1 Introduction

Pomegranate (Punica granatum L.) is among the oldest and most significant cultivated crops that are widely known. The plant is grown extensively in tropical and subtropical climates as well as in other countries, such as Saudi Arabia, and is a member of the Lythraceae family [1, 2]. Consumption of pomegranate fruits often takes the form of juice or raw seeds. Phytoconstituents and antioxidants from the polyphenolic class, comprising tannins, polyphenols, and flavonoids, have been shown to be present in the fruit extract, along with essential minerals, acids, sugars, vitamins, polysaccharides, and polyphenols [3]. In addition, different parts of the plant have been evaluated for their possible medicinal benefits against conditions including cancer, cardiovascular issues, diabetes, and gum infections [4, 5]. Moreover, studies have shown antioxidant activity and changes to the physical and chemical composition of fruits as pomegranates develop [6]. The cultivar determines plant quality, and cultivars differ greatly in terms of their morphological, agronomical, and post-harvest properties [7, 8]. Some of these characteristics may be influenced by the environment, hindering the classification of cultivars based on morphological and/or chemical properties. Therefore, in order to measure the genetic diversity among pomegranate cultivars and to assist breeders in choosing and developing genotypes with better levels of quality and fidelity, it is crucial to discover molecular markers that are unaffected by the environment.

Molecular markers are important tools for genotype characterization and the identification of phylogenetic relationships between cultivars that are difficult to distinguish morphologically, thus aiding the management of accessions and breeding programs. Standard DNA barcodes, such as ITS2, rbcL, and trnH-psbA, have been suggested to differentiate between plant varieties and cultivars. Several studies have demonstrated the application of different molecular markers in pomegranates, including random amplified polymorphic DNA (RAPD) [9,10,11] simple-sequence repeats (SSRs) [12,13,14] Inter Simple Sequence Repeats (ISSR), amplified fragment length polymorphism (AFLP) [15, 16], sequence-related amplified polymorphism (SRAP) [17], 18–28S rDNA [18] and chloroplast microsatellites [19]. Several investigations have been carried out to identify pomegranate cultivars using chloroplast DNA barcodes, such as the trnH-psbA spacer, trnL‑F, Maturase K (matK), and cpDNA petA–psaJ/trnC–trnD [20,21,22].

Pomegranate is a valuable agricultural crop in the Al-Baha region of Saudi Arabia because of its high quality, which is mainly based on the fruit’s unique taste. These features made it a highly valued commodity in the region. Moreover, because of the economic and nutritional importance of pomegranate, a local festival is celebrated annually that is named after pomegranate. There are two different cultivars of pomegranate that are locally known as Bidah-red and Bidah-green. Pomegranate cultivated in the Al-Baha region has never been characterized using any molecular markers. Therefore, the purpose of the present study was to investigate the molecular phylogeny of two important pomegranate cultivars in Al-Baha, Saudi Arabia (Bidah-red and Bidah-green), using three DNA barcodes—ITS2, rbcL, and trnH-psbA. Phylogenetic analyses were performed between the two cultivars and the cultivars identified in GenBank. We believe that the study's findings will be useful for breeding plans and genetic conservation measures.

2 Materials and methods

2.1 Plant materials

Three randomly chosen trees of each of the two pomegranates cultivars growing on farms in the Al-Baha area of southern Saudi Arabia were sampled for their leaves.

2.2 DNA extraction, amplification, and sequencing

DNA was extracted from the samples using the cetyltrimethylammonium bromide (CTAB) method [23]. The amount of extracted DNA was measured using a UV spectrophotometer (NanoDrop 2000 Spectrophotometer: Thermo Scientific, UK). DNA was amplified using a Techne PCR thermal cycler (GMI, USA) with the primers ITS-S2F (5′ ATGCGATACTTGGTGTGAAT 3′) and ITS4rev (5′ TCCTCCGCTTATTGATATGC 3′) for the ITS region, rbcLaF (5′ ATGTCACCACAAACAGAGACTAAAGC 3′) and rbcLarev (5′ GTAAAATCAAGTCCACCRCG 3′) for the rbcL region, and psbAF (5′ CGCGCATGGTGGATTCACAATCC 3′) and t-rnH2 (5′ GTTATGCATGAACGTAATGCTC 3′) for the trnH-psbA region. The reaction mixture had a 50 μL volume, and the Polymerase Chain Reaction (PCR) was performed at the following temperatures: 94 °C for 3 min, followed by 35 cycles at 94 °C for 30 s, annealing for 40 s, and extension at 72 °C for 50 s. The annealing temperatures for ITS2, rbcL, and psbA-trnH were 55 °C, 58 ℃, and 60 °C, respectively.

