Background

Nuclear genomes of higher plants are composed of coding and regulatory sequences and substantial amounts of repetitive DNA [including e.g. (retro) transposable elements and tandemly repeated DNA] that are considered to play important roles in genome differentiation, dynamics and evolution [1,2,3,4]. Repetitive DNA contributes to the diversity of genome sizes encountered in plants [5,6,7]. Satellite DNA (Sat) constitutes highly amplified tandemly repeated sequences, that can vary in abundance, sequence and chromosomal distribution between species [7,8,9,10,11,12,13,14,15,16]. Often it occurs in heterochromatic, peri-centromeric or sub-telomeric regions of the chromosome, but it can also be in found in interstitial regions. Because of the dynamic nature of the organization and distribution of these types of repeats, the characterization of satellite DNA is particularly useful for chromosome identification and for reconstruction of patterns of species divergence [13, 17,18,19,20,21,22].

Paphiopedilum (Orchidaceae: Cypripedioideae) is the most diverse genus of terrestrial slipper orchids, containing about 80 species, nearly all of which are rare and threatened [23]. The genus consists of seven subgroups, comprising three subgenera (Parvisepalum, Brachypetalum and Paphiopedilum) and five sections in subgenus Paphiopedilum (Paphiopedilum, Cochlopetalum, Coryopedilum, Pardalopetalum and Barbata) based on morphological, cytological and molecular phylogenetic data [24,25,26,27,28]. Patterns of speciation in some sections are complex and potentially involve recurrent patterns of interspecific hybridization, arising from the redistribution of taxa with changing sea levels across South East Asia during the glacial cycles of the late Cenozoic [28, 29].

The genus is characterized by considerable chromosome number variation (2n = 26–42) and a relatively wide range of genome sizes (2.2-fold, 1C = 16.5–35.9 pg, mean 1C = 25.4 pg) [27]. Previous cytological studies have suggested that Robertsonian translocations have contributed to the diversity of chromosome numbers observed between Paphiopedilum species, involving the fission of metacentric chromosomes at or near the centromere to generate telocentric chromosomes [30,31,32,33,34,35,36,37]. In addition, it is clear from more recent cytological studies that other types of complex chromosomal rearrangements (e.g. inversions and duplications) may also have contributed to the karyotypic diversity observed [38].

Little is known about the composition, diversity and evolutionary dynamics of repetitive DNA sequences in the genomes of Paphiopedilum species. In a study of ribosomal DNA (rDNA) sequence evolution by Lan and Albert [38], no clear relationships were uncovered between the number of rDNA signals, chromosome number and genome size. Duplications of the nuclear 45S rDNA locus occurred independently in subgenus Parvisepalum and sections Coryopedilum and Pardalopetalum of subgenus Paphiopedilum, whereas duplications of 5S rDNA loci were only observed in subgenus Paphiopedilum.

Recently, with developments in high-throughput sequencing approaches, non-model species have become more amenable to in-depth analyses of the repetitive DNA component of their genomes [7, 39, 40]. Even for species with large genomes (1C > 10 Gbp), it is possible to gain insights into the types, amounts, diversity and evolution of the most abundant repetitive elements using low-coverage sequencing data [14, 15, 41,42,43,44,45,46,47].

In this study, we use low-coverage genomic DNA sequence data from the Illumina next-generation sequencing platform to characterize the satellite DNA component of seven Paphiopedilum species, selected to represent the phylogenetic diversity of the genus. We undertook an in-depth analysis of the most abundant satellite DNA identified in the genus, which was identified in P. armeniacum. This species belongs to subgenus Parvisepalum, a lineage that is considered to have diverged from the rest of Paphiopedilum early in the evolution of the genus. In addition, we examined the chromosomal distribution of SatA in closely related species of subgenus Parvisepalum and representative species belonging to the other two subgenera, to provide a phylogenetic perspective of its distribution and evolution across the genus. Finally, we explored the utility of SatA as a chromosomal marker for characterizing karyotype evolution in species belonging to subgenus Parvisepalum.

