powder, add 100 μL DNase to the lysate and incubate for 30 min on ice. Add one EDTA-free Protease Inhibitor tablet dissolved in 1× buffer 1. Centrifuge at 25,364 × g at 4 °C for 30 min to clear the lysate. Collect the supernatant carefully without disturbing the pellets and note the exact volume. At this point, bring the KCl concentration to 500 mM and filter the lysate using 1 μm glass fiber filters or equivalent. Chill Ti45 ultracentrifuge tubes. Add 7 mL of sucrose cushion (buffer 3) into each tube. Carefully layer 55 mL of cleared lysate onto each sucrose cushion. Centrifuge at 235,418 × g for 2 h at 4 °C. Immediately remove the lipids layer on top of each tube and carefully swipe the tubes to get rid of leftover lipids and extra supernatant. The ribosomal pellet should be transparent. Add 1 mL of buffer 4 to each tube and incubate on ice for 15 min. Dissolve the pellets by gently pipetting using a P1000 pipette. Pool the ribosome solution and bring the final volume to 10 mL with buffer 4. Stir at a moderate speed with a micro-stir bar for 1 h at 4 °C.

  3. 3.

    Add 200 μL of sucrose cushion (buffer 3) in chilled MLA 130 tubes and carefully layer 1 mL of ribosome solution in each tube, on top of the sucrose cushion. Centrifuge at 603,000 × g for 30 min at 4 °C. Discard the supernatant by inverting the tubes. Add 400 μL of buffer 5 to each tube and incubate on ice for 15 min. Dissolve the pellets carefully, pool the solution in a 15 mL falcon tube and bring the total volume to 6 mL with buffer 5. Add 60 μL of 100 mM puromycin and incubate for 15 min on ice and then 10 min at 37 °C.

  4. 4.

    Gradient preparation and ribosome layering: Prepare 5%–30% sucrose gradient in SW32 tubes. Pipet 25 mL of 30% sucrose solution (buffer 6) at the bottom and carefully layer 15 mL of 5% sucrose solution (buffer 6) on top. Close the gradient tube with caps without any bubbles. Prepare the gradient using Gradient Master. Remove the caps from the gradient tubes and take 1 mL out from the top of each SW32 tube. Carefully layer 1 mL of ribosome solution on each SW32 gradient tube. Centrifuge at 106,750 × g for 16 h at 4 °C.

  5. 5.

    Gradients are fractionated either using a peristaltic pump connected to an FPLC system or gradient fractionation system. Collect the fractions from the bottom of the tube and measure OD260 of each fraction. The first peak with higher sucrose concentration corresponds to the 60S subunits peak and the second large peak corresponds to the 40S subunits peak. Pool the fractions corresponding to 40S and 60S subunits and concentrate using a 100 kDa MWCO Vivaspin concentrator. Exchange to buffer 7 using the same concentrator. Measure the OD260 of concentrated 40S and 60S subunits solutions and calculate the concentrations using the extinction coefficients 2 × 107 M−1 cm−1 for 40S subunits and 4 × 107 M−1 cm−1 for 60S subunits [13].

  6. 6.

    Quality control for rRNA integrity: Prepare solutions containing 3 pmol of 40S or 60S subunits with 60% formamide and 1x loading dye (50 mM Tris–HCl pH 7.6, 0.25% bromophenol blue, 60% glycerol). Load on a 1% agarose gel premixed with SYBR gold dye. Run the gel at 70 V (10 V/cm of gel) for 1 h (dye should reach two-thirds of the gel). Visualize 28S and 18S rRNA for 60S and 40S subunits under UV gel scanner. 5S and 5.8S are too small to be visualized on the gel.

3.2 Purification of Initiation Factors

Unless specified otherwise, all purifications are performed using an FPLC system.

  1. 1.

