Plant Molecular Biology Reporter

, Volume 31, Issue 2, pp 344–351 | Cite as

A Basic Helix-Loop-Helix Gene from Poplar is Regulated by a Basic Leucine-Zipper Protein and is Involved in the ABA-Dependent Signaling Pathway

  • Lin He
  • Caiqiu Gao
  • Yucheng Wang
  • Yingjie Wu
  • Zhihua Liu
Original Paper

Abstract

Basic helix-loop-helix (bHLH) transcription factors (TF) comprise a large group of proteins that are involved in many developmental and physiological processes in plants. In this study, a bHLH gene (PkbHLH2), along with its promoter, was cloned from Populus koreana Rehd. A PkbHLH2 promoter::GUS gene fusion construct was generated to investigate the expression of PkbHLH2. The results demonstrated that PkbHLH2 was expressed mainly in leaf stalks, leaf veins and roots. Yeast one-hybrid assays showed that a bZIP gene product (PkbZIP2) can bind specifically to the ABA-responsive elements (ABRE) that exist in the promoter region of PkbHLH2, regulating the expression of PkbHLH2. In addition, the “GC” of the ABRE core motif “ACGTG” was very important for PkbZIP2 recognition, because its mutation to “TT” completely prevented the interaction between PkbZIP2 and ABRE. Furthermore, both PkbHLH2 and PkbZIP2 can be up-regulated by abscisic acid (ABA) and osmotic stress, and share similar expression patterns when exposed to ABA and osmotic stress. These results suggest that PkbZIP2 is an upstream regulator of PkbHLH2, which can control the expression of PkbHLH2 through an ABA-dependent signaling pathway.

Keywords

ABA-dependent signaling pathway ABRE motif bHLH bZIP Populus koreana 

Introduction

Basic helix-loop-helix (bHLH) transcription factors (TFs) are the second largest class of plant TFs, and are involved in many developmental and physiological processes in plants (Bai et al. 2011). For instance, there are 133 bHLH genes in Arabidopsis, constituting one of the largest TF families (Heim et al. 2003). The bHLH proteins contain several highly conserved domains that are structurally heterogeneous (Xu et al. 2011). The bHLH domain is characterized by the signature bHLH domain comprising approximately 60 amino acids (aa) with two functionally distinct regions. The basic region at the N-terminus contains 13–17 primarily basic aa and plays a role in binding to the hexanucleotide E-box DNA motif CANNTG. bHLH domains, whose basic region contains at least five basic aa, comprise a highly conserved HER motif (His5–Glu9–Arg13), which is predicted to bind DNA (Feller et al. 2011). The helix-loop-helix (HLH) region at the C-terminal end comprises two amphiphatic a-helices that are connected by a loop of variable length. The HLH motif was found to form homo- or heterodimers with other bHLH proteins (Heim et al. 2003; Toledo-Ortiz et al. 2003), which is necessary for DNA recognition and DNA-binding specificity. Many bHLH proteins are found to contain an acidic region that can facilitate transcriptional activation and/or dimerization (Feller et al. 2011), and this region is usually N-terminal to the bHLH domain (Chinnusamy et al. 2003; Feller et al. 2006). bHLH proteins also play roles in transcriptional activation or repression, and have either a very broad or very restricted expression pattern, which is affected by their dimerization properties (Feller et al. 2011).