Results

Phylogenetic relationships in Paphiopedilum subgenus Parvisepalum

Nuclear ribosomal ITS sequences were used to reconstruct phylogenetic relationships of the seven Paphiopedilum species belonging to subgenus Parvisepalum (Additional file 1: Fig. S1). The analysis re-confirmed the monophyly of the subgenus and resolved P. vietnamense as sister to the other species (bootstrap = 93%; PP = 1). In addition, two clades within the subgenus were recovered with strong to moderate support, the first consisting of P. hangianum and P. emersonii (bootstrap = 93%; PP = 1) and the other comprising P. armeniacum, and P. malipoense, (bootstrap = 69%; PP = 0.97). However, relationships between these clades and the two remaining species of the subgenus, i.e. P. delenatii and P. micranthum, remained unresolved.

Satellite DNA identification and characterization

Using RepeatExplorer to individually cluster the Illumina HiSeq data for seven Paphiopedilum taxa (corresponding to between c. 0.84 and 7.6% of the genome depending on the taxon, Additional file 2: Table S1), we identified four distinct types of satellite DNA (SatA, SatB, SatG, and SatJ) based on the shape of the output graphs. The abundance of each repetitive DNA type varied between species (Table 1), with none containing all four satellites. The amount of satellite DNA was also estimated for the sister genus Phragmipedium, in which only SatG was identified, occurring in low abundance (0.04%) in the P. longifolium genome.

Table 1 Major types of repetitive DNA in Paphiopedilum
Full size table

SatA appeared to be specific to subgenus Parvisepalum, and it accounted for 14.4% of the P. armeniacum genome (Table 1). In contrast, SatB was found in all Paphiopedilum subgroups, ranging from 0.1% in P. armeniacum and P. concolor (subgenus Parvisepalum and section Brachypetalum, respectively) to 7.5% in P. lowii (section Pardalopetalum), although it was absent in the outgroup P. longifolium. SatG was found in both Phragmipedium and most Paphiopedilum species analysed with the exception of P. armeniacum (subgenus Parvisepalum) and P. concolor (subgenus Brachypetalum), in which it appears to have been lost or to be present in amounts below the threshold of detection used here. SatJ was found exclusively in just two sections of subgenus Paphiopedilum, comprising 2.5 and 1.8% of the P. villosum (section Paphiopedilum) and P. appletonianum (section Barbata) genomes, respectively (Table 1).

Characterization of SatA in subgenus Parvisepalum

The characteristics of the top four most abundant SatA monomers in P. armeniacum are summarized in Additional file 3: Table S2 and Additional files 4, 5 and 6: Figs. S2-S4. All have high AT content (c. 66%) and contain multiple, often long stretches, of inverted repeat regions which form multiple hairpin loop motifs interspersed with unpaired bases (Additional file 4: Fig. S2). The largest (359 bp) monomer (CL1_965) is made up of three highly similar 146, 146 and 67 bp long repeat subunits (Additional file 6: Fig. S4) and is the most abundant high BLAST similarity hit in an all-to-all sequence comparison to nearly 50% of all SatA reads. The remaining three monomers (CL1_940, CL1_393 and CL1_886) are distinct from CL1_965. They ranged in length from 235 to 307 bp and possessed high sequence similarity (above 90%) to each other and as such can be aligned easily.

Chromosomal organization of SatA and rDNA

SatA distribution patterns

The physical locations of long (> 1000 bp = the lower threshold of FISH sensitivity) [48] stretches of SatA sequence were visualized using FISH and showed that SatA hybridized to all species of subgenus Parvisepalum (Fig. 1). In contrast, none of the representative species belonging to the other subgenera or sections of Paphiopedilum had any hybridization signal. Both 45S and 5S rDNA probes hybridized to the same chromosome preparations (Fig. 2).

Fig. 1
figure 1

Fluorescent in situ hybridization (FISH) of root tip metaphase chromosomes of species belonging to subgenus Parvisepalum with the SatA (red), 45S (green) and 5S (white) rDNA probes, counterstained with DAPI (blue): (a) P. armeniacum, (b) P. malipoense, (c) P. emersonii, (d) P. hangianum, (e) P. micranthum, (f) P. delenatii, (g) P. vietnamense. Bar = 10 μm

Full size image
Fig. 2
figure 2

Fluorescent in situ hybridization (FISH) of root tip metaphase chromosomes with the SatA, 45S (green) and 5S (white) rDNA probes, counterstained with DAPI (blue): (a) P. concolor (subgenus Brachypetalum), (b) P. villosum (section Paphiopedilum), (c) P. rothschildianum (section Coryopedilum), (d) P. lowii (section Pardalopetalum), (e) P. appletonianum (section Barbata), and (f) P. primulinum (section Cochlopetalum). The absence of FISH signals confirms that SatA is indeed specific to subgenus Parvisepalum. Bar = 10 μm