    eIF1

    Express eIF1 from pETT22b plasmid (no tag) in BL21 E. coli cells. Inoculate a preculture of 200 mL LB with 100 μg/mL carbenicillin and grow at 37 °C overnight. Next day, inoculate 6 L of LB with 100 μg/mL carbenicillin with the overnight preculture at a starting OD600 of 0.1 and grow in a shaker at 37 °C with 180 rpm. Induce expression with 0.5 mM IPTG when OD600 reaches 0.8 and incubate at 37 °C for additional 3–4 h. Harvest the cells at 7000 rpm for 10 min at 4 °C and store at −80 °C. Resuspend the cell pellet in buffer 8 (3 mL/g of cells) complemented with 100 μL of DNase and one protease inhibitor tablet. Homogenize the cell suspension on ice and use Emulsiflex to lyse the cells. Centrifuge at 180,800 × g for 1 h at 4 °C. Collect the supernatant and filter it through 1 μm glass fiber filters or equivalent. Equilibrate the HiTrap SP column with buffer 8. Load the sample onto the column in buffer 8. Wash the column with buffer 8. Elute with a linear gradient from 0% to 100% of buffer 9 over 60 mL. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eIF1. Dilute the pool to decrease the salt concentration to 150 mM NaCl with buffer 11. Equilibrate the HiTrap Heparin column with buffer 8. Load the diluted sample and wash the column with buffer 8. Elute eIF1 with a linear gradient from 0% to 100% of buffer 9 over 60 mL. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eIF1. Concentrate eIF1 and load on a HiLoad 26/600 Superdex75 pg size-exclusion chromatography column preequilibrated with buffer 10. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eIF1. Concentrate the eIF1 using a 5 kDa MWCO Vivaspin concentrator. Check the final concentration at the spectrophotometer (OD280, extinction coefficient 3105 M−1 cm−1), flash-freeze aliquots, and store at −80 °C.

  2. 2.

    eIF1A

    Express eIF1A from pGEX-6P1 plasmid (GST tag) in BL21 E. coli cells. Inoculate a pre-culture of 200 mL LB with 100 μg/mL carbenicillin and grow at 37 °C overnight. Next day, inoculate 6 L of LB with 100 μg/mL carbenicillin with the overnight preculture at a starting OD600 of 0.1 and let it grow in a shaker at 37 °C with 180 rpm. Reduce the temperature from 37 °C to 16 °C when OD600 reaches 0.4, induce expression with 0.5 mM IPTG when OD600 reaches 0.8 and grow for additional 16 h. Harvest the cells at 7000 rpm for 10 min at 4 °C. Resuspend the cell pellets (30–50 g) in 2 mL/g with buffer 12 complemented with 100 μL of DNase and one protease inhibitors tablet. Homogenize the cell suspension on ice and use Emulsiflex to lyse the cells. Centrifuge at 180,800 × g for 1 h at 4 °C. Collect the supernatant and filter using 1 μm glass fiber filters or equivalent. Equilibrate the GSTrap column with buffer 13. Load the lysate and wash the column with buffer 13. Elute eIF1A with 100% of buffer 14 and collect 2 mL fractions. Analyze the fractions on a 15% SDS-PAGE. Pool the elution fractions and add PreScission protease (1 μM final) to cleave the tag while dialyzing overnight at 4 °C against 2 L of buffer 13. Load the dialyzed sample on a Resource Q column and elute with 0 to 100% buffer 15 over 60 mL. Analyze the fractions on a 15% SDS-PAGE, pool the fractions containing eIF1A. Concentrate eIF1A and load on a HiLoad 26/600 Superdex75 pg size-exclusion chromatography column preequilibrated with buffer 16. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eIF1A. Concentrate proteins using a 5 kDa MWCO Vivaspin concentrator. Check the final concentration at the spectrophotometer (OD280, extinction coefficient 10,095 M−1 cm−1), flash-freeze aliquots, and store at −80 °C.

  3. 3.

    eIF5

    Express eIF5 from pGEX-6P1 plasmid (GST tag) in BL21 E. coli cells. Inoculate a preculture of 200 mL LB with 100 μg/mL carbenicillin and grow at 37 °C overnight. Next day, inoculate 6 L of LB with 100 μg/mL carbenicillin with the overnight preculture at a starting OD600 of 0.1 and let it grow in a shaker at 37 °C with 180 rpm. Reduce the temperature from 37 °C to 16 °C when OD600 reaches 0.4, induce expression with 0.5 mM IPTG when OD600 reaches 0.8 and grow for additional 16 h. Harvest the cells at 7000 rpm for 10 min at 4 °C. Resuspend the cell pellets (30–50 g) in 2 mL/g with buffer 17 complemented with 100 μL of DNase and one protease inhibitors tablet. Homogenize the cell suspension on ice and use Emulsiflex to lyse the cells. Centrifuge at 180,800 × g for 1 h at 4 °C. Collect the supernatant and filter using 1 μm glass fiber filters or equivalent. Equilibrate the GSTrap column with buffer 17. Load the lysate and wash the column with buffer 17. Elute eIF5 with 100% of buffer 18 and collect 2 mL fractions. Analyze the fractions on a 15% SDS-PAGE. Pool the elution fractions and add PreScission protease (1 μM final) to cleave the tag while dialyzing overnight at 4 °C against 2 L of buffer 19. Perform a second GSTrap column and eIF5 remains now in the flow-through as the GST tag is cleaved. Concentrate eIF5 and load on a HiLoad 26/600 Superdex75 pg size-exclusion chromatography column preequilibrated with buffer 20. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eIF5. Concentrate proteins using a 10 kDa MWCO Vivaspin concentrator. Check the final concentration at the spectrophotometer (OD280, extinction coefficient 30,285 M−1 cm−1), flash-freeze aliquots, and store at −80 °C.