Most of the plant bHLH genes determined so far were functionally characterized in Arabidopsis, and only a few bHLH genes have been characterized functionally in other plant species (Zhou et al. 2009). The functions of plant bHLH genes were found to encompass involvement in regulation of epidermal cell development, carpel, anther and fruit dehiscence, flavonoid biosynthesis, phytochrome signaling, hormone signaling and stress responses (Feller et al. 2011). For example, Bai et al. (2011) isolated two bHLH genes (NtAn1a and NtAn1b) from tobacco, and their study showed that NtAn1 and NtAn2 act in concert to mediate the anthocyanin pathway in tobacco flowers, and that NtAn2 can up-regulate the expression of NtAn1. Zhang et al. (2011a) identified a bHLH TF, CrMYC2, from Catharanthus roseus. The results suggested that MeJA-responsive expression of alkaloid biosynthesis genes in C. roseus is regulated by a TF cascade consisting of the bHLH protein CrMYC2, which regulates the expression of ORCA. Two bHLH gene products from Arabidopsis, MYC3 and MYC4, can interact with JAZ-interacting TF that regulate JA responses, and are activators of JA-regulated programs, which act additively with MYC2 to mediate specifically different subsets of the JA-dependent transcriptional response. These results suggested that they were involved in the regulation of plant defense and development (Fernández-Calvo et al. 2011; Qi et al. 2011). SPT, a bHLH (AtbHLH024) from Arabidopsis, was identified as a positive regulator in the development of carpel and fruit, but it was also shown that it negatively controls seed germination, expansion of leaves, petals and cotyledons (Heisler et al. 2001; Penfield et al. 2005; Groszmann et al. 2010; Ichihashi et al. 2010). A bHLH gene product, ICE1 (AtbHLH116), can bind to several E-box sequences in vitro and has the ability for transcriptional activation, and it also plays a role in cold acclimatization responses and freezing tolerance (Chinnusamy et al. 2003).

Although many studies have been performed on bHLH, still little is known regarding the upstream regulator(s) of bHLH, and their spatial expression patterns. In the present study, we cloned a bHLH gene (PkbHLH2) from Populus koreana Rehd, and a PkbHLH2 promoter::GUS gene fusion was generated to investigate the expression of PkbHLH2. Yeast one-hybrid analysis was employed to investigate upstream regulators. Our results show that PkbHLH2 was expressed mainly in leaf stalks, leaf veins and roots. The expression of PkbHLH2 may be regulated by a bZIP gene product, and is up-regulated by ABA and osmotic stress, suggesting that it may be involved in the ABA signal transduction pathway.

Materials and Methods

Plant Materials

Plantlets of P. koreana were grown in MS medium. For ABA treatments, these plantlets were treated with 100 μM ABA (supplied in MS medium) for 24 and 48 h, respectively. After treatment, a mixture of leaves and stems, and roots from at least three seedlings were harvested for real-time RT-PCR analyses.

Cloning of the ORF and Promoter of the PkbHLH2 Gene

For cloning of the bHLH gene from P. koreana Rehd, primers were designed according to the sequence of a bHLH (GenBank number: XP_002300555) from poplar as follows: forward primer: 5′-ATGGCTCTGAGCTTCTGTTC-3′; reverse primer: 5′- CTATCCAAGAAATTGCTCC -3′. Total RNA was isolated from P. koreana using a CTAB method (Chang et al. 1993) and was digested with DNaseI (RNase-free) to remove any DNA contamination. Total RNA (2 μg) was reverse transcribed into cDNA using an oligodeoxythymidine primer in a reaction volume of 10 μL, which was then adjusted diluted to 100 μL for use as a PCR template. Primers for amplification of the bHLH promoter (see below) of bHLH were designed according to the promoter sequence of bHLH from poplars: forward primer 5′- ATTCCTGCGTAATGCGTACC-3′, reverse primer 5′- GGAGGATAGAATCTAGAAAA -3′. DNA isolated from P. koreana using a CTAB method (Doyle and Doyle 1987) was used as PCR template for amplifying the bHLH promoter. Multiple sequence alignments of bHLH from poplars and other plant species were performed using CLUSTALX1.81. The promoter sequence was analyzed using the program plantcare (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/).

Spatial Expression Analysis of the PkbHLH2 Gene

The primers for amplification of the promoter of the bHLH were as follows: P1: 5′- CCCAAGCTTATTCCTGCGTAATGCGTACCAT -3′ (HindIII site underlined), P2: 5′- CGCGGATCCGGAGGATAGAATCTAGAAAAG -3′ (BamHI site underlined). The PCR products were digested with HindIII and BamHI, and ligated into the pBI121 vector that was also digested with HindIII and BamHI. The construct was transformed into Agrobacterium EHA105. The transformation of Tobacco was performed using the Agrobacterium-mediated method. For histochemical staining, the transformed plants were immersed into GUS staining solution [10 mM Na2EDTA, 50 mM phosphate buffer (pH 7.0), 0.5 mM K3Fe(CN)6, 0.5 mM K4Fe(CN)6, 0.1 % Triton X-100 and 0.6 mg/mL X-Gluc] and incubated overnight at 37 °C. Stained plants were soaked in 70 % ethanol to remove chlorophyll.