Full size image

Species of Paphiopedilum subgenus Parvisepalum have 2n = 2× = 26 (except for P. vietnamense, 2n = 2× = 28), with mostly metacentric or sub-metacentric chromosomes. However, despite this apparent karyotypic uniformity, the hybridization pattern of the SatA probe was seen to differ considerably between species (Fig. 3). Thus to compare the physical distribution of the SatA hybridization sites in a phylogenetic context, karyotypes (Fig. 3) and ideograms (Fig. 4) of all seven species were prepared and arranged according to the nrITS phylogenetic tree. The arrangement of the chromosomes shown in these figures assumes that the SatA and rDNA signals are most likely carried on homologous chromosomes in the most closely related species, using approaches developed in Lim et al. [49] (Figs. 3 and 4).

Fig. 3
figure 3

Fluorescent in situ hybridization of karyotypes of Paphiopedilum subgenus Parvisepalum with the SatA (red), 45S (green) and 5S (white) rDNA probes, counterstained with DAPI (blue). Phylogenetic relationships between these species shown on the right-hand side of the figure (see also Additional file 1: Fig. S1)

Full size image
Fig. 4
figure 4

Ideograms of somatic metaphase chromosomes of species belonging to subgenus Parvisepalum.SatA (red), 45S (green) and 5S (white) rDNA signals

Full size image

The greatest abundance of SatA signals (which broadly reflects the genome proportion of 14.4% estimated by RepeatExplorer; see Table 1) was found in P. armeniacum, where all chromosomes had at least one site of SatA sequences. The signals were mainly located in the centromeric (defined here to include both the centromere and peri-centromeres) and sub-telomeric regions, although the precise position, strength and frequency of signals varied between chromosomes. Broadly similar patterns were also observed in P. malipoense. In contrast, clear SatA signals in P. hangianum and P. emersonii were only found in the centromeric regions of about half the chromosomes. For the remaining species analysed, both centromeric and sub-telomeric SatA signals were detected on at least some of the chromosomes, although the exact position, and strength of signal differed between species. Overall, the most abundant and intense centromeric and sub-telomeric SatA signals were observed in P. armeniacum and P. malipoense, whereas the weakest signals were found in P. vietnamense (Fig. 1).

By arranging karyotypes in a phylogenetic framework as predicted from nrITS sequence data (Fig. 3), the distribution of the SatA sequences is more similar in closely related species than more distantly related species, as illustrated by the following examples. (1) The distribution of the SatA sites in P. armeniacum were broadly similar to those in P. malipoense to which it is closely related. Nevertheless, although SatA sites were detected in centromeric and sub-telocentric regions of all eight chromosome pairs in P. malipoense, six chromosome pairs lacked prominent SatA signals in the centromeric region. These strong SatA signals coincided with heterochromatic bands seen by DAPI staining (data not shown) which became apparent after the denaturation step of the FISH protocol. (2) P. emersonii and P. hangianum are closely related sister species and both possessed SatA sites primarily in the peri-centromeric region. Nevertheless, in P. hangianum, the SatA signals co-localized exclusively with the heterochromatic bands in the centromeric region of six chromosome pairs, whereas in P. emersonii, SatA signals were restricted to the centromeric regions of just eight chromosome pairs, despite heterochromatic bands being present in the centromeric region of all chromosomes (data not shown).

In contrast to these species, P. delenatii showed only weak SatA signals in the peri-centromeric, sub-telocentric and interstitial regions. The distribution of SatA and rDNA signals in P. vietnamense is highly distinctive in comparison with the other species. In P. micranthum, multiple strongly dispersed interstitial signals across several chromosomes were observed. In addition, several hemizygous sub-telomeric SatA signals, including one which spanned almost the entire length of one chromosome, were found in P. micranthum (Figs. 1e, 3 and 4).