  4. 4.

    eIF5A

    Express eIF5A from pGEX-6P1 plasmid (GST tag) in Rosetta 2 cells. Inoculate a preculture of 200 mL LB with 100 μg/mL carbenicillin and 34 μg/mL chloramphenicol, and grow at 37 °C overnight. Next day, inoculate 6 L of LB with 100 μg/mL carbenicillin with the overnight preculture at a starting OD600 of 0.1 and let it grow in a shaker at 37 °C with 180 rpm. Induce eIF5A expression with 0.5 mM IPTG when OD600 reaches 0.8 and incubate at 37 °C for additional 3–4 h. Harvest the cells at 7000 rpm for 10 min at 4 °C. Resuspend the cell pellets (30–50 g) in 2 mL/g with buffer 21, complemented with 100 μL of DNase and one protease inhibitors tablet. Homogenize the cell suspension on ice and use Emulsiflex to lyse the cells. Centrifuge at 180,800 × g for 1 h at 4 °C. Collect the supernatant and filter using 1 μm glass fiber filters or equivalent. Equilibrate the GSTrap column with buffer 21. Load the lysate and wash the column with buffer 21. Elute eIF5A with buffer 22 and collect 2 mL fractions. Analyze the fractions on a 15% SDS-PAGE. Pool the elution fractions and add PreScission protease (1 μM final) to cleave the tag while dialyzing overnight at 4 °C against 2 L of buffer 23. After dialysis, load eIF5A on a HiLoad 26/600 Superdex75 pg size-exclusion chromatography column preequilibrated with buffer 24. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eIF5A. Concentrate proteins using a 5 kDa MWCO Vivaspin concentrator. Check the final concentration at the spectrophotometer (OD280, extinction coefficient 3105 M−1 cm−1), flash-freeze aliquots, and store at −80 °C.

  5. 5.

    eIF5B-397C

    Express eIF5B-397C from pGEX-6P1 plasmid (GST-tag) in BL21 E. coli cells. Inoculate a preculture of 200 mL LB with 100 μg/mL carbenicillin and grow at 37 °C overnight. Next day, inoculate 6 L of LB with 100 μg/mL carbenicillin with the overnight preculture at a starting OD600 of 0.1 and let it grow in a shaker at 37 °C with 180 rpm. Induce eIF5B-397C expression with 0.5 mM IPTG when OD600 reaches 0.8 and incubate at 37 °C for additional 3–4 h. Harvest the cells at 7000 rpm for 10 min at 4 °C. Resuspend the cell pellets (30–50 g) in 2 mL/g with buffer 25, complemented with 100 μL of DNase and one protease inhibitors tablet. Homogenize the cell suspension on ice and use Emulsiflex to lyse the cells. Centrifuge at 180,800 × g for 1 h at 4 °C. Collect the supernatant and filter using 1 μm glass fiber filters or equivalent. Equilibrate the GSTrap column with buffer 25. Load the lysate and wash the column with buffer 25. Elute eIF5B-397C with 100% of buffer 26 and collect 2 mL fractions. Analyze the fractions on a 15% SDS-PAGE. Pool the elution fractions and add PreScission protease (1 μM final) to cleave the tag while dialyzing overnight at 4 °C against 2 L of buffer 27. After dialysis, load eIF5A on a HiLoad 26/600 Superdex200 pg size-exclusion chromatography column preequilibrated with buffer 28. Collect 2 mL fractions for each, analyze on a 15% SDS-PAGE and pool the fractions containing eIF5B-397C. Concentrate proteins using a 30 kDa MWCO Vivaspin concentrator. Check the final concentration at the spectrophotometer (OD280, extinction coefficient 46,215 M−1 cm−1), flash-freeze aliquots, and store at −80 °C.

