Skip to main content
SpringerLink
Log in

Genomic sequence analysis of Helicoverpa armigera nucleopolyhedrovirus isolated from Australia

  • Annotated Sequence Record
  • Published:
Archives of Virology Aims and scope Submit manuscript

Abstract

The complete genomic sequence of Helicoverpa armigera nucleopolyhedrovirus from Australia, HearNPV-Au, was determined and analyzed. The HearNPV-Au genome was 130,992 bp in size with a G + C content of 39 mol% and contained 134 predicted open reading frames (ORFs) consisting of more than 150 nucleotides. HearNPV-Au shared 94 ORFs with AcMNPV, HearSNPV-G4 and SeMNPV, and was most closely related to HearSNPV-G4. The nucleotide sequence identity between HearNPV-Au and HearSNPV-G4 genome was 99 %. The major differences were found in homologous regions (hrs) and baculovirus repeat ORFs (bro) genes. Five hrs and two bro genes were identified in the HearNPV-Au genome. All of the 134 ORFs identified in HearNPV-Au were also found in HearSNPV-G4, except the homologue of ORF59 (bro) in HearSNPV-G4. The sequence data strongly suggested that HearNPV-Au and HearSNPV-G4 belong to the same virus species.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1

Similar content being viewed by others

References

  1. Gettig RR, McCarthy WJ (1982) Genotypic variation among wild isolates of Heliothis spp. nuclear polyhedrosis viruses from different geographical regions. Virol 117:245–252

    Article  CAS  Google Scholar 

  2. Parnell M, Grzywacz D, Jones KA, Brown M (2002) The strain variation and virulence of granulovirus of diamondback moth (Plutella xylostella Linnaeus, Lep., Yponomeutidae) isolated in Kenya. J Invertebr Pathol 79:192–196

    Article  PubMed  Google Scholar 

  3. Graham RI, Tyne WI, Possee RD, Sait SM, Hails RS (2004) Genetically variable nucleopolyhedroviruses isolated from spatially separate populations of the winter moth Operophtera brumata (Lepidoptera: Geometridae) in Orkney. J Invertebr Pathol 87:29–38

    Article  PubMed  Google Scholar 

  4. Cory JS, Green BM, Paul RK, Hunter-Fujita F (2005) Genotypic and phenotypic diversity of a baculovirus population within an individual insect host. J Invertebr Pathol 89:101–111

    Article  PubMed  Google Scholar 

  5. van Oers MM, Vlak JM (2007) Baculovirus genomics. Curr Drug Targets 8:1051–1068

    Article  PubMed  Google Scholar 

  6. Rowley DL, Popham HJR, Harrison RL (2011) Genetic variation and virulence of nucleopolyhedroviruses isolated worldwide from the heliothine pests Helicoverpa armigera, Helicoverpa zea, and Heliothis virescens. J Invertebr Pathol 107:112–126

    Article  PubMed  Google Scholar 

  7. Baillie VL, Bouwer G (2012) High levels of genetic variation within Helicoverpa armigera nucleopolyhedrovirus populations in individual host insects. Arch Virol 157:2281–2289

    Article  CAS  PubMed  Google Scholar 

  8. Baillie VL, Bouwer G (2012) High levels of genetic variation within core Helicoverpa armigera nucleopolyhedrovirus genes. Virus Genes 44:149–162

    Article  CAS  PubMed  Google Scholar 

  9. Zhang GY, Sun XL, Zhang ZX, Zhang ZF, Wan FF (1995) Production and effectiveness of the new formulation of Helicoverpa virus pesticide-emulsifiable suspension. Virol Sinica 10:242–247

    Google Scholar 

  10. Qin QL, Cheng QQ, Zheng JF, Chen XZ, Zhang ST, Li X, Miao L, Zhang H (2008) Production and application of Helicoverpa armigera nucleopolyhedrovirus bio-pesticides trademarked KEYUN on large scale. Biotechnol Bull pp 467–470

  11. Zhang CX, Ma XC, Guo ZJ (2005) Comparison of the complete genome sequence between C1 and G4 isolates of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus. Virol 333:190–199

    Article  CAS  Google Scholar 

  12. Chen XW, Ijkel WFJ, Tarchini R, Sun XL, Sandbrink H, Wang HL, Peters S, Zuidema D, Lankhorst RK, Vlak JM, Hu ZH (2001) The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome. J Gen Virol 82:241–257

    CAS  PubMed  Google Scholar 

  13. Ogembo JG, Caoili BL, Shikata M, Chaeychomsri S, Kobayashi M, Ikeda M (2009) Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs. Virus Genes 39:261–272

    Article  CAS  PubMed  Google Scholar 

  14. Chen XW, Zhang WJ, Wong J, Chun G, Lu A, McCutchen BF, Presnail JK, Herrmann R, Dolan M, Tingey S, Hu ZH, Vlak JM (2002) Comparative analysis of the complete genome sequences of Helicoverpa zea and Helicoverpa armigera single-nucleocapsid nucleopolyhedroviruses. J Gen Virol pp 673–684

  15. Tang P, Zhang H, Li YN, Han B, Wang GZ, Qin QL, Zhang ZF (2012) Genomic sequencing and analyses of HearMNPV-a new multinucleocapsid nucleopolyhedrovirus isolated from Helicoverpa armigera. Virol J 9:168

