Introduction

The common fig (Ficus carica L.) is an ancient crop species belonging to the Moraceae family originating from the Mediterranean basin (Berg 2003). Iran is the fifth largest producer of figs after Turkey, Morocco, Greece, and Spain (FAOSTAT 2020) with 107,791 tons of fig production annually, and Fars Province is Iran’s leading dried fig producer, with 51,000 ha devoted to fig cultivation (Jafari et al. 2018). Despite the special significance of dried figs to Iran’s economy, some limiting factors such as fig canker disease decrease yield and export of this product.

In recent years, the most extensive collection of rainfed fig cultivars in Estahban, and other fig plantations in Fars Province have been at risk of a widespread decline caused by fig canker disease. The primary cause of fig canker disease in Iran is Diaporthe cinerascens Sacc. (syn. Phomopsis cinerascens (Sacc.) Traverso) (Banihashemi and Javadi 2009). However, different fungal plant pathogens are reported to attack fig and cause canker disease in other parts of the world, including species in the Botryosphaeriaceae such as Neofusicoccum parvum (Pennycook & Samuels) Crous et al. in Italy (Aiello et al. 2020), Lasiodiplodia theobromae (Pat.) Griffon & Maubl. in Turkey (Çeliker and Michailides 2012), and Neoscytalidium dimidiatum (Penz.) Crous & Slippers in Australia (Elshafie and Ba-Omar 2002; Ray et al. 2010), a species from Ceratocystidaceae, Ceratocystis ficicola Kajitani & Masuya, in Japan (Kajitani and Masuya 2011), and Stilbocrea banihashemiana Z. Bolboli, B. Tavakolian & Mostowf., from Bionectriaceae, in Iran (Bolboli et al. 2022).

During a recent survey to identify fungal pathogens associated with canker diseases of edible fig trees in southern Iran, several Neocosmospora spp. isolates (formerly Fusarium solani species complex = FSSC) were obtained from infected tissues. Neocosmospora is one of the fusarioid genera that has been segregated from the genus Fusarium sensu lato (Lombard et al. 2015). Species of this genus affect an extensive range of hosts, including humans, animals, and plants (O’Donnell et al. 2008; Lombard et al. 2015). Several species of Neocosmospora cause stem and trunk canker diseases of trees. For example, N. perseae Sand.-Den. & Guarnaccia on avocado (Persea americana Miller.) in Italy (Guarnaccia et al. 2018), N. croci Guarnaccia et al. (= N. martii (Appel & Wollenw.) Sand.-Den. & Crous), N. macrospora Sand.-Den. et al. and N. solani (Mart.) L. Lombard & Crous on English walnut (Juglans regia L.) in Turkey (Sandoval-Denis et al. 2019; Polat et al. 2020), N. solani on pistachio (Pistacia vera L.) trees in California (Crespo et al. 2019) and N. euwallaceae (S. Freeman et al.) Sand.-Den. et al. on avocado in Israel and California (Freeman et al. 2013). Still, to our knowledge, there are not any reports of canker-causing species of Neocosmospora on edible figs.

Observing widespread decline and trunk cankers on fig trees in several fig plantations in southern Iran (Fars Province), we focused our studies on identifying the fig canker’s causal agents during 2018–2021. The present study identified two new stem and trunk canker pathogens of figs belonging to the genus Neocosmospora, of which one represented a new species. Koch’s postulates were also confirmed for both species.

Materials and methods

Sampling and fungal isolation

During 2018–2020, infected fig trees with decline and canker symptoms were sampled from fig orchards in various parts of Fars Province (Estahban, Firuzabad, Jahrom, Kazerun, and Nayriz Counties). Transverse sections of infected branches and trunks were prepared, and small pieces (5 × 5 mm) from the margins between healthy and discoloured or decayed wood tissues were cut, washed under running tap water, surface disinfected for 1 min in a 70% ethanol, 1 min in a 2% sodium hypochlorite solution and rinsed twice in sterile distilled water (Gonzalez-Dominguez et al. 2016). Surface disinfected tissue samples were dried in sterile paper towels under a laminar flow-hood, and subsequently plated on Petri dishes containing potato dextrose agar (PDA; extract of 300-g/L boiled potato, 20-g/L glucose monohydrate, 15-g/L agarose, and distilled water) amended with tetracycline (1 mg/L). Plates were incubated at 25 °C for 7 days. All isolates were then transferred onto water agar (WA; 20-g/L agar, and distilled water) and single conidial isolates established once sporulating.