  6. 6.

    eIF2

    Streak eIF2 strain on a selective media (-LEU -URA) plate and incubate for 2 days at 30 °C. Inoculate a preculture of 200 mL selective media (-LEU -URA) overnight in a shaker at 30 °C with 180 rpm. Inoculate 100 L selective media (-LEU -URA) with the preculture at a starting OD600 of 0.1 and grow until mid-log phase in a bioreactor . Harvest the cells, wash the pellets with MilliQ water and suspend the cell pellets in 1 mL/g of cells in buffer 29. Prepare frozen cell droplets by dropping the lysate using a syringe or serological pipette in liquid nitrogen. Grind the cell droplets using an ultracentrifugal mill prechilled with liquid nitrogen. Collect the powder and store in −80 °C freezer. Thaw the grinded yeast cell powder (~200 mL lysate in buffer 29) on ice and add one protease inhibitor tablet. Centrifuge at 180,800 × g for 30 min at 4 °C. Collect the supernatant into a fresh beaker and note down the volume. Stir the supernatant on ice or in the cold room. While stirring, gradually add grinded solid ammonium sulfate to 75% saturation (48.3 g ammonium sulfate/100 mL of lysate) and stir for 1 h. Centrifuge at 235,418 × g for 1 h at 4 °C. Discard the supernatant and resuspend the pellet in at least 200 mL of buffer 30. Filter the lysate through 1 μm glass fiber filters or equivalent. Equilibrate HisTrap columns with buffer 30. Load the sample onto the columns, wash the columns with buffer 30 and elute the proteins with 100% buffer 31. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eIF2. Dilute the pooled fractions five times by slowly adding buffer 35 with constant mixing to avoid precipitation. Equilibrate the Heparin column with buffer 32. Load the diluted sample immediately onto the Heparin column and wash with buffer 32. Elute eIF2 with a linear gradient from 0% to 100% of buffer 33 over 60 mL. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eIF2. Decrease the salt concentration of the pool to 100 mM KCl. Spin the sample for 20 min at 13,200 rpm at 4 °C. Equilibrate the HiTrap Q column with buffer 32. Load the diluted sample and wash the column with buffer 32. Elute eIF2 with a linear gradient from 0% to 100% of buffer 33 over 60 mL. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eIF2. Concentrate the eIF2 protein with a 10 kDa MWCO cutoff concentrator and exchange the buffer with buffer 34. Check the final concentration at the spectrophotometer (OD280, extinction coefficient 59,010 M−1 cm−1), flash-freeze aliquots, and store at −80 °C.

  7. 7.

    eIF3

    Streak eIF3 strain on a selective media (-LEU -URA) plate and incubate for 2 days at 30 °C. Inoculate a preculture of 200 mL selective media (-LEU -URA) overnight in a shaker at 30 °C with 180 rpm. Inoculate 100 L selective media (-LEU -URA) with the preculture at a starting OD600 of 0.1 and grow until mid-log phase in a bioreactor . Harvest the cells, wash the pellets with MilliQ water and suspend the cell pellets in 1 mL/g of cells in buffer 36. Prepare frozen cell droplets by dropping the lysate using a syringe or serological pipette in liquid nitrogen. Grind the cell droplets using an ultracentrifugal mill prechilled with liquid nitrogen. Collect the powder and store in −80 °C freezer. Thaw the grinded yeast cell powder (~200 mL lysate in buffer 36) on ice and add one protease inhibitor tablet. Centrifuge at 88,180 × g for 15 min at 4 °C. Collect the supernatant and filter through 1 μm glass fiber filters or equivalent. Equilibrate two HisTrap columns with buffer 36. Load the lysate on the columns; wash the columns with buffer 36 then with buffer 37. Elute the proteins with 100% buffer 38. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eIF3 subunits. Load eIF3 on a Hi Load 26/600 Superdex200 pg size-exclusion chromatography column preequilibrated with buffer 39. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eIF3. Concentrate the eIF3 with a 10 kDa MWCO Vivaspin concentrator. Check the final concentration at the spectrophotometer (OD280, extinction coefficient 365,210 M−1 cm−1), flash-freeze aliquots, and store at −80 °C.

  8. 8.

    eEF1A

    Streak the YAS2488 strain on a YPD plate and incubate for 2 days at 30 °C. Inoculate a preculture of 200 mL YPD media overnight in a shaker at 30 °C with 180 rpm. Inoculate 100 L YPD culture with the preculture at a starting OD600 of 0.1 and grow until mid-log phase in a bioreactor . Harvest the cells, wash the pellets with MilliQ water and suspend the cell pellets in 1 mL/g of cells in buffer 40. Prepare frozen cell droplets by dropping the lysate using a syringe or serological pipette in liquid nitrogen. Grind the cell droplets using an ultracentrifugal mill prechilled with liquid nitrogen. Collect the powder and store in −80 °C freezer. Thaw grinded yeast cell powder (~200 mL lysate in buffer 40) on ice and add one protease inhibitor tablet. Check the pH of the lysate and adjust it to pH 7.7 by adding dropwise untitrated 1 M Tris to avoid protein precipitation. Centrifuge the lysate at 180,800 × g for 1 h at 4 °C. Collect the supernatant and filter it through 1 μm glass fiber filters or equivalent. Connect HiTrap Q column on top of HiTrap SP column as a tandem and equilibrate with buffer 41. Load the lysate onto the columns in tandem. Disconnect HiTrap Q column and wash HiTrap SP column with buffer 41 (eEF1A will bind to HiTrap SP and most impurities will bind to HiTrap Q). Elute the protein from the HiTrap SP column with a linear gradient of buffer 42 from 0% to 100% over 30 mL. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eEF1A. Load eEF1A on a Hi Load 26/600 Superdex200 pg size-exclusion chromatography column preequilibrated with buffer 43. Collect 2 mL fractions, analyze on a 15% SDS-PAGE and pool the fractions containing eEF1A. Concentrate the eEF1A pool with a 10 kDa MWCO Vivaspin concentrator . Check the final concentration at the spectrophotometer (OD280, extinction coefficient 45,295 M−1 cm−1), flash-freeze aliquots, and store at −80 °C (see Note 3 ).