Electrophoresis with 1.0% agarose gel was used to separate the PCR products, and Expin PCR Purification Kit (Gene ALL, Korea) was used for DNA purification. The amplicons were sequenced by Macrogen (Seoul, South Korea).

2.3 Sequence and phylogenetic analysis

All pomegranate cultivars' sequences were submitted to NCBI, and the Basic Local Alignment Search Tool (BLASTn) was used to compare them to previously published sequences in GenBank (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Accession numbers were given to all sequences that were submitted to GenBank. Highly similar sequences of pomegranate cultivars with clear cultivar names and references were retrieved. The sequencing data were aligned, trimmed, and analyzed using the MEGA11 program [24]. Using maximum likelihood and the Tamura 3-parameter model, a phylogenetic tree was generated [24]. To evaluate the reliability of the phylogenetic trees, 1000 bootstrap replicates were used.

3 Results

The amplification of the three loci was successful in all samples obtained from the two cultivars. For Bidah-red and Bidah-green, the accession numbers of ITS2 loci sequences are ON678157 and ON678153, respectively; those of rcbL loci sequences are ON873728 and ON873729, respectively; and those of trnH-psbA are ON873730 and ON873731, respectively as shown in Table 1.

Table 1 Information on retrieved sequences of ITS2, psbA-trnH, and rbcL loci
Full size table

After searching GenBank (NCBI) for ITS2, rbcL, and psbA-trnH sequences of Bidah-red and Bidah-green cultivars, a number of accessions were obtained; the sequences that were accompanied by a clear cultivar name and reference were included in the study. The retrieved sequences, accession numbers, names, and sites of collection of the cultivars are listed in Table 1.

The nucleotide sequences of all retrieved cultivars were analyzed along with those of the two cultivars under study using MEGA11. Sequence alignment revealed that the ITS2 region contained 84 Single Nucleotide Polymorphisms (SNPs) and 22 insertions and deletions (INDELs), whereas the psbA-trnH region contained six SNPs and four INDELs. In contrast, the rbcL region was uniform.

The Tamura 3-parameter model had the lowest Bayesian Information Criterion (BIC) scores; therefore, the evolutionary relationship between the two cultivars and other related cultivars was inferred using the maximum likelihood method and the Tamura 3-parameter model. Because the rbcL sequence was uniform for all cultivars, only the ITS2 and psbA-trnH sequences were used for analysis. The dendrogram based on ITS2 sequences consisted of two clades (Fig. 1). Clade 2 consisted of Bidah-red and Bidah-green cultivars, and clade 1 consisted of the remaining 36 cultivars retrieved from NCBI with an 87% bootstrap value as displayed in Fig. 1.

Fig. 1
figure 1

Evolutionary analysis using the maximum likelihood method for the ITS2 loci. Maximum likelihood and the Tamura 3-parameter model estimated the evolutionary history [24]. The Nodes display bootstrap values (in bold). The tree was drawn to scale, with branch lengths estimated by site substitutions (below the branches)

Full size image

The dendrogram based on psbA-trnH sequences consisted of three clades with 84% bootstrap value (Fig. 2). Clade 3 consisted of the Jangalhaye Asalem and Darya kenar babolsar cultivars; clade 2 consisted of only the Gol sefid cultivar; and clade 1 consisted of the remaining 15 cultivars, including Bidah-red and Bidah-green.