Morphological characterisation

Isolates were transferred onto carnation leaf agar (CLA) (Fisher et al. 1982), oatmeal agar (OA; extract of 30-g/L boiled oatmeal, 15-g/L agar, distilled water), and PDA. Morphological identification and characterisation for all fusarioid isolates were performed based on Crous et al. (2021). Average growth rates at 25 and 30 °C were obtained from colony diameters on PDA (90 mm Petri dishes with 25 ml medium), after 7 days of incubation in the dark with three replicates per isolate. Colony morphology and pigments were recorded after 7 days of incubation at 25 °C in the dark (Sandoval-Denis et al. 2019), using the colour chart of McKnight and Rayner (1972).

DNA extraction, PCR amplification, and sequencing

Total fungal DNA was extracted using the method described by Mirsoleimani and Mostowfizadeh-Ghalamfarsa (2013). Mycelia were harvested from the isolates grown in potato extract broth (extract of 300-g/L boiled potatoes in distilled water) for 7–10 days, then freeze-dried, and DNA was extracted with DNG-PLUS extraction kit (CinnaGen, Tehran, Iran). DNA quality was examined with a MD-1000 Nanodrop spectrophotometer (NanoDrop Technologies, Delaware, USA). The nc rDNA internal transcribed spacer (ITS) region (ITS1–5.8S–ITS2) was amplified using the primer set ITS1 (5′- TCCTCCGCTTATTGATATGC-3′) and ITS4 (5′- TCCTCCGCTTATTGATATGC -3′) following the protocol of White et al. (1990). RNA polymerase II second largest subunit (RPB2) was amplified using primers RPB2-5F2 (5′-GGGGWGAYCAGAAGAAGGC-3′) (Sung et al. 2007) and fRPB2-7cR (5′-CCCATRGCTTGTYYRCCCAT-3′) (Liu et al. 1999) and translation elongation factor 1-alpha (TEF1) was amplified with primers EF-1H (5′-ATGGGTAAGGARGACAAGAC-3′) and EF-2T (5′-GGARGTACCAGTSATCATG-3′) (O’Donnell 1998). Temperature and time conditions for PCR amplification are listed in Table 1. PCR amplifications were performed on a Peltier Thermal Cycler (Techne, Germany). PCR products were sequenced with the same primer pairs used for amplification by a dye terminator cycle (Cardiogenetic Research Center, Tehran, Iran). Sequenced data were deposited in GenBank (www.ncbi.nlm.nih.gov/genbank). Accession numbers are listed in Table 2.

Table 1 PCR conditions for primers used in this study
Full size table
Table 2 List of Neocosmospora spp. isolates recovered from infected fig trees, their GenBank accession numbers, and their corresponding observed disease symptoms in fig orchards of Fars Province of Iran
Full size table

Phylogenetic analysis

The isolates’ forward and reverse nucleotide sequences were edited, proofread, and assembled in BioEdit v. 7.0.9.0 (Hall 1999). Sequence alignment was conducted by Clustal X (Thompson et al. 1997) with subsequent manual adjustment. Partition homogeneity tests were conducted on the combined nuclear gene alignment by PAUP v. 4.0a136 (Swofford 2002) using 100 replicates and the heuristic general search option. Alignments derived in this study were deposited in Figshare (www.figshare.com; doi identifier https://doi.org/10.6084/m9.figshare.20455476.v1).

To reconstruct the phylogenetic trees, Bayesian inference analyses on individual and concatenated ITS, RPB2, and TEF1 loci were carried out with MrBayes v. 3.1 (Ronquist and Huelsenbeck 2003). Additional sequences included in this study were retrieved from GenBank and sequences of the ascomycete Geejayessia atrofusca (Schwein.) Schroers & Gräfenhan (NRRL 22316) served as the outgroup taxon in all analyses included (Supplementary Table 1) (Sandoval-Denis et al. 2019). The best nucleotide substitution model was determined by MrModelTest v. 2.3 (Nylander 2004). Two independent runs of Markov chain Monte Carlo (MCMC) using four chains were run over 1,000,000 generations. Trees were saved each 1000 generations, resulting in 10,001 trees. Burn-in was set at 25% generations. In order to conduct a phylogenetic comparison, maximum likelihood estimation was carried out using PHYLIP DNAML (Felsenstein 1993) with the same dataset. The robustness of the maximum likelihood trees was estimated by 1000 bootstraps. Phylogenetic trees were edited and displayed with TreeGraph (Stöver and Müller 2010).