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  16. Chen Y, Lin X, Yi YZ, Lu YY, Zhang ZF (2009) Construction and application of a baculovirus genomic library. Z Naturforsch C 64:574–580

    CAS  PubMed  Google Scholar 

  17. Xiao H, Qi Y (2007) Genome sequence of Leucania seperata nucleopolyhedrovirus. Virus Genes 35:845–856

    Article  CAS  PubMed  Google Scholar 

  18. Guarino LA, Gonzalez MA, Summers MD (1986) Complete sequence and enhancer function of the homologous DNA regions of Autographa-californica nuclear polyhedrosis-virus. J Virol 60:224–229

    CAS  PubMed Central  PubMed  Google Scholar 

  19. Pearson M, Bjornson R, Pearson G, Rohrmann G (1992) The Autographa-californica baculovirus genome-evidence for multiple replication origins. Science 257:1382–1384

    Article  CAS  PubMed  Google Scholar 

  20. Theilmann DA, Stewart S (1992) Tandemly repeated sequence at the 3’ end of the ie-2 gene of the baculovirus Orgyia-pseudotsugata multicapsid nuclear polyhedrosis-virus is an enhancer element. Virol 187:97–106

    Article  CAS  Google Scholar 

  21. Bideshi DK, Renault S, Stasiak K, Federici BA, Bigot Y (2003) Phylogenetic analysis and possible function of bro-like genes, a multigene family widespread among large double-stranded DNA viruses of invertebrates and bacteria. J Gen Viro 84:2531–2544

    Article  CAS  Google Scholar 

  22. Zemskov EA, Kang WY, Maeda S (2000) Evidence for nucleic acid binding ability and nucleosome association of Bombyx mori nucleopolyhedrovirus BRO proteins. J Virol 74:6784–6789

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  23. Kang WK, Imai N, Suzuki M, Iwanaga M, Matsumoto S, Zemskov EA (2003) Interaction of Bombyx mori nucleopolyhedrovirus BRO-A and host cell protein laminin. Arch Virol 148:99–113

    Article  CAS  PubMed  Google Scholar 

  24. Kang WK, Kurihara M, Matsumoto S (2006) The BRO proteins of Bombyx mori nucleopolyhedrovirus are nucleocytoplasmic shuttling proteins that utilize the CRM1-mediated nuclear export pathway. Virol 350:184–191

    Article  CAS  Google Scholar 

  25. Li LL, Li OJ, Willis LG, Erlandson M, Theilmann DA, Donly C (2005) Complete comparative genomic analysis of two field isolates of Mamestra configurata nucleopolyhedrovirus-A. J Gen Virol 86:91–105

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgments

This work was supported by the grants from the “863” Project (2011AA10A204), the International Cooperation Project (2011-G4) and the Knowledge Innovation Program of the Chinese Academy of Sciences (KSCX2-EW-G-16).

Author information

Authors and Affiliations

  1. State Key Laboratory of Integrated Management of Pest Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences, Beijing, 100101, China

    Huan Zhang, Qing Yang, Qi-Lian Qin, Wei Zhu, Ning Zhang & Ji-Hong Zhang

  2. Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing, 100081, China

    Zhi-Fang Zhang & Yi-Nü Li

  3. Henan Jiyuan Baiyun Industry Co., Ltd, Henan, 459002, China

    Qing Yang

Authors
  1. Huan Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Qing Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Qi-Lian Qin
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Wei Zhu
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Zhi-Fang Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Yi-Nü Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Ning Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Ji-Hong Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding authors

Correspondence to Zhi-Fang Zhang or Ji-Hong Zhang.

Additional information

H. Zhang and Q. Yang contributed equally to the work.

Electronic supplementary material

Below is the link to the electronic supplementary material.

705_2013_1823_MOESM1_ESM.tif

Supplementary material 1 (TIFF 5591 kb) Supplementary Figure: HearNPV-Au repeated sequences containing type A repeats (tttaaaccggtcttggatcttttcgttcgaaacgggccgtgatcttttgtttcgactcgtgacc) (A) and type B repeats (aaaaaacaaattacgtcatcgacatagaatattgcatcatttttaaattcgaaactagcccgctttcatatgaaaccctcggcgaagatcgattatatttgttctagaacattcgacggcttgacccaaaaaaacaaatgacgtcat) (B) were aligned in Clustal X and displayed in GeneDoc. The repeats are denoted according to their presence in a homologous region (hr1–hr5), their type (a or b), their order in the hr, and whether they occur in the reverse orientation (r) or not. Shading is used to indicate conserved sequences. In type A repeats, black indicates >75 % identity, and grey indicates 55 %-75 % identity; in type B repeats, black indicates >90 % identity, and grey indicates 70 %-90 % identity. Direct repeats (boxed) in type B repeats are indicated

Rights and permissions

Reprints and permissions

About this article

Cite this article

Zhang, H., Yang, Q., Qin, QL. et al. Genomic sequence analysis of Helicoverpa armigera nucleopolyhedrovirus isolated from Australia. Arch Virol 159, 595–601 (2014). https://doi.org/10.1007/s00705-013-1823-3

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s00705-013-1823-3

Keywords

Search

Navigation