Yeast One-Hybrid Analysis of the Upstream Regulator of the PkbHLH2 Gene

Two cis-elements of ABRE with the sequence of “ACGTG” were found in the promoter of PkbHLH2, located at −774 and −1,042 bp of the start codon, respectively. For yeast one-hybrid analysis, the promoter sequence contained three tandem copies of the ABRE cis-element cloned into a pHIS2 vector (Clontech , Palo Alto, CA) using the forward and reverse primers 5′-AATTCGCGACGTGGTTGCGACGTGGTTGCGACGTGGTTGAGCT-3 and 5′- CAACCACGTCGCAACCACGTCGCAACCACGTCGCG-3′. A cDNA library was constructed from P. koreana using a Make Your Own “Mate & Plate” Library System (Clontech, Mountain View, CA) according to the user manual. The one-hybrid analysis was performed following the protocol of BD Matchmaker™ Library Construction & Screening Kits User Manual.

A bZIP (PkbZIP2, GenBank number: JN651905) was obtained by yeast one-hybrid analysis. To study the specificity of the interaction between PkbZIP2 and the ABRE cis-element, the core motif of “ACGT” was mutated to “ATTT”, and the interaction between PkbZIP2 and these motifs was performed using yeast one-hybrid analysis.

To further study whether PkbZIP2 is able to regulate expression of PkbHLH2, an 800 bp promoter fragment of bHLH (forward primer: TAATACGTGAGATCGTCCCTAT, reverse primer: CTCGGAGCTCATGTCCCATTTTGAGCAAG, Sac I underlined) was cloned into a pHIS2 vector, and kbZIP2 was cloned into a pGADT7 vector for use in one-hybrid analysis.

Real Time PCR Analysis of PkbZIP2 and PkbHLH2 in Response to ABA Treatment

To analyze the expression of ABRE and bHLH in response to ABA treatment, real-time RT-PCR assays were performed. Total RNA (1 μg) was reverse transcribed into cDNA using an oligodeoxythymidine primer in a reaction volume of 10 μL, which was then diluted to 100 μL for use as a PCR template. Real-time RT-PCR was conducted using a MJ Research Opticon™2 instrument. α-Tubulin (XM_002301092), and actin 3 (XM_002308329) were used as internal controls to normalize the amount of total RNA present in each reaction. The primers (Table 1) for each gene were designed from conserved regions, and generated specific bands (data not shown). The PCR conditions were 94 °C for 30 s, 45 cycles of 94 °C for 12 s, 58 °C for 30 s, 72 °C for 40 s, and 80 °C for 1 s for plate reading. The relative expression levels were calculated according to the 2−ΔΔCt method (Livak and Schmittgen 2001).
Table 1

Primer sequences used for real time RT-PCR

Gene name

GenBank number

Forward and reverse primer sequences

α-Tubulin

XM_002301092

5′-TCATTAAGGTTTGATGGAGC-3′

5′-GCATTCACATCCTTGGGCAC-3′

Actin 3

XM_002308329

5′-GCAGGTTATCACCATTGGAG-3′

5′-TCCTTTCTGGTGGTGCAACC-3′

PkbZIP2

JN651905

5′-GGTCTAGCTCACAGTGGAGG-3′

5′-GTGTATGGGCCTGCTTGAGAG-3′

PkbHLH2

JN651906

5′-TGGATTCAAAGAAACCAAGC-3′

5′-TTGCTCTAAGTACAACTTCTC-3′

Results

Cloning of the PkbHLH2 Gene

A full-length ORF of the PkbHLH2 gene (GenBank number: JN651906) cloned from P. koreana was 894 bp in length, encoding 297 aa with a molecular weight of 35.5 kDa. An HLH domain was found at amino acid residues 172–216. Multiple sequence alignments were performed with other bHLH proteins from seven plant species. All of these bHLH proteins shared a highly conserved HLH domain, which is found specifically in DNA-binding proteins, and acts as a TF transcription factors (Fig. 1a).
Fig. 1