Pathogenicity tests

Pathogenicity tests were conducted on detached woody shoots (fresh vegetative shoots, collected from 5–10-year-old fig trees and cut into 25–30 cm pieces (5–9 mm diam)) and mature 1-year-old fig saplings of Ficus carica cv. Shah Anjeer and cv. Sabz grown from cuttings in greenhouse conditions at 26 ± 3 °C. For both experiments, the outer bark at the inoculation site was cleaned and surface-sterilised with 70% ethanol, and a 6-mm wound was made using a sterilised cork-borer. A 6-mm diam mycelium plug taken from the margin of a 5-day-old PDA culture was inserted into the wound and covered with Parafilm (USA, Bemis Packaging) to prevent desiccation and contamination. Non-colonised PDA agar plugs served as the negative control (Roux et al. 2007). In the detached woody shoots experiment, the bases of inoculated shoots were inserted into Erlenmeyer’s flasks covered with Parafilm, with 500 ml of sterilised water, then kept under greenhouse conditions at 25 ± 2 °C. Inoculated detached shoots and saplings, as well as uninoculated controls, were returned to the laboratory 21 days after inoculation, their bark removed, and disease symptoms investigated. For re-isolation of fungal pathogens, five pieces (2 × 5 mm) from the margins of necrotic lesions were surface disinfected for 1 min in 70% ethanol, followed by 1 min in a 2% sodium hypochlorite solution, rinsed twice in sterile distilled water, and plated on PDA plates to recover and identify the inoculated fungi and complete Koch’s postulates.

Results

Field surveys and disease symptoms

Fig trees attacked by canker-causing fusarioid fungi displayed external and internal symptoms. External symptoms included leaf yellowing and defoliation, limb dieback, and three types of trunk cankers (Figs. 1 and 2). Type B cankers originated from the crown and developed upward (Fig. 2A), whereas type C was observed as well-developed sunken trunk lesions (Fig. 2E) and type D which consisted in cracked, discoloured, and dead areas on the main stem and branches (Fig. 1B). Internal symptoms included brown to dark brown discolouration of vascular tissues and different types of wood necrosis (Figs. 1 and 2). The occurrence of each symptom varied in an orchard from tree to tree, depending on cultivars, locations, and the orchards surveyed. From all sampled counties (Estahban, Firuzabad, Jahrom, Kazerun, and Nayriz), canker-causing fusarioid isolates were only isolated from the infected fig trees in Estahban and Nayriz. Thirteen fusarioid isolates were identified from diseased fig trees based on morphological and phylogenetic data. Trunk and branch cankers chiefly developed from pruning wounds, fig tree borer (Phryneta spinator Fabricius, Coleoptera: Cerambycidae) feeding sites, sunburn lesions, blighted shoots, and wounds that were caused by mechanical injuries (Table 2).

Fig. 1
figure 1

Symptoms of canker disease caused by Neocosmospora metavorans observed on the main stem and branches of Ficus carica cv. Shah Anjeer (Estahban, Fars, Iran). A Yellowing of the leaves and dieback of branches. B Type D of fig canker disease: cracked, discoloured, and dead areas on the main stem and branches. C–D Wood decay of an infected tree in transverse and longitudinal view. E Transverse sections through a branch of an infected fig tree

Full size image
Fig. 2
figure 2

Symptoms of canker disease caused by Neocosmospora caricae sp. nov. observed on the main stem of Ficus carica cv. Sabz (Estahban, Fars, Iran). A Type B of fig canker disease: a trunk canker originated from the crown and developed upward with holes in the wood produced by fig tree borer. B Wedge-shaped necrosis in transverse sections of infected fig trees. C–D irregular-shaped necrosis in longitudinal and transverse view. E Type C of fig canker disease: a well-developed sunken lesion on the trunk