  9. 9.

    eEF2

    Streak eEF2 strain on a selective media (-LEU) plate and incubate for 2 days at 30 °C. Inoculate a preculture of 200 mL selective media (-LEU) overnight in a shaker at 30 °C with 180 rpm. Inoculate 100 L selective media (-LEU) with the preculture at a starting OD600 of 0.1 and grow until mid-log phase in a bioreactor . Harvest the cells, wash the pellets with MilliQ water and suspend the cell pellets in 1 mL/g of cells in buffer 44. Prepare frozen cell droplets by dropping the lysate using a syringe or serological pipette in liquid nitrogen. Grind the cell droplets using an ultracentrifugal mill prechilled with liquid nitrogen. Collect the powder and store in −80 °C freezer. Thaw grinded yeast cell powder (~200 mL lysate in buffer 44) on ice and add one protease inhibitor tablet. Check the pH of the lysate and adjust it to pH 7.7 by dropwise addition of untitrated 1 M Tris to avoid protein precipitation. Centrifuge the lysate at 18,900 × g for 20 min at 4 °C. Collect the supernatant carefully, it should be as clear as possible. Centrifuge a second time in ultracentrifuge at 235,418 × g for 1 h at 4 °C. Collect the supernatant and filter it through 1 μm glass fiber filters or equivalent. Equilibrate two HisTrap columns with buffer 44 and load the lysate onto the columns. Wash the columns with buffer 45. Elute the protein with 100% buffer 46. Collect 2 mL fractions, analyze on a 12% SDS-PAGE and pool the fractions containing eEF2. Load eEF2 on a Hi Load 26/600 Superdex200 pg size-exclusion chromatography column preequilibrated with buffer 47. Collect 2 mL fractions, analyze on a 12% SDS-PAGE and pool the fractions containing eEF2. Concentrate the pool of eEF2 using 30 kDa MWCO Vivaspin concentrator. Measure the final concentration at the spectrophotometer (OD280, extinction coefficient 74,300 M−1 cm−1), flash-freeze aliquots, and store at −80 °C (see Note 4 ).

3.3 In Vitro Hypusination of eIF5A

3.3.1 Purification of eIF5A Hypusination Enzymes Deoxyhypusine Synthase (Dys1 ) and Deoxyhypusine Hydroxylase (Lia1 ) (See Note 5 )

Coexpress the proteins from pQLinkH plasmid (His tag) in BL21 E. coli cells. Inoculate a preculture of 200 mL LB with 100 μg/mL carbenicillin and grow at 37 °C overnight. Next day, inoculate 6 L of LB with 100 μg/mL carbenicillin with the overnight preculture at a starting OD600 of 0.1 and grow it in a shaker at 37 °C with 180 rpm. Induce the expression with 0.5 mM IPTG at 0.8 OD600 and incubate at 37 °C for additional 4 h. Harvest the cells at 7000 rpm for 10 min at 4 °C. Resuspend the cell pellet in 3 mL/g buffer 48, add one protease inhibitor tablet and 100 μL of DNase solution. Homogenize the cell suspension on ice and use Emulsiflex to lyse the cells. Centrifuge at 180,800 × g for 30 min at 4 °C. Collect the supernatant and filter it through glass fiber filters or equivalent. Equilibrate two Protino Ni-IDA 2000 columns separately with buffer 48. Load the lysate over two tandem columns. Separate the columns and wash them with buffer 48. Elute each column with buffer 49 and collect 1 mL fractions in 1.5 mL Eppendorf tubes. Analyze the fractions on a 15% SDS-PAGE and pool the fractions containing Dys1 and Lia1 . Dialyze the pool against 2 L of buffer 50 overnight at 4 °C with stirring. Next day, perform a second dialysis with fresh 2 L of buffer 50 for 2–3 h at 4 °C. Concentrate the pool using a 10 kDa MWCO Vivaspin concentrator. Measure the final concentration at the spectrophotometer (OD280), flash-freeze aliquots, and store at −80 °C (see Note 6 ).