Bioinformatic analyses of PkbHLH2 and its promoter. a Multiple sequence alignment analysis of basic helix-loop-helix (bHLH) proteins from different plant species. XP_002317694, bHLH from Populus trichocarpa; XP_002533773, bHLH from Ricinus communis; AAM10945, bHLH from Arabidopsis thaliana; XP_002270265, bHLH from Vitis vinifera; XP_002879517, bHLH from Arabidopsis lyrata subsp. Lyrata; XP_002465928, bHLH from Sorghum bicolor; AEO45564, bHLH from Populus koreana. b Analysis of cis-elements in the promoter of PkbHLH2

Cloning the Promoter of PkbHLH2 and Spatial Expression Analysis of PkbHLH2

The promoter of PkbHLH2 was cloned and was determined to be 1,729 bp in length. The cis-elements in the promoter were identified using PLACE software tools. Many cis-elements known to be involved in stress responses, such as ABRE, MRE, MBS (Fig. 1b) were found in the PkbHLH2 promoter. Two ABA-responsive elements (ABRE) were found (Fig. 1b), suggesting that the PkbHLH2 may be regulated by genes that bind to ABRE motifs. To study the expression pattern of PkbHLH2, Arabidopsis plants were transformed with a constructed PkbHLH2 promoter::GUS vector. Histochemical staining of GUS was performed on Arabidopsis plants of different ages. GUS activity was found in mainly leaf stalks, leaf veins and roots (Fig. 2).
Fig. 2

Spatial expression analysis of PkbHLH2 in Arabidopsis. The PkbHLH2 promoter:: GUS gene fusion construct was transformed into Arabidopsis, and expression of PkbHLH2 was studied using GUS staining. a Wild type Arabidopsis as control; be 1-, 2-, 4- and 6-week-old transgenic Arabidopsis

Identification of the Upstream Regulator of PkbHLH2

Three tandem copies of the ABRE motif were cloned into a pHIS2 vector to perform a yeast one-hybrid assay. The results indicated that a bZIP gene product (PkbZIP2) can bind to the ABRE motif. To validate the yeast one-hybrid results, we examined whether the ABRE motif interacted with the empty cloning vector pGADT7 at various concentrations of 3-AT. While PkbZIP2 (GenBank number: JN651905) bound to the ABRE motif, the empty pGADT7 vector did not (Fig. 3a). These results suggested that the PkbZIP2 gene regulated the expression of the PkbHLH2 gene.
Fig. 3

Yeast one-hybrid analysis of the interaction of the PkbZIP2 with the promoter of PkbHLH2 and the ABRE motif. a Interaction between PkbHLH2 and ABRE motif. b Specificity of interaction between PkbZIP2 and ABRE motif. The core sequence “ACGTG” of ABRE was mutant to “ATTTG”. Three tandem copies of ABRE or the mutated ABRE motif was inserted into pHIS2, and interacted with PkbZIP2 (designed as ABRE + PkbZIP2 or MABRE + PkbZIP2, respectively), or ABRE motifs interacted with empty pGADT7 (ABRE + Em pGADT7). Both ABRE + Em pGADT7 and MABRE + PkbZIP2 served as negative controls. c Identification of the upstream regulator of PkbHLH2. Pro: one copy of the promoter fragment (800 bp in length) of PkbHLH containing 2 ABRE motifs was cloned into pHIS2. Pro + PkbZIP2: the promoter fragment in pHIS2 interacted with PkbZIP2. Em pHIS2 + PkbZIP2: empty pHIS2 hybridized with PkbZIP2 (negative control 1). Pro + Em pGADT7: the promoter fragment in pHIS2 hybridized with empty pGADT7 (negative control 2)

To further confirm that PkbZIP2 can regulate the expression of the PkbHLH2 gene, an 800-bp stretch of the promoter region of PkbHLH2 was cloned into a pHIS2 vector. Interaction with PkbZIP2 (inserted into pGADT7) was examined using a one-hybrid assay, and the empty pGADT7 was used as control. The results showed that the PkbZIP2 gene product interacted with the promoter of the PkbHLH2 gene (Fig. 3b), whereas no binding activity was observed using the empty pGADT7, confirming that the interaction between PkbZIP2 and the promoter of PkbHLH2 was specific. These results suggested that PkbZIP2 was an upstream regulator of the PkbHLH2 gene.