Full size image

Phylogenetic analyses

Representative fusarioid isolates including, Esh191B, NPDRJ, NPDRJ-2 ES212-1, ES212-2, ES216-M, ES216, and ES216-R were subjected to multilocus sequence analyses. Polymerase chain reaction (PCR) amplification of the ITS, RPB2, and TEF1 regions generated 523–525, 863–870, and 686–688 bp fragments, respectively. BLASTn searches in GenBank showed that RPB2 sequences of some isolates (ESH191B, NPRJ, and NPRJ-2) had 99–100% identity with isolates previously described as Neocosmospora metavorans (Al-Hatmi et al.) Sand.-Den. & Crous (strain F201334 and F201131, GenBank accession no. KM520376 and KM520375 (Zhou et al. 2016)). The TEF1 sequences of these isolates also had 99–100% identity with isolates previously identified as N. solani (strain NRRL 22654 GenBank accession no. DQ247636 (Zhang et al. 2006)) and N. metavorans (strain NRRL44904, GenBank accession no. GU170621 (Migheli et al. 2010)). Furthermore, ITS sequences showed 99–100% identity with N. solani (strain CBS 143218 GenBank accession No. LR583743) (Sandoval-Denis et al. 2019)).

Results from maximum likelihood and Bayesian methods showed that N. metavorans isolates from fig canker (ESH191B, NPRJ, and NPRJ-2) were closely related to a N. metavorans isolate from Malus sylvestris L. (culture/specimen: CBS 233.36 = NRRL 22654) (Sandoval-Denis et al. 2019), both of which were clustered strongly (1/100%) in a monophyletic subclade within N. metavorans (Fig. 3).

Fig. 3
figure 3

Phylogenetic relationships of Neocosmospora species from infected fig trees of Fars Province: relationships among 71 Neocosmospora species (92 isolates) based on Bayesian analysis of multigene genealogies of ITS (internal transcribed spacers 1 and 2 and 5.8S gene of rRNA), RPB2 (RNA polymerase II second largest subunit) and TEF1 (translation elongation factor 1-alpha) sequences. Numbers on the nodes are Bayesian posterior probability values (BI-PP) followed by Maximum Likelihood bootstrap values (ML–BS) Full supported branches (ML–BS = 100/BI–PP = 1). Ex-type isolates are indicated with T. *= ex-type of N. caricae sp. nov.

Full size image

Several isolates with unique morphological features were recovered from trunks and branches of infected fig trees in plantations of southern Iran. BLASTn searches in GenBank showed that RPB2 sequences of these isolates had ca. 99% identity with isolates previously described as N. parceramosa Sand.-Den. & Crous (strain NRRL 31158, GenBank accession No. EU329559 (O'Donnell et al. 2008)), N. liriodendri Sand.-Den. & Crous (strain NRRL 22389, GenBank accession No. EU329506 (O’Donnell et al. 2008)) and N. petroliphila (Q.T. Chen & X.H. Fu) Sand.- Den. & Crous (strain JMRC: NRZ: 0086, GenBank accession No. MF467496 (Walther et al. 2017)). The TEF1 sequences of these isolates also had 98% identity with isolates previously identified as Fusarium sp. (strain NRRL 13414 GenBank accession No. MK818415 (Carrillo et al. 2020)) and N. petroliphila (strain NRRL 44904, GenBank accession No. KJ867424 (Ersal et al. 2015)). Furthermore, the partition homogeneity test between ITS, RPB2, and TEF1 loci resulted in a P value of ca 0.9 indicating statistical congruence, so the null hypothesis of congruence is accepted (P≥0.05), which means these genes have co-evolved.

Taxonomy

The multigene genealogy using nuclear ribosomal and protein-coding loci (ITS, RPB2, and TEF1) showed that these isolates were significantly distinct from other known Neocosmospora species and clustered in a monophyletic clade with strong supporting values both in Bayesian and maximum likelihood trees. The new lineage is proposed here as a new species, Neocosmospora caricae sp. nov.

Neocosmospora caricae Z. Bolboli & Mostowf., sp. nov.

MycoBank 844080 Fig. 4.