3.3.2 In Vitro Hypusination [14, 15]

This is performed in a two-step process. In the first step, the synthesis of deoxyhypusine is catalyzed by deoxyhypusine synthase Dys1 using the reaction described in Table 1.

Table 1 In Vitro Hypusination Step 1
Full size table

Mix components as indicated in Table 1 and incubate at 37 °C for 1 h. Exchange the buffer on a NAP-column equilibrated with buffer 51. Load the sample and collect the flow-through. Add 1 mL of buffer 51 and collect the eluent. Repeat the elution step once more. Analyze the eluents on a 15% SDS-PAGE and pool the fractions containing eIF5A.

In the second step, the deoxyhypusine hydroxylase Lia1 catalyzes the final step of hypusination.

Mix the components indicated in Table 2 and incubate at 37 °C for 2 h. Purify modified eIF5A from the enzyme mix using Protino Ni-IDA 2000 column. Equilibrate the column with buffer 52. Load the reaction sample and wash the column two times with 4 mL of buffer 52. Elute three times with 3 mL buffer 53 with a fraction size of 1 mL. Analyze the fractions on a 15% SDS-PAGE and pool the fractions containing eIF5A.

Table 2 In Vitro Hypusination Step 2
Full size table

Load eIF5A on a Superdex75 10/300 GL size exclusion chromatography column preequilibrated with buffer 52. Collect fractions of 250 μL, analyze on a 15% SDS-PAGE and pool the fractions containing eIF5A. Concentrate the pool using a 5kDA MWCO Vivaspin concentrator. Measure the final concentration at the spectrophotometer (OD280), flash-freeze aliquots, and store at −80 °C.

3.4 RNA Synthesis and Purification

Prepare initiator tRNA (tRNAi Met) by in vitro transcription using T7 RNA polymerase. A plasmid containing a 92 nucleotides-long DNA with the T7 promoter (underlined) and the initiator tRNA sequence was purchased from Eurofins.

5′TAATACGACTCACTATAAGCGCCGTGGCGCAGTGGAAGCGCGCAGGGCTCATAACCCTGATGTCCTCGGATCGAAACCGAGCGGCGCTACCA3′.

Amplify the DNA using the following forward and reverse primers for in vitro transcription .

Forward primer: 5′TAATACGACTCACTATAAGCGCCG3′.

Reverse primer: 5′TmGmGTAGCGCCGCTCGGTTTC3′ (see Note 2 ).

Perform in vitro transcription using the reaction components as described in Table 3:

Table 3 In Vitro Transcription Setup
Full size table

Purify the transcription product on a HiTrap Q column. Load the transcription product on a HiTrap Q column preequilibrated with buffer 57. Elute the product with a linear gradient from 0% to 100% buffer 58 over 120 mL. Collect 2.5 mL fractions, analyze on a 12% UREA-PAGE and pool the fractions containing tRNAi Met. Precipitate tRNAi Met by adding 1/10 volume of 200 mM KOAc pH 5 and 2.5 volumes of ice-cold ethanol at −20 °C overnight. The next day, centrifuge at 3901 × g for 60 min at 4 °C to pellet tRNAi Met. Dry and dissolve the pellet in water.

Perform the aminoacylation reaction at 37 °C for 30 min using the components indicated in Table 4.

Table 4 Aminoacylation Reaction Setup
Full size table

Quench the reaction by adding 1/10 volume of 200 mM KOAc pH 5. Extract Met-tRNAi Met by adding 1 volume of phenol (RNA grade) and collect the upper aqueous phase after 10 min centrifugation at 3901 × g at room temperature. Precipitate Met-tRNAi Met by adding 1/10 volume of 200 mM KOAc pH 5 and 2.5 volumes of ice-cold ethanol at −20 °C overnight. The next day, centrifuge at 3901 × g for 60 min at 4 °C to pellet Met-tRNAi Met. Dry and dissolve the pellet in water. Purify Met-tRNAi Met by HPLC using a LiChrospher WP 300 RP-18 (5 μM) reverse phase column preequilibrated with buffer 60. Load the product and elute with a linear gradient from 0% to 100% buffer 61 over 255 mL. Collect 3 mL fractions and count the radioactivity of each fraction. Pool the fractions containing radioactivity and precipitate as before. Finally, dissolve the pellet in water and measure concentration by dividing obtained [3H] radioactivity by the specific activity of [3H]-Methionine to obtain the pmol of methionine incorporated. Divide obtained pmol by the volume of water used to dissolve the final pellet to obtain the final concentration of [3H]Met-tRNAi Met [16].