Specificity of the Interaction Between PkbZIP2 and the ABRE Motif

To study whether PkbZIP2 binds specifically to the ABRE motif, the core motif of ABRE “ACGTG” was mutated to “ATTTG”, which was inserted into a pHIS2 vector in three tandem copies. Interaction assays between PkbZIP2 and the ABRE motif or its mutated form were performed at different 3-AT concentrations using a yeast one-hybrid assay. PkbZIP2 interacted with the core motif “ACGT”, but not with its mutant form “ATTT” (Fig. 3c), which indicated that the interaction between PkbZIP2 and “ACGT” was specific.

Expression of PkbHLH2 and PkbZIP2 in Response to ABA and Osmotic Treatments

Real time RT-PCR was performed to study expression of PkbHLH2 and PkbZIP2 in response to ABA treatment and osmotic stress. The results indicated that both PkbHLH2 and PkbZIP2 were up-regulated by ABA treatment (Fig. 4). Following ABA treatment for 3–12 h, the expression levels of both PkbHLH2 and PkbZIP2 continued to increase, indicating that ABA mediated the expression of PkbHLH2 and PkbZIP2 in P. koreana. The expression of PkbHLH2 and PkbZIP2 were also induced by osmotic stress, and shared similar expression patterns. These results confirmed that expression of both genes, PkbZIP2 and PkbHLH2, is stress responsive, and that they may play roles in plant stress tolerance.
Fig. 4

Expression of PkbHLH2 and PkbZIP2 in response to abscisic acid (ABA) and polyethylene glycol (PEG) using real-time RT-PCR. The relative expression level was log2 transformed: > 0 up-regulation, = 0 no change, < 0 down-regulation

Discussion

PkbHLH2 has a Conserved HLH Domain and is Expressed in Specific Tissues

In the present study, we cloned a PkbHLH2 gene from P. koreana. Sequence alignments of seven bHLHs from different plant species showed that all of them share a highly conserved HLH domain (Fig. 1a). The HLH domain serves as a TF found in specific DNA-binding proteins. Therefore, the presence of a conserved HLH domain in PkbHLH2 suggested that it may also serve as a TF and that it can interact with other TFs. Other cis-elements, such as ABRE, MRE, MBS, exist in the PkbHLH promoter (Fig. 1b), suggesting that the expression of PkbHLH2 may be involved in stress responses. To examine the spatial expression of PkbHLH2, the GUS reporter gene was fused to the promoter of PkbHLH2 and Arabidopsis plants were transformed. GUS staining revealed that PkbHLH2 was expressed mainly in leaf stalks, leaf veins and main roots (Fig. 2), suggesting that it might perform specialized functions in these tissues.

Both PkbZIP and PkbHLH Belong to the ABA-Dependent Signaling Pathway

ABA is an important plant hormone that affects many aspects of plant growth and developmental processes, and plays a crucial role in plant responses to stress (Zhang et al. 2006). There are two stress signaling pathways in plants, the ABA-dependent and ABA-independent signaling pathways. Correspondingly, there are two major cis-acting elements included in stress inducible genes, ABRE and DRE/CRT. ABRE is recognized by ABA-dependent regulatory mechanisms, and the DRE/CRT element is recognized by ABA-independent regulatory mechanisms (Liao et al. 2008).