Fig. 2
figure 2

Evolutionary analysis using the maximum likelihood method for the psbA-trnH Loci. Maximum likelihood and the Tamura 3-parameter model estimated the evolutionary history [24]. The Nodes display bootstrap values (in bold). The tree was drawn to scale, with branch lengths estimated by site substitutions (below the branches)

Full size image

4 Discussion

The determination of plant varieties and cultivars has significant importance within the agricultural sector, mostly owing to the extensive range of plant varieties and cultivars that have been generated across various crop species. Nevertheless, the identification of plant varieties and cultivars based on basic morphological features presents challenges and difficulties, particularly when distinguishing closely related species. These challenges arise not only from the limited differences between these species but also from the technical constraints of the method of identification. Specifically, this process is tedious, requires significant labour, and experiences high costs.

The present study on pomegranate cultivars has demonstrated that ITS2, rbcL, and psbA-trnH barcodes can be used for distinguishing and clustering different cultivars of this species. ITS2, rbcL, and psbA-trnH have been previously suggested as core plant barcodes. The ITS2 region has been empirically shown to serve as a very effective barcode for plant authentication, owing to its multitude of potential advantages relative to its constraints. According to previous investigations on barcoding, the ITS2 region demonstrates superior capacity for species differentiation and sequence retrieval across various plant species [25, 26], Therefore, the ITS2 region has emerged as a favored choice for the selection of barcoding genes in the context of plant identification. Soliman et al. [27] have effectively distinguished and differentiated four Lantana ornamental plant types at the variety level with enhanced precision by using the ITS2 region for barcoding.

In the current study, ITS2 and psbA-trnH DNA barcodes fulfilled two basic requirements: the amplification rate was 100%, and polymorphism and variable sites were present between cultivars. Other molecular markers, such as RAPD, SSRs, ISSR, AFLP, SRAP, and 18–28S rDNA, have been extensively used to evaluate the genetic diversity of pomegranates. These markers were highly polymorphic among the pomegranate cultivars, and DNA barcoding is such a way for identifying and classifying many organisms at the species and genus levels utilizing markers. For example, Zhang et al. [28] developed a unique method for identifying pomegranate germplasms. Specifically, they focused on recording and using the polymorphic bands created by RAPD markers to construct a cultivar identification diagram. The primary limitations of RAPD lie in its reduced repeatability [29]. The study conducted by Amar and El-Zayat [30] demonstrated that the discriminating capacity (DC) analysis indicated that the SRAP test yielded higher-quality outcomes in terms of the number of alleles, number of polymorphic amplicons, and polymorphism information content for the classification of Egyptian pomegranates.

In addition, the pomegranate breeding plan used AFLP as another marker type. However, there is only one available report on this particular application, which involved screening 16 Tunisian cultivars [16]. The results of this study indicated a greater degree of polymorphism. Moreover, several SSR markers were used in pomegranate breeding and characterization studies [31]. However, the primary constraint associated with SSR markers is the complicated and time-consuming nature of the process.

Genetically, it is evident that pomegranates are highly diverse, owing to the existence of a large number of cultivars distributed across different habitats.

The role of the ITS2 barcode and its applications in the assessment of genetic diversity and analysis of genetic relationships between pomegranate cultivars have been reported previously [11]. Singh et al. [11] evaluated the nuclear rRNA and ITS regions and suggested using ITS2 as a DNA barcode for molecular genetic discrimination of pomegranate germplasm for crop improvement. In addition, rbcL, psbA-trnH, ITS, and matK were evaluated for their potential genetic diversity among the pomegranate genotypes [21]. Among these, psbA-trnH has been found to be the most effective in discriminating among cultivars owing to having the greatest number of variable regions among all the plant DNA barcodes [21]. In contrast, rbcL had the lowest ability to identify pomegranate genotypes [21]. These findings are in line with those of the present investigation, since rbcL failed to distinguish between those two pomegranate cultivars. This was because of the lack of variable sites in the rbcL loci of the sequences of the tested cultivars. The common use of rbcL as a DNA barcode has been attributed to its historical popularity rather than its usefulness in barcoding species [32]. Several studies have investigated the discriminating capacity of rbcL, and it has not been deemed the optimal barcode for seed plants [33,34,35].

The association between the morphological and geographical characterization of pomegranates and molecular classification was not evident in most studies. For example [36], used RAPD markers to evaluate diversity among 24 Iranian pomegranate cultivars, and the results indicated no correlation between the pomegranate genotype clusters obtained using the UPGMA method and morphological traits. Additionally, AFLP analysis, which was used to characterize 34 pomegranate cultivars, showed that the clustering of cultivars was independent of their geographical origin [16].