Perform aminoacylation of individual tRNAVal and tRNAPhe using the components indicated in Table 4 with [14C]Valine or [14C]Phenylalanine, respectively. Purify aa-tRNA by HPLC as described for Met-tRNAi Met.

The mRNA used was purchased from IBA; the unstructured 5′ UTR is underlined, the initiation codon is indicated in bold and is followed by the valine and phenylalanine codons.

5′GGUCUCUCUCUCUCUCUCU AUGGUUUUUUCUCUCUCUCUC3′.

3.5 Nucleotide Binding and Dissociation Assay for eIF5B-397C and eEF1A

To monitor the nucleotide binding and dissociation ability of eIF5B-397C and eEF1A, we used a fluorescence change that is observed upon mant-GTP binding to and dissociation from eIF5B-397C or eEF1A [17]. The experiments were carried out in a stopped-flow apparatus. Fluorescence of mant was excited at 363 nm and measured after passing KV408 long-pass filters. We collected 5–7 individual traces for each experiment, averaged them and plotted against time.

For nucleotide binding assay, prepare 800 μL of 1 μM eIF5B-397C or 0.2 μM eEF1A and 800 μL of 1 μM mant-GTP in YT buffer (buffer 54). In a stopped-flow apparatus, rapidly mix the protein with mant-GTP solutions. Follow the time course of reaction for 10 s (eIF5B-397C) or 100 s (eEF1A) by monitoring the fluorescence change.

For nucleotide dissociation assay, incubate 0.2 μM eIF5B-397C or eEF1A with 5 μM mant-GTP in YT buffer (buffer 54) with 3 mM PEP and 1% PK, for 10 min at 26 °C. Prepare 800 μL of 1 mM GTP in YT buffer (buffer 54). In a stopped-flow apparatus, collect the traces over 10 s (eIF5B-397C) or 100 s (eEF1A) by rapidly mixing equal volumes of reactants and monitoring the time courses of fluorescence change.

3.6 eIF2–GTP–Met-tRNAiMet Ternary Complex Formation Assay

Incubate 4 μM eIF2 (2× over tRNA) in YT buffer conditions with 3 mM PEP, 1% PK, 1 mM DTT, 2 mM GTP for 10 min at 26 °C. Start the reaction by adding 2 μM of [3H]Met-tRNAi Met and incubate at 26 °C. Collect 10 μL samples before the addition of Met-tRNAi Met at (0 time) and after different incubation times points. Spot them on 0.2 μM nitrocellulose filters presoaked in YT buffer (buffer 54) and wash with 5 mL of YT buffer. Transfer the filters into a polyethylene scintillation vials, add 10 mL of Quickszint 361 (Zinsser Analytic) scintillation cocktail to each tube, mix well and count the radioactivity in a scintillation counter.

3.7 80S Initiation Complex Formation

3.7.1 Method 1: Size-Exclusion Chromatography

Prepare the ternary complex by incubating 4 μM of eIF2 with 3 mM PEP, 1% PK, 1 mM DTT, 1 mM GTP in YT buffer (buffer 54) in a 80 μL reaction volume for 10 min at 26 °C. Add [3H]Met-tRNAi Met to 2 μM and incubate for additional 5 min at 26 °C. Separately, prepare 80 μL of 48S IC by mixing 1 μM 40S subunits with 5 μM mRNA (5× over 40S ), 5 μM eIF1 (5× over 40S ), 2 μM eIF3 (2× over 40S ), 2.5 μM eIF1A (2.5× over 40S ), 2.5 μM eIF5 (2.5× over 40S ), 2 mM DTT, 0.25 mM spermidine, and 1 mM GTP in YT buffer. Incubate for 5 min at 26 °C. Add 1.5 μM 60S subunit (1.5× over 40S ) and 3 μM eIF5B (2× over 60S ) and incubate for additional 5 min at 26 °C. Mix the ternary complex to 48S IC and load on a Biosuite450 (WATERS) size-exclusion chromatography column preequilibrated by YT buffer (buffer 54) on a HPLC . Run the sample at 0.8 mL/min for 25 min in YT buffer (buffer 54) and follow the absorbance at 290 nm. Collect 0.5 min fractions (0.4 mL) and count the radioactivity for each fraction. Pool the fractions containing 80S IC, count the radioactivity, calculate the concentration (obtained [3H] radioactivity divided by the specific activity of [3H]-Methionine to obtain the pmol of methionine incorporated. Divide obtained pmol by the volume of 80S IC to obtain the final concentration), flash-freeze aliquots, and store at −80 °C.