The results of the present study revealed two ABRE motifs in the promoter region of PkbHLH2. This suggested that PkbHLH2 may belong to an ABA-dependent signaling pathway. bZIP transcription factors, which are present in all eukaryotes, contain a basic region that binds DNA, and a leucine zipper dimerization motif (Tang et al. 2012). Some bZIP proteins have been found to specifically interact with the ABRE motif (Busk and Pages 1998; Rock 2000; Kim et al. 2004). The promoters of all ABA-responsive genes contain an ABA-responsive element, ABRE, that binds specifically to the bZIP family of TFs. This binding can result in the up- or down-regulation of expression of ABA-induced genes (Zhang et al. 2006). Nieva et al. (2005) cloned two maize bZIP genes that were found to mediate the expression of the ABA-inducible gene, rab28. The activity of rab28 was modulated by ABA, suggesting that bZIP genes mediate gene expression through the ABA-dependent signaling pathway.

However, there are no reports that bZIP may mediate stress responses via regulation of expression of other TFs. In the present study, the results obtained using a yeast one-hybrid system indicated that PkbZIP2 did interact with the ABRE motifs that were present in the promoter region of PkbHLH2 (Fig. 3a). In addition, PkbZIP2 interacted with the promoter of PkbHLH2 (Fig. 3b), confirming that it was able to regulate the expression of PkbHLH2.

To study the specificity of the interaction between ABRE and PkbZIP2, we mutated ABRE core motif “ACGTG” to “ATTTG”. The results revealed that when “CG” was changed to “TT”, the ability of PkbZIP2 to interact with the mutant was totally abolished (Fig. 3c). This result highlights the importance of the “CG” in the core motif of “ACGTG” for bZIP recognition.

The expression of bZIP was found to be modulated by ABA as well as by various abiotic stresses (Chinnusamy et al. 2003; Zou et al. 2008; Nijhawan et al. 2008; Zhang et al. 2011b), indicating that bZIP is involved in the ABA-independent signaling pathway. However, other studies had also shown that bHLH genes seem to belong to different signaling pathways. Some bHLH family genes were involved in abiotic stress tolerance, but did not depend on ABA in its response to salt stress (Jiang et al. 2011; Zhou et al. 2009). For example, Li et al. (2007) observed that a bHLH (AtAIB) from Arabidopsis was induced by ABA and PEG treatments, thus suggesting involvement in the regulation of ABA signaling. We investigated whether PkbZIP2 and PkbHLH2 are regulated by ABA and osmotic stress. Results obtained using real-time PCR demonstrated that the transcripts of PkbZIP2 and PkbHLH2 were increased greatly by ABA treatment and osmotic stress. These results strongly supported the suggestion that they are stress responsive genes involved in the ABA-dependent signaling pathway. Both PkbHLH2 and PkbZIP2 were induced by ABA and osmotic stress, and shared similar expression patterns (Fig. 4), suggesting some relationship between them. In addition, PkbZIP2 appeared to be induced more highly than PkbHLH2 (Fig. 4), suggesting that PkbZIP2 was more sensitive to ABA than PkbHLH2. Furthermore, the one-hybrid result suggested that expression of PkbHLH2 was regulated by PkbZIP2 (Fig. 3a, b). This could imply that PkbZIP2 might be regulated directly by ABA, whereas PkbHLH2 was regulated indirectly by ABA. Therefore, we concluded that, under stress conditions, P. koreana produces ABA, which induces the expression of PkbZIP2, which binds to the ABRE motifs to regulate the expression of PkbHLH2. Finally, PkbHLH2 will regulate its target genes to complete the molecular responses associated with stress (Fig. 5).
Fig. 5

Proposed model for the roles of PkbHLH2 and PkbZIP2 in the ABA signaling pathway

In conclusion, our studies showed that both PkbZIP2 and PkbHLH2 are involved in the ABA-dependent signal transduction pathway as both can be up-regulated by ABA and osmotic stress. In the ABA dependent signal transduction system, PkbZIP2 was the upstream regulator of PkbHLH2, which perceives altered ABA level, is up-regulated by enhanced ABA levels, and binds to ABREs to induce expression of PkbHLH2 and other target genes.

Notes

Acknowledgment

This work was supported by National Natural Science Foundation of China (31000312).