Fig. 4
figure 4

Colony morphology and morphological features of Neocosmospora caricae sp. nov. from infected fig trees in Iran. a–b Colonies of N. caricae on PDA and OA, respectively, after 7 d at 25 °C in the dark. c–f Sporodochia formed on the surface of carnation leaves in CLA. g–h Sporodochial conidiophores and phialides. i–k Aerial conidiophores and phialides. l–m Chlamydospores. n Aerial conidia (microconidia). o Sporodochial conidia (macroconidia). Scale bars: d–f, k = 20 μm; l–m = 5 μm; all others = 10 μm

Full size image

Etymology: Name reflects the host species, Ficus carica.

Typification: IRAN, Fars Province, (29°06′.793″N−054°04′.473″E) Estahban, on trunk of Ficus carica, Dec. 2020, Z. Bolboli (holotype CBS 148865, stored in a metabolically inactive state), Westerdijk Fungal Biodiversity Institute (CBS; Utrecht, The Netherlands).

Aerial conidiophores: highly abundant on aerial mycelium, straight rarely simple, often branched verticillately and sympodially, 64.2–80.1 × 2.1–3.2 μm (av. 71.4±6.8 × 2.6± 0.4 μm) simple aerial monophialides, Microconidia: oval, obovoid to somewhat reniform, clustering in false heads at tip of monophialides on slender, elongated aerial phialides and aerial conidiophores, 0(–1)-septate, (5–)6–10.5 × (2.5–)3.5–5 μm (av. 8.2±2.1 × 4.1±0.6 μm), smooth- and thin-walled. Sporodochia: pale luteous to citrine, formed abundantly on the surface of carnation leaves after 14 d; sporodochial conidiophores: unbranched or branched multiple times, sporodochial phialides subcylindrical, subulate to doliiform, 10.4–15 × 2.9–5.2 μm (av. 12.7±1.27 × 4.3± 0.5 μm), smooth- and thin-walled, with short apical collarette, periclinal thickening inconspicuous or absent. Sporodochial conidia: fusoid, gently dorsiventrally curved with somewhat parallel walls or slightly widened above the mid line, basal cell with a poorly to well-developed foot shape, apical cell blunt and slightly curved, (3–)5(–6)-septate, hyaline, smooth-walled. Three-septate conidia: 28.1–40 × 3.3–4.9 μm (av. 34.2 ±2.9× 4.2±0.3 μm); four-septate conidia: 34.2–51× 3.2–5.5 μm (av. 41.7 ±4.9× 4.2±0.6 μm); five-septate conidia: 33.6–45.3 × 4.3–5.6 μm (av. 39.9 ±2.6× 5.1±0.4 μm); six-septate conidia: 60.5–69.9 × 5.4–6.3 μm (av. 65.7±3.1 × 5.8±0.2 μm). Chlamydospores: abundant and rapidly formed on agar media (approx. 7 days), hyaline, globose to subglobose, 6.4–9 × 4.3–8.4 μm (av. 7.3±0.8 × 61±10 μm, n = 30), solitary or in chains, terminal, intercalary or borne on short lateral pegs, smooth- and thick-walled.

Colony characteristics: Colonies on PDA growing in the dark with an average radial growth rate of 6.1–6.3 mm/days at 25 °C, reaching 64.3 mm diam in 7 days at 25 °C; white, pale luteous to luteous at centre, flat to slightly raised, cottony, with abundant aerial mycelium; colony margin filiform. Reverse pale straw to pale luteous. On OA incubated in the dark reaching 61.2 mm diam in 7 days at 25 °C; white to yellowish, flat, membranous with scant white aerial mycelia.

Cardinal temperatures for growth: Minimum 10 °C, maximum 37 °C, optimum 25 °C.

Other specimens examined (paratypes): Iran, Fars Province: Estahban (29°06′.852″N–054°04′.487″E) from the trunk of Ficus carica cv. Sabz ES212-1, 23 Dec. 2020, Z. Bolboli, CBS 148933. Iran, Fars Province: Estahban (29°06′.852″N–054°04′.487″E) from the trunk of Ficus carica cv. Sabz ES212-2, 23 Dec. 2020, Z. Bolboli, CBS 148932. Iran, Fars Province: Estahban (29°06′.793″N–054°04′.473″E) from the trunk of Ficus carica cv. Sabz ES216, 23 Dec. 2020, Z. Bolboli. Iran, Fars Province: Estahban (29°06′.793″N–054°04′.473″E) from the trunk of Ficus carica cv. Sabz ES216-R, 23 Dec. 2020, Z. Bolboli, CBS 148930.