rDNA distribution patterns

The 45S and 5S rDNA sequences in Paphiopedilum subgenus Parvisepalum were consistently localized in sub-telomeric positions although the number and strength of signals varied between species (Figs. 1 and 3, Table 2). All species had at least one pair of chromosomes with co-localized 45S + 5S rDNA sites (see ideograms in Fig. 4). In P. micranthum and P. delenatii (Figs. 1e and f), no further 45S or 5S rDNA sites were detected, whereas P. armeniacum, P. emersonii and P. hangianum (Figs. 1a, c and d) had an additional chromosome pair with 45S rDNA signals in sub-telomeric positions. The most distinctive pattern was observed in P. vietnamense (Fig. 1g); in addition to the pair of chromosomes with co-localised 45S + 5S rDNA sites, three chromosome pairs had 45S rDNA sites in sub-telomeric regions. Two of these pairs of 45S rDNA signals were of much higher intensity and located on large chromosomes in contrast to the 45S rDNA signals of other species which were all located on smaller chromosomes and were much less intense.

Table 2 SatA and rDNA signals in seven species of Paphiopedilum subgenus Parvisepalum
Full size table

Discussion

Global satellite repeat composition in Paphiopedilum

The analysis of satellite DNAs across an ever-increasing diversity of plants has shown that there is considerable diversity in sequence composition, diversity, organization, abundance and evolution [4, 6, 15]. Here we have taken advantage of high-throughput sequencing approaches and the bioinformatic pipeline RepeatExplorer to provide insights into the most abundant satellite DNA repeats (i.e. comprising ≥0.01% of the genome) across the seven subgenera/sections of the slipper orchid genus Paphiopedilum. As with some plant genomes analysed to date, e.g. Silene latifolia [50], the diversity of satellites identified was low, with only four major satellite types identified. Nevertheless, this contrasts with other plant genomes where a considerably greater diversity has been reported. For example, 51 different satellites were identified in Vicia peregrina [15] and up to 54 types, each comprising > 0.01% of the genome, were identified in Luzula elegans [45, 51].

Many plant satellites have been shown to be species-specific (e.g.in Fabeae, [15]), indicative of relatively rapid sequence divergence rates compared with speciation rate. However, this was not the case in Paphiopedilum, in which all four satellites were observed to be more widely distributed, either between more than one species in a subgenus (SatA) or between sections (SatJ), subgenera (SatB) or genera (SatG). The contribution of these four satellites to the whole genome varied considerably between species analysed, from just 0.13% of the genome in P. concolor (subgenus Brachypetalum) to 14.39% in P. armeniacum (subgenus Parvisepalum) (Table 1). In addition, there was no evidence of a clear correlation between satellite abundance and genome size. For example, both P. concolor (23.1 pg/1C) and P. armeniacum (22.8 pg/1C) have similar genome sizes, but the lowest and highest percentage of the genome comprising satellite DNAs of the species investigated (Table 1 and Additional file 2: Table S1). Such a situation has been observed in similar analyses in other groups [14, 15] in which it is generally transposable elements, particularly retrotransposons such as certain Ty1/Copia and Ty3/Gypsy elements, which correlate most closely with genome size [5, 15, 52, 53].

Analysis of SatA: The most abundant satellite in Paphiopedilum

Plant genomes are often dominated by just one or a few repeats which have amplified to high copy number. Typically the most abundant repeats are retrotransposons. For example, the Ty3/Gypsy Ogre elements have been shown to comprise 54% of the genome of Vicia faba [15], whereas Ty3/Gypsy Gorge3 elements contribute up to 34% of the Gossypium exiguum genome [52]. Nevertheless, there are also examples in which satellites have contributed to a substantial proportion of the genome. For example, the VicTR-B satellite repeat represents about 25% of the Vicia sativa genome [54], whereas the FriSAT1 repeat accounts for up to 11% of the Fritillaria affinis genome [14], and the PaB6 repeat represents about 10% of the Prospero autumnale cytotype B6B6 genome [55]. In Paphiopedilum, the most abundant satellite DNA is SatA (Table 1) which is estimated to comprise c.14.39% of the P. armeniacum genome and is specific to subgenus Parvisepalum (Figs.1 and 2).