References

  1. Bai Y, Pattanaik S, Patra B, Werkman J, Xie C, Yuan L (2011) Flavonoid-related basic helix-loop-helix regulators, NtAn1a and NtAn1b, of tobacco have originated from two ancestors and are functionally active. Planta 234:363–375PubMedCrossRefGoogle Scholar
  2. Busk PK, Pages M (1998) Regulation of abscisic acid-induced transcription. Plant Mol Biol 37:425–435PubMedCrossRefGoogle Scholar
  3. Chang S, Puryear J, Cairney J (1993) A simple and efficient method for isolating RNA from pine trees. Plant Mol Biol Rep 11(2):113–116CrossRefGoogle Scholar
  4. Chinnusamy V, Ohta M, Kanrar S, Lee B, Hong X, Agarwal M, Zhu JK (2003) ICE1: a regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis. Genes Dev 17:1043–1054PubMedCrossRefGoogle Scholar
  5. Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11–15Google Scholar
  6. Feller A, Hernandez JM, Grotewold E (2006) An ACT-like domain participates in the dimerization of several plant basic-helix-loop-helix transcription factors. J Biol Chem 281:28964–28974PubMedCrossRefGoogle Scholar
  7. Feller A, Machemer K, Braun EL, Grotewold E (2011) Evolutionary and comparative analysis of MYB and bHLH plant transcription factors. Plant J 66:94–116PubMedCrossRefGoogle Scholar
  8. Fernández-Calvo P, Chini A, Fernández-Barbero G, Chico JM, Gimenez-Ibanez S, Geerinck J, Eeckhout D, Schweizer F et al (2011) The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses. Plant Cell 23:701–715PubMedCrossRefGoogle Scholar
  9. Groszmann M, Bylstra Y, Lampugnani ER, Smyth DR (2010) Regulation of tissue-specific expression of SPATULA, a bHLH gene involved in carpel development, seedling germination, and lateral organ growth in Arabidopsis. J Exp Bot 61:1495–1508PubMedCrossRefGoogle Scholar
  10. Heim MA, Jakoby M, Werber M, Martin C, Weisshaar B, Bailey PC (2003) The basic helix–loop–helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity. Mol Biol Evol 20:735–747PubMedCrossRefGoogle Scholar
  11. Heisler M, Atkinson A, Bylstra YH, Walsh R, Smyth DR (2001) SPATULA, a gene that controls development of carpel margin tissues in Arabidopsis, encodes a bHLH protein. Development 128:1089–1098PubMedGoogle Scholar
  12. Ichihashi Y, Horiguchi G, Gleissberg S, Tsukaya H (2010) The bHLH transcription factor SPATULA controls final leaf size in Arabidopsis thaliana. Plant Cell Physiol 51:252–261PubMedCrossRefGoogle Scholar
  13. Jiang FL, Wang F, Wu Z, Li Y, Shi GJ, Hu JD, Hou XL (2011) Components of the Arabidopsis CBF coold-response pathway are conserved in non-heading Chinese cabbage. Plant Mol Biol Rep 29:525–532CrossRefGoogle Scholar
  14. Kim S, Kang J, Cho DI, Park JH, Kim SY (2004) ABF2, an ABRE–binding bZIP factor, is an essential component of glucose signaling and its overexpression affects multiple stress tolerance. Plant J 40:75–87PubMedCrossRefGoogle Scholar
  15. Li H, Sun J, Xu Y, Jiang H, Wu X, Li C (2007) The bHLH-type transcription factor AtAIB positively regulates ABA response in Arabidopsis. Plant Mol Biol 65:655–665PubMedCrossRefGoogle Scholar
  16. Liao Y, Zou HF, Wei W, Hao YJ, Tian AG, Huang J, Liu YF, Zhang JS et al (2008) Soybean GmbZIP44, GmbZIP62 and GmbZIP78 genes function as negative regulator of ABA signaling and confer salt and freezing tolerance in transgenic Arabidopsis. Planta 228:225–240PubMedCrossRefGoogle Scholar