Pathogenicity tests

Pathogenicity of representative isolates Esh191B, ES212, and ES216 were evaluated in two experiments on detached twigs and 1-year-old saplings, respectively. All isolates used in both pathogenicity tests produced cankers, vascular tissue discolouration and yellowing on Ficus carica cv. Shah Anjeer and cv. Sabz saplings. The first visible symptom was the appearance of discolouration that began from the inoculation site and developed longitudinally on detached twigs and saplings. Based on pathogenicity tests, N. metavorans and N. caricae sp. nov. isolates produced canker disease symptoms on fig stems 10 and 21 days after inoculation, respectively (Fig. 5). Common symptoms included brown to dark brown discolouration of vascular tissues, wood necrosis, and branch dieback. Yellowing and defoliation of sapling were observed 5 months after inoculation. Symptoms were similar to those observed in infected fig trees in orchards. Inoculated isolates could be recovered from lesion margins. Control plants remained healthy.

Fig. 5
figure 5

Typical symptoms of stem canker disease on Ficus carica cv. Shah Anjeer and “Sabz” inoculated with Neocosmospora species from infected fig trees of Iran. A–D Symptoms of stem canker disease on Ficus carica cv. Shah Anjeer inoculated with Neocosmospora metavorans isolate ESH191B. A Twenty days after inoculation. B Canker progression, side view. C Canker progression behind the inoculation site. D Bark scraped away to reveal lesion progression on the stem. E–H Symptoms of stem canker disease on Ficus carica cv. Sabz inoculated with Neocosmospora caricae sp. nov. 3 months after inoculation. E–F Symptoms of canker disease and wood necrosis caused by N. caricae isolate ES212. G–H Extended lesion caused by N. caricae isolate ES216

Full size image

Discussion

The primary cause of fig canker disease in Iran has been reported to be Diaporthe cinerascens (syn. Phomopsis cinerascens) (Banihashemi and Javadi 2009). Another causal agent of stem cankers and twig dieback of fig trees in southern Iran has been very recently reported to be Stilbocrea banihashemiana (Bolboli et al. 2022). Our results demonstrate that some Neocosmospora species (formerly Fusarium solani species complex = FSSC) cause fig trunk and branch canker in Estahban county, along with other parts of the Fars Province, which represent Iran’s largest fig producing region.

Although species of Fusarium have been associated with canker diseases on some horticultural and forestry trees such as sweet orange, Citrus × sinensis (L.) Osbeck, (F. salinense Sand.-Den., Guarnaccia & Polizzi), Citrus spp. (F. citricola Guarnaccia & Sand.-Den.), pines (F. circinatum Nirenberg & O’Donnell), and pistachio, Pistacia vera L., (F. oxysporum Smith & Swingle, and F. proliferatum (Matsush.) Nirenberg) (Pfenning et al. 2014, Sandoval-Denis et al. 2018, Crespo et al. 2019), there are no reports of Fusarium or Neocosmospora cankers from edible fig. However, some Fusarium species have been shown to be the causal agents of fig fruit diseases, e.g., F. moniliforme J. Sheld (now: F. verticillioides (Sacc.) Nirenberg) (Droby et al. 2011, Kosoglu et al. 2011, Crous et al. 2021; Guarnaccia et al. 2021), and F. proliferatum (Fawzi 2003). It seems that F. proliferatum isolates from many crops, including fig trees, are phylogenetically different from the original ex-type strain, and belong to a morphologically and phylogenetically diverse clade, F. annulatum Bugnic (Yilmaz et al. 2021).

Multi-locus phylogenetic analyses using three loci (ITS, RPB2, and TEF1), as well as morphological analysis, revealed that all fusarioid isolates in this study belong to clade 3 of the genus Neocosmospora, including N. metavorans and a new taxon, N. caricae sp. nov. Sandoval-Denis et al. (2019) provided a comprehensive phylogeny for N. metavorans, which included 19 isolates that originate from different substrates, namely humans, insects, and plants. These isolates are clustered in several subgroups in the clade. They are mostly known from human clinical samples, and only a single isolate is associated with a plant, M. sylvestris. Neocosmospora metavorans isolates from fig canker were closely related to N. metavorans from M. sylvestris, which formed a subclade distinct from other isolates from humans and animals.