Origin, evolution and organization of SatA in subgenus Parvisepalum

Characterization of SatA in Paphiopedilum subgenus Parvisepalum revealed just four (or conservatively two if CL_940, 393 and 886 are considered to be minor variants of a single sequence) primary monomers which have no homology to any satellite DNA sequences identified in other subgenera or sections of Paphiopedilum, the sister genus Phragmipedium or other plant genomes published to date. However, given that satellite DNA sequences are known to diverge rapidly and that subgenus Parvisepalum may have diverged from the rest of Paphiopedilum only c. 20 Mya [28], it is likely that SatA clusters arose independently in the lineage leading to subgenus Parvisepalum. The arrangement of the SatA and rDNA sites in P. vietnamense is highly distinctive in comparison with the other species. If P. vietnamense is sister to the rest of the subgenus, as indicated by ITS sequence divergence, then the distribution patterns in this species maybe either an apomorphic or plesiomorphic character state, or indeed a mixture of both character states, depending on the specific chromosomal signal.

Since the origin of SatA, there have clearly been considerable changes in its abundance and chromosomal distribution between the different species comprising subgenus Parvisepalum. However, despite this variability, most signals occur at peri-centromeric or sub-telocentric regions of the chromosome, as is typical of many satellites [22]. When the distribution patterns are considered in a phylogenetic context (Figs. 3 and 4), it is apparent that the most closely related species carry the most similar satellite DNA distributions and that the distribution of satellites carries a strong phylogenetic signal.

The plethora of hemizygous interstitial sites in P. micranthum indicates rapid divergence of SatA within a species, perhaps associated with genetic drift in local populations and some gene flow between populations. Further studies of P. micranthum at the population level are clearly needed to provide deeper insights into satellite DNA proliferation in this species.

Organization of rDNA sites in subgenus Parvisepalum

Previous studies of the organization of rDNA sequences in Paphiopedilum have suggested that the ancestral state for the genus is two 45S and two 5S rDNA sites [38]. Although the number of 5S rDNA sites was observed to be maintained throughout subgenus Parvisepalum, in our study we found that the number of 45S rDNA sites varied from one to eight (Table 2, Fig. 4), in contrast to the range from two to four previously reported [38]. Indeed, the P. delenatii, P. micranthum and P. malipoense 5S and 45S rDNA FISH profiles in this study (Figs. 1b, e and f, Table 2) differed from those of Lan and Albert [38], which suggests that there may well be intraspecific rDNA site number variation in these species.

Ancestral chromosome number of Paphiopedilum

The new karyotype of P. vietnamense, with 2n = 28, metacentric chromosomes reported here (Figs. 3 and 4), expands the chromosome number range for subgenus Parvisepalum, which was previously considered to be conserved at 2n = 26. Prior to this study, 2n = 28 was only reported for P. hookerae and P. sangii which both belong to section Barbata [36, 56]. Previously it was suggested that Paphiopedilum had an ancestral chromosome number of 2n = 26 comprising metacentric chromosomes [57]. However, confidence in this number is dependent on the precise placement of P. vietnamense in phylogenetic trees for the genus. If P. vietnamense is sister to the rest of subgenus Parvisepalum, as suggested from the nrITS sequence data (Additional file 1: Fig. S1), then the ancestral chromosome number of subgenus Parvisepalum could be 2n = 26 or 28. However, if P. armeniacum is sister to the rest of the subgenus, as suggested by plastid DNA sequences [28], then 2n = 26 is the most likely ancestral chromosome number of the subgenus. Given that 2n = 26 or 2n = 28 are both possible ancestral chromosome numbers for subgenus Parvisepalum, and because subgenus Parvisepalum is sister to the rest of Paphiopedilum [28], the ancestral chromosome number of the genus itself could also be 2n = 26 or 2n = 28. Chromosome numbers from other genera in Cypripedioideae do not support one the alternatives above the other, although perhaps they point most strongly towards an ancestral chromosome number of 2n = 26 for Cypripedioideae. This is because the sister genera Phragmipedium and Mexipedium are together sister to Paphiopedilum and they have chromosome numbers of 2n = 18–30 for Phragmipedium and 2n = 26 for Mexipedium (a monotypic genus) (Chromosome counts database, http://ccdb.tau.ac.il/search/Phragmipedium/). However, we do not currently know how the range of chromosome numbers of Phragmipedium species are distributed across the phylogenetic tree for the genus and without that we cannot readily determine the ancestral number of Phragmipedium and Mexipedium. Thus, in determining the chromosome ancestry of Paphiopedilum, we need greater clarity of the phylogenetic placement of P. vietnamense and of the evolution of chromosome numbers in Phragmipedium.