  17. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25(4):402–408PubMedCrossRefGoogle Scholar
  18. Nieva C, Busk PK, Domínguez-Puigjaner E, Lumbreras V, Testillano PS, Risueño MC, Pagès M (2005) Isolation and functional characterisation of two new bZIP maize regulators of the ABA responsive gene rab28. Plant Mol Biol 58:899–914PubMedCrossRefGoogle Scholar
  19. Nijhawan A, Jain M, Tyagi AK, Khurana JP (2008) Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice. Plant Physiol 146:333–350PubMedCrossRefGoogle Scholar
  20. Penfield S, Josse EM, Kannangara R, Gilday AD, Halliday KJ, Graham IA (2005) Cold and light control seed germination through the bHLH transcription factor SPATULA. Curr Biol 15:1998–2006PubMedCrossRefGoogle Scholar
  21. Qi T, Song S, Ren Q, Wu D, Huang H, Chen Y, Fan M, Peng W et al (2011) The Jasmonate-ZIM-domain proteins interact with the WD-Repeat/bHLH/MYB complexes to regulate jasmonate-mediated anthocyanin accumulation and trichome initiation in Arabidopsis thaliana. Plant Cell 23:1795–1814PubMedCrossRefGoogle Scholar
  22. Rock CD (2000) Tansley review no. 120. Pathways to abscisic acid-regulated gene expression. New Phytol 148:357–396CrossRefGoogle Scholar
  23. Tang W, Michael P, Fei YJ, Liu LC, Xu F, Cai XD, Yuan LY, Wu QS, Zhou MQ (2012) Overexpression of AtbZIP60 deltaC gene alleviates salt-induced oxidative damage in transgenic cell cultures. Plant Mol Biol Rep 30:1183–1195. doi:10.1007/s11105-012-0437-3 Google Scholar
  24. Toledo-Ortiz G, Huq E, Quail PH (2003) The Arabidopsis basic/helix-loop-helix transcription factor family. Plant Cell 15:1749–1770PubMedCrossRefGoogle Scholar
  25. Xu HM, Wang Y, Chen F, Zhang XZ, Han ZH (2011) Isolation and characterization of the iron-regulated MxbHLH01 gene in Malus xiaojinensis. Plant Mol Biol Rep 29:936–942CrossRefGoogle Scholar
  26. Zhang J, Jia W, Yang J, Ismail AM (2006b) Role of ABA in integrating plant responses to drought and salt stresses. Field Crop Res 97:111–119CrossRefGoogle Scholar
  27. Zhang H, Hedhili S, Montiel G, Zhang Y, Chatel G, Pré M, Gantet P, Memelink J (2011a) The basic helix–loop–helix transcription factor CrMYC2 controls the jasmonate–responsive expression of the ORCA genes that regulate alkaloid biosynthesis in Catharanthus roseus. Plant J 67:61–71PubMedCrossRefGoogle Scholar
  28. Zhang X, Zhen JB, Li ZH, Kang DM, Yang YM, Kong J, Hua JP (2011b) Expression profile of early responsive genes under salt stress in upland cotton (Gossypium hirsutum L.). Plant Mol Biol Rep 29:626–637CrossRefGoogle Scholar
  29. Zhou J, Li F, Wang J, Ma Y, Chong K, Xu Y (2009) Basic helix-loop-helix transcription factor from wild rice (OrbHLH2) improves tolerance to salt-and osmotic stress in Arabidopsis. J Plant Physiol 166:1296–1306PubMedCrossRefGoogle Scholar
  30. Zou M, Guan Y, Ren H, Zhang F, Chen F (2008) A bZIP transcription factor, OsABI5, is involved in rice fertility and stress tolerance. Plant Mol Biol 66:675–683PubMedCrossRefGoogle Scholar

Copyright information

© Springer-Verlag 2012

Authors and Affiliations

  • Lin He
    • 1
  • Caiqiu Gao
    • 1
  • Yucheng Wang
    • 1
  • Yingjie Wu
    • 1
  • Zhihua Liu
    • 1
  1. 1.State Key Laboratory of Tree Genetics and BreedingNortheast Forestry UniversityHarbinChina

Personalised recommendations