Moreover, the phenotypic divergence between pomegranate cultivars, such as soft- and hard-seeded pomegranates, was attributed to genomic variations and the expression of certain genes involved in sucrose transport and environmental adaptation [37].

However, in the current research, the cultivars Bidah-red and Bidah-green, belonging to the same geographical region, were present in the same cluster in both the phylogenetic trees. In fact, the influence of the environment on the genetic variation present within a given species is widely documented [38]. It may be inferred that population variations resulting from biotic or abiotic environmental changes have the potential to impact the majority, if not all, of living species [38,39,40]. The variations in ecological systems may be attributed to several factors, including climate change, pest outbreaks, and the more recent influence of human activities [41]. In addition, the influence of contemporary agricultural practices and other human-related activities on plant genetic resources has been confirmed [42].

Using ITS2 sequences, the maximum likelihood approach and the Tamura three-parameter model, a dendrogram was generated that unambiguously separated all P. granatum variants into two major clusters. The second cluster contained Bidah-red and Bidah-green cultivars with an 87% bootstrap value, while the first cluster contained the remaining varieties retrieved from GenBank, including wild and cultivated varieties from different geographical regions. Therefore, Bidah-red and Bidah-green can be considered as distinct cultivars.

The phylogenetic relationship between pomegranate varieties inferred using the maximum likelihood method and the Tamura 3-parameter based on the psbA-trnH loci clearly delineated all varieties of P. granatum into two main clusters (Fig. 2.). The first cluster comprised Bidah-red and Bidah-green cultivars, along with all sequences of pomegranate varieties retrieved from NCBI, except for Angalhaye Asalem and Darya kenar babolsar.

In addition, the multiple sequence alignment of all pomegranate sequences for the three loci revealed variation in the occurrence of SNPs and INDELs. However, the rbcl region was relatively uniform in all the varieties evaluated, which corroborates the suggestion that it is a weak DNA barcode to study intraspecies phylogeny [21]. ITS2 sequences in plants are associated with environmental adaptation [43]. In the present study, the ITS2 region exhibited higher polymorphism than psbA-trnH region, showing a greater genetic diversity among the selected pomegranate varieties. The clustering of Bidah-red and Bidah-green sequences implies that they may be closely related or have a history of adaptability to their respective locations, which might aid pomegranate breeding efforts.

5 Conclusions

This study's results will aid in the development of breeding programs and genetic conservation measures, which are primarily based on the quantity and distribution of genetic diversity in the genetic pool. Moreover, the characterization of superior cultivars is a prerequisite to improving crop production in Saudi Arabia. The present study focused on the examination of two significant pomegranate cultivars, namely Bidah-red and Bidah-green, which are prominently cultivated in the Al-Baha area of Saudi Arabia. These cultivars have garnered substantial interest in recent times owing to their distinctive sweet flavour. Given the limited knowledge on their phylogenetic characteristics, DNA barcoding techniques were used to investigate their genetic profiles. The ITS2 and psbA-trnH regions exhibited significant levels of polymorphism, enabling differentiation at the cultivar level. Conversely, the rbcL region had a consistent sequence, rendering it ineffective in distinguishing across cultivars. The two cultivars were shown to be grouped together in the same clade on the phylogenetic tree generated using the ITS2 and psbA-trnH sequences. This finding implies that they share a close evolutionary relationship or have undergone adaptation specific to their respective environments. The ITS2 region had a greater degree of variability compared to psbA-trnH. Consequently, the phylogenetic analysis using the ITS2 region revealed clear differentiation between Bidah-red and Bidah-green, confirming their separate cultivar status. Based on our findings, it can be inferred that the use of ITS2 and psbA-trnH DNA barcodes has the potential to authenticate and distinguish various pomegranate cultivars. Furthermore, these DNA barcodes hold promise in facilitating advancements in pomegranate quality via the application of molecular breeding. Because the cultivars Bidah-red and Bidah-green possess many desirable traits, such as high fruit sweetness, they may help improve other pomegranate cultivars.