Conclusion

We identified and characterized a new satellite repeat, SatA from P. armeniacum using the RepeatExplorer pipeline to analyse HiSeq Illumina reads. SatA is specific to subgenus Parvisepalum but absent from the other two subgenera in Paphiopedilum. Since the distribution pattern of SatA on chromosomes in subgenus Parvisepalum is species-specific and hence rapidly evolving, and possesses a strong phylogenetic signal, it is an ideal probe that could be used as a chromosomal marker for characterizing karyotype evolution in species belonging to subgenus Parvisepalum. Nevertheless, greater certainty is needed on the phylogenetic placement of P. vietnamense, as this will help to shed light on the ancestral karyotype and chromosome number of the genus. Certainly, it is recognized that the currently available phylogenetic data for Paphiopedilum is limited and could be greatly enhanced by the application of phylogenomic and bioinformatic approaches, involving multiple genes, repeats or even whole genomes, to generate robust species trees and phylogenetic insights of the genus.

Methods

Plant materials

Details of the origin of plant materials used for Illumina sequencing, fluorescent in situ hybridization (FISH), and genome size estimations and the location of the voucher specimens are given in Additional file 7: Table S3. All other nrITS sequences used in the phylogenetic analysis were downloaded from GenBank.

Genome size estimation using flow cytometry

Flow cytometry (FCM) was used to determine the genome sizes of each studied species and estimate the volume of Illumina sequence DNA required to characterize the repetitive fraction of the genome (see below). Samples for FCM were prepared as in Ebihara et al. [58] with slight modifications. Briefly, c. 1 cm2 of leaf material of the Paphiopedilum sample was co-chopped with the reference standard Vicia faba ‘Inovec’ (2C = 26.9 pg, [59]) in 2.0 mL of Ebihara buffer [1.0% Triton X-100, 140 mM 2-mercaptoethanol, 50 mM Na2SO3, 50 mM Tris-HCl (pH 7.5), 40 mg/mL polyvinyl-pyrolidone (PVP-40) and 0.1 mg/mL ribonuclease] on ice in a fume hood. The resulting slurry was incubated for 5 min on ice and filtered through a 30-μm nylon mesh (Partec) into a 2.0-mL tube and the nuclei were subsequently stained with 100 μL propidium iodide (1 mg/mL). The filtrate was incubated for 15 min at 37 °C and then left on ice for c. 30 min. Genome sizes were measured on a PartecCyflow SL3 flow cytometer (Partec GmbH, Münster, Germany) fitted with a 100 mW green solid state laser (532 nm, Cobolt Samba, Solna, Sweden). As many orchids, Paphiopedilum presents endoreplication [60] and we had to run the samples longer than usual to recover 1000 nuclei in the 2C peak of G1-phase for Paphiopedilum. Three measurements were made for each sample. The output histograms were analysed with the FlowMax software v.2.4 (Partec GmbH).

High-throughput sequencing of genomic DNA

Total genomic DNA was isolated from young leaf samples using DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Paired-end sequencing (2× 100 bp or 2 × 125 bp, 300–500 bp insert size) of total genomic DNA was performed using Illumina HiSeq 2000 (Illumina, Inc.) at Genomics BioSci & Tech. Co., Ltd., Taipei, Taiwan and using a HiSeq 2500 at BGI, Hong Kong and Service XS, Leiden, The Netherlands, based on libraries made by the service providers.

Processing of Illumina HiSeq data

The quality of the raw reads was assessed by Fast QC v0.10.1. Raw reads were trimmed and quality-filtered with a FASTX-Toolkit v 0.013 to give 90-bp length reads with 90% of bases having a minimum Phred score of 20. To remove sequences of organellar origin, custom Perl scripts and the stand-alone version of BLAST v2.2.16 [60] were used to screen the quality-filtered reads against a custom database containing the draft plastid genome of Phragmipedium longifolium (unpublished data provided by Dr. W. Mark Whitten, University of Florida, USA) and the published mitochondrial genomes of ten monocots (taken from GenBank). Parameter settings used for BLASTN [61] searches were: -v 1 -G 0 -E 2 -K 0 -b 0 - e 0.000001 -F mL. Sequences with similarity matches to the database (E-value ≤19 × 10− 6) were removed. All remaining reads were considered to be of nuclear origin and uploaded to RepeatExplorer (http://www.repeatexplorer.org) within the Galaxy server environment, as described in Dodsworth et al. [62]. Nuclear reads were paired using the FASTQ interlacer tool implemented in RepeatExplorer [63, 64]. Overlapping read pairs, which are caused by the presence of overly short genomic DNA fragments in the sequence library, can adversely affect the subsequent RepeatExplorer clustering analysis. Consequently, they were removed using a RepeatExplorer utility (minimum overlap = 30 nt, maximum mismatch per 100 bp = 1, offset = 5).