Isolates of N. metavorans were also recovered from the intestines and mouth parts of Phryneta spinator larvae. This longhorn beetle from Cerambycidae is a wood borer that attacks fig trees in Iran. The larvae tunnels were also observed on the canker sites of fig trunks. These observations agreed with previous reports of symbiotic relationships between canker-causing Neocosmospora species and fruit and nut tree borers. For example, N. euwallaceae and N. ambrosia (Gadd & Loos) L. Lombard & Crous, associated with symbiotic Euwallacea beetles in avocado (Freeman et al. 2013), and N. metavorans isolates from the guts of the wood-boring cerambycid beetles, Anoplophora glabripennis Motschulsky (Herr et al. 2016). Hence, fig tree borer larvae can be considered as potential vectors or transmitters of canker-causing Neocosmospora species in fig. More experiments, however, should be conducted to confirm this hypothesis.

Several N. caricae sp. nov. isolates were recovered from trunks and branches of infected fig trees in plantations of southern Iran. Morphological and multigene phylogenetic studies using ribosomal and protein-coding loci (ITS, RPB2, and TEF1) showed that these isolates were significantly distinct from other known Neocosmospora species. The differences were more evident in the TEF1 phylogeny than in the other genes. Neocosmospora caricae sp. nov. appeared as a sister taxon to N. petroliphila, one of the most prevalent species associated with human infections (Sandoval-Denis et al. 2019). Morphologically, the apical cells of sporodochial conidia in N. caricae sp. nov. were short, and the basal cells poorly developed foot-shaped, vs longer and more curved apical cells of sporodochial conidia in N. petroliphila. Furthermore, sporodochial conidia in N. caricae sp. nov. were shorter than those of N. petroliphila and N. metavorans (Short et al. 2013, Sandoval-Denis et al. 2018). The morphological differences, as well as the phylogenetic analyses, supported describing these isolates as a new species.

Four different types of canker were observed in the infected fig orchards; we named them as types A–D (Bolboli et al. 2022). Only the previously reported Diaporthe cinerascens (syn. Phomopsis cinerascens) (Banihashemi and Javadi 2009) was recovered from the type A cankers: trunk lesions with zonation. Our observations, combined with these results, revealed that the fig canker-causing Neocosmospora isolates can induce types B, C, and D cankers. Type B cankers that originate from the crown were more widespread than type C, with well-developed sunken lesions on the trunks, and type D, cracked, discoloured, and dead areas on the main stem and branches. However, N. caricae sp. nov. may cause type B, or C in the orchards, whereas type C and D can result from N. metavorans infections of the fig trees. Types C and D cankers were also caused by the recently described S. banihashemiana (Bolboli et al. 2022). Two types of discolouration were also observed in the transverse sections of the infected fig trees. Neocosmospora caricae sp. nov. isolates caused irregular-shaped and wedge-shaped necrosis, whereas N. metavorans necrosis was crescent-shaped and wedge-shaped in the transverse sections of infected trees.

Since Neocosmospora species could have a non-pathogenic endophytic or pathogenic lifestyle (Sandoval-Denis et al. 2019), our pathogenicity results demonstrate that both N. metavorans and N. caricae sp. nov. were pathogenic and responsible for fig stem and trunk canker. Based on our observations, these newly reported pathogens may represent a severe threat to fig plantations.

In conclusion, this study identified two new pathogenic fungal species from the Nectriaceae, N. metavorans and N. caricae sp. nov., associated with trunk and branch canker diseases of fig orchards in Iran. These species were pathogenic to the “Sabz” cultivar, the most widely planted fig cultivar in Iran. The current results add to the previous knowledge on the aetiology of fig stem and trunk canker and may provide essential information for developing effective integrated management strategies against canker diseases affecting fig orchards in Iran. Future research on disease integrated management of fig canker diseases should focus on fast and accurate detection of the inoculum sources in fig nurseries and orchards as well as the evaluation of susceptibility of various Iranian fig cultivars to these pathogens.