3.7.2 Method 2: Sucrose Cushion Centrifugation

This method allows preparing larger quantities of complexes; all concentrations are doubled compare to Method 1. Prepare 500 μL of ternary complex by incubating 8 μM of eIF2 with 3 mM PEP, 1% PK, 1 mM DTT, 2 mM GTP for 10 min at 26 °C in YT buffer. Add 4 μM [3H]Met-tRNAi Met and incubate for additional 5 min at 26 °C. Separately, prepare 500 μL of 48S IC by mixing 2 μM 40S with 10 μM mRNA (5× over 40S subunits), 10 μM eIF-mix (mixture of initiation factors eIF1, eIF1A, eIF3, eIF5) (5× over 40S ), 2 mM DTT, 0.25 mM spermidine and 1 mM GTP in YT buffer (buffer 54). Incubate for 5 min at 26 °C, then add 3 μM 60S subunits (1.5× over 40S ) and 6 μM eIF5B (2× over 60S ) and incubate for 5 min at 26 °C. Mix the ternary complex with the 48S IC and adjust the MgCl2 to a final concentration of 9 mM to stabilize the 80S IC.

On ice, add 300 μL of 1 M sucrose (prepared in buffer 55 containing 9 mM MgCl2 (YT9 buffer)) into TLS-55 centrifuge tubes and carefully layer 1 mL of 80S IC reaction on top without disturbing the sucrose. Centrifuge in a TLS-55 rotor at 259,000 × g for 2 h at 4 °C. Invert the tubes to remove the supernatant and carefully wipe off excess of liquid without perturbing the pellet. Place the tubes on ice and dissolve the pellets in buffer 55 containing 9 mM MgCl2. Resuspend the pellet gently, count the radioactivity, calculate the concentration (as in Method 1), flash-freeze aliquots, and store at −80 °C.

3.8 Peptide Bond Formation Assay

Prepare the ternary complex eEF1A–GTP–[14C]Val-tRNAVal by incubating 1 μM eEF1A, 0.1 μM eEF1Bα, 3 mM PEP, 1% PK, 1 mM DTT, 0.5 mM GTP in YT buffer (buffer 54) for 15 min at 26 °C. Add 0.2 μM [14C]Val-tRNAVal (5 eEF1A:1 aa-tRNA ) and incubate for 5 min at 26 °C. Then add 2 μM modified eIF5A to the ternary complex. Separately, prepare 1 μM 80S IC in YT buffer containing 3 mM MgCl2 by diluting 80S IC by YT0 buffer (buffer 56). Mix equal volumes of 80S IC containing [3H]Met-tRNAi Met with the eEF1A–GTP–[14C]Val-tRNAVal ternary complex. After the desired incubation times quench the reaction by adding KOH to a final concentration of 0.5 M. Release the peptides by alkaline hydrolysis for 45 min at 37 °C, separate the reaction products by LiChrospher 100 RP-8 (5 μm) reversed-phase HPLC using buffer 62 and buffer 63, and quantified by double-label ([3H] and [14C]) radioactivity counting [17]. To form tripeptides, additionally prepare the eEF1A–GTP–[14C]Phe-tRNAPhe ternary complex by incubating 1 μM of eEF1A, 0.1 μM of eEF1Bα, 3 mM PEP, 1% PK, 1 mM DTT, 2 mM GTP for 15 min at 26 °C, in YT buffer (buffer 54). After incubation add 0.2 μM of [14C]Phe-tRNAPhe (5 eEF1A:1 aa-tRNA ) and incubate for additional 5 min at 26 °C. Then add 1 μM eEF2 and 4 μM eEF3 to ternary complex. Mix equal volumes of ribosomes containing dipeptidyl-tRNA with the ternary complex. After the desired incubation times, quench the reaction and analyze the peptide products as described above for the dipeptides.

4 Notes

  1. 1.

    eIF5A contains the uncommon amino acid hypusine, which is derived from lysine in two modifying steps (deoxyhypusine synthase and deoxyhypusine hydroxylase ).

  2. 2.

    Use fresh plates; plates older than 2 weeks result in decreased ribosome yields.

  3. 3.

    eEF1A is sensitive to freezing and thawing as it loses activity. Prepare small aliquots.

  4. 4.

    Do not concentrate eEF2 above 100 μM to avoid precipitation and activity loss.

  5. 5.

    Tm and Gm are 2′-O methylated nucleotides to reduce the occurrence of 3′ heterogeneity due to the addition of nontemplated nucleotides by T7 polymerase.

  6. 6.

    The purification of these proteins does not require the use of an FPLC system.