Clustering and annotation of satellite DNA with RepeatExplorer (RE)

The RepeatExplorer pipeline runs a graph-based clustering algorithm [63, 64] to assemble the groups of frequently overlapping reads into clusters of reads, each representing a repetitive element, or part of a repetitive element with a higher order genome structure. Similarity- and structure-based repeat identification tools in RepeatExplorer aid the identification of the repeats. RepeatExplorer uses a BLAST threshold of 90% similarity across 55% of the read to identify reads to each clusters (minimum overlap = 55, cluster threshold = 0.01%, minimum overlap for assembly = 40), and the clusters are identified based on a principle of maximum modularity.

To identify major shared and unique repetitive elements between Paphiopedilum species, comparative clustering analysis was performed on a combined dataset comprising Illumina sequence reads from seven Paphiopedilum species representing each of the seven major Paphiopedilum subgroups, and Phragmipedium as an outgroup (see Additional file 2: Table S1). For each taxon, the number of HiSeq Illumina reads analysed in RepeatExplorer was scaled according to the genome size of the species, so that the same proportion of the genome (2%) was analysed in each case. To provide greater insights into the characteristics of individual repetitive elements identified in repeat clusters, these eight HiSeq samples were also analysed in RepeatExplorer individually. For that we used the highest possible number of reads that can be readily handled by the software (Additional file 2: Table S1). Preliminary runs of RepeatExplorer indicated that the P. armeniacum sample contained a high (> 10%) proportion of satellite DNA. Large repeat clusters containing many sequence reads, and identified as comprising tandem repeats (e.g. satellites) can be problematic in RepeatExplorer analysis as they consume high amounts of computing resources and so reduce the number of sequences that can be handled by the pipeline. Consequently, prior to clustering, the reads were subjected to a custom sequence filter (containing a database of 617 of the most abundant sequence contigs from the satellite SatA, see below) to remove 90% of the satellite sequences, as recommended by the developers of RepeatExplorer. Clusters were identified manually as described in Novák et al. [64] by scanning read similarity hits to the RepeatMasker [65] database, visual examination of graphs and the location of cluster mates. Only clusters with genome proportions (GP) > 0.01% were included in subsequent analyses.

Characterization of the most abundant satellite repeat in Paphiopedilum

The structural features of the top four monomers of the most abundant satellite repeat identified by RepeatExplorer (SatA) were characterized using DOTTER [66] and the Vienna RNA fold tool implemented in Geneious v. 9.0.5 [67]. Sequence homology was checked against other Paphiopedilum satellites and by BLAST against published satellite DNA sequences in PlantSat (http://w3lamc.umbr.cas.cz/PlantSat/) [68].

PCR amplification, cloning and sequencing of SatA

The consensus sequence of the SatA monomer was used to design oligonucleotide primers (CL3C37-F:CATTTTCAACGTCGAGCC; CL3C37-R:AGACAAATTCTAAGCTATATGGAC; PCR product 147 bp) for amplifying the SatA monomers from genomic DNA of P. armeniacum. The amplification was performed in a reaction volume of 20 μl using the KAPA HiFi HotStart PCR kit (KAPA Biosystems) in a Takara thermal cycler (Takara Bio, Shiga, Japan), and the reaction mixture contained 1× KAPA HiFi buffer, 0.3 mM each dNTP, 0.3 μM each primer, and 1unit KAPA HiFi HotStart DNA polymerase. The amplification profile included an initial step at 94 °C for 3 min, followed by 35 cycles of 94 °C for 15 s, 50 °C for 15 s, and 72 °C for 5 s, and finally a 1 min final extension at 72 °C. DNA was cloned using the T&A cloning vector system (Yeastern Biotech Co., Ltd., Taiwan) and DH5α competent cells (Genomics BioSci & Tech. Co., Ltd., Taiwan) following the manufacturer’s instructions.

