CB₁ receptor density and CB₁ receptor-mediated functional effects in rat hippocampus are decreased by an intracerebroventricularly administered antisense oligodeoxynucleotide

Abstract.

We have studied (i) the effect of antisense oligodeoxynucleotides complementary to CB₁ mRNA on the CB₁ receptor binding in hippocampus, striatum and cerebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB₁ receptor-mediated effects.

Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (AS1; GCCATCTAGGATCGACTT) and –8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were used. The dissociation constant (K_D) of rat CB₁ cannabinoid receptors, labelled by the radioligand [³H]-SR141716, did not differ in membranes from rats treated with saline, AS1, AS2 or MM. The density of receptor binding (B_max) was reduced by the antisense oligodeoxynucleotides, 10 nmol, in the hippocampus (AS1, –40%; AS2, –20%) and striatum (AS1, –29%; AS2 –6%), but not in the cerebral cortex. When the dose of AS1 was raised to 30 nmol, the reduction of B_max in the hippocampus and striatum was only marginally increased; a dose of 3 nmol of AS1 reduced B_max in both brain regions by somewhat more than the half-maximum effect. The mismatch oligodeoxynucleotide MM (3–30 nmol) did not affect B_max. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-polymerase chain reaction of CB₁ receptor mRNA and of β-actin mRNA levels (used as reference value). The ratio of CB₁ receptor mRNA over β-actin mRNA after treatment with AS1 did not differ from the ratios following treatment with saline or MM in the hippocampus, striatum and cerebral cortex. Finally, pretreatment with antisense oligodeoxynucleotide AS1 30 nmol attenuated two functional effects via CB₁ receptors, i.e., the facilitatory effect of WIN 55,212–2 on [³⁵S]-GTPγS binding in rat hippocampus membranes and the inhibitory effect of WIN 55,212–2 on acetylcholine release in rat hippocampus slices.

In conclusion, (i) two antisense oligodeoxynucleotides reduce the density of CB₁ receptors in the rat hippocampus and striatum after i.c.v. administration. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not appear to be related to breakdown of CB₁ receptor mRNA. (iii) Pretreatment with AS1 attenuated the CB₁ receptor-mediated effect in two functional models.