Chromosome preparation

Chromosome preparations for FISH were made according to the methods of Chung et al. [69] with minor modifications. Briefly, young, healthy root tips were harvested and pretreated in 2 mM 8-hydroxyquinoline at 18 °C for 5 h to accumulate metaphase nuclei, rinsed with distilled water and then fixed in freshly prepared Farmer’s fluid (3:1 ethanol:glacial acetic acid). Root tips were macerated with 6% cellulose (Onozuka R-10, Yakult Honsha, Japan) and 6% pectinase (Sigma Chemical Co., St. Louis, Mo.) in 75 mM KCl, pH = 4.0 at 37 °C for 90 min, and squashed on a microscope slide in the same fixative. Slides were air-dried and stored at − 80 °C until required.

Fluorescent in situ hybridization

The FISH procedure followed that described in Lee et al. [70]. The SatA probe was designed from a conserved region of the SatA monomer alignment and labeled with digoxigenin using oligonucleotide-5′-end-labeling (AAATCTGACCTAATTTGGACCCAATCTTTGAACCTTCTAATTGAAGGTCAATTGGTGT). Probes for 45S rDNA (pTA71 containing a repetitive unit of 45S rDNA from Triticum aestivum) [71] and 5S rDNA (pTA794 containing the 5S rDNA repeat unit from T. aestivum) [72] were also used. The rDNA sequences were labeled by nick translation with digoxigenin-11-dUTP orbiotin-16-dUTP (Roche Diagnostics GmbH, Penzberg, Germany). Digoxigenin-labeled probes were detected by anti-digoxigenin-rhodamine (Roche Diagnostics GmbH), whereas biotin-labeled probes were detected using fluorescein isothiocyanate (FITC)-conjugated avidin (Vector Laboratories, Burlingame, CA, USA). Chromosomes were counterstained with 4′, 6-diamidino-2-phenylindole (DAPI) in an anti-fade solution (Vector Laboratories, CA, USA). All images were captured digitally using a CCD camera attached to an epifluorescence microscope (Axioskop 2, Carl Zeiss AG, Germany). The CCD camera was controlled by Image-Pro Plus software (version 4.5.1, Media Cybernetics, Yorktown, VA, USA), and final image adjustments were made with Adobe Photoshop CS2 (version 9.0.2, Adobe Systems Inc., San Jose, CA, USA).

Analysis of phylogenetic relationships in Paphiopedilum

DNA was extracted from each sample using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). The nrITS regions, which include ITS1, ITS2 and the 5.8S nuclear rRNA gene, were amplified by PCR with the primer combinations of Sun et al. [73] and White et al. [74] and Sanger sequenced as described in Chochai et al. [27]. PCR products of P. emersonii were difficult to sequence directly and thus were cloned using the pGEM-T Vector System II (Promega, Madison, WI, USA). This yielded five distinct nrITS sequences which were verified using a BLAST search against the NCBI sequence database (National Center for Biotechnology Information, GenBank). GenBank accession numbers (http://www.ncbi.nlm.nih.gov) of nrITS sequences were listed in Additional file 8: Table S4.

Phylogenetic relationships between the seven Paphiopedilum species comprising subgenus Parvisepalum were analysed using the newly generated nrITS sequences together with those downloaded from GenBank for representative species of the other subgenera/sections of Paphiopedilum and with Phragmipedium besseae and P. longifolium as outgroup species. Sequences were aligned using CLUSTALW [75] implemented in Geneious v.9.0.5 and checked by eye. Phylogenetic relationships were analysed using a model-based Bayesian approach with MrBayes 3.2.1 [76]. The ‘best-fit’ model of evolution was selected under the Akaike information criterion test [77] as implemented in MrModel test 2.2 [78]. The general time reversal plus invariant rates and a gamma distribution (GTR + I + Γ) model was selected for the analyses. Two separate runs of four Monte Carlo Markov chains (MCMC; Yang and Rannala [79]) were performed for 10,000,000 generations until the mean deviation of split frequency dropped below 0.01, and a tree was sampled every 1000th generation. Trees from the first 25% of generations were discarded using the “burn-in” command, and the remaining trees were used to calculate an all-compatible consensus topology and posterior probability (PP) values for individual branches. The alignment datasets were further analysed using maximum parsimony (MP) in PAUP* version 4.0b10 [80]. Support for groups was evaluated using the bootstrap method [81] with 1000 replicates. The trees obtained in these analyses were drawn with the TreeGraph 2 software [82].