Correction to: Gut Pathog (2017) 9:65 https://doi.org/10.1186/s13099-017-0215-8
In the original version of this article [1], published on 17 November 2017, Table 2 contains an error: the first “T” in the first sequence in the column ‘Consensus direct repeats (CDRs) sequences’ has been incorrectly underlined. In Table 2, the underlining indicates the Consensus sequence.
-
The sequence was originally underlined like this:
AACAGCACTTTCAATCAAGGGACTTACAA
-
The sequence should have been underlined like this:
AACAGCACTTTCAATCAAGGGACTTACAA
The original publication of this article has been corrected.
Reference
Bangpanwimon K, Sottisuporn J, Mittraparp-arthorn P, Ueaphatthanaphanich W, Rattanasupar A, Pourcel C, Vuddhakul V. CRISPR-like sequences in Helicobacter pylori and application in genotyping. Gut Pathog. 2017;9:65. https://doi.org/10.1186/s13099-017-0215-8.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Author information
Authors and Affiliations
Corresponding author
Additional information
The original article can be found online at https://doi.org/10.1186/s13099-017-0215-8.
Rights and permissions
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
About this article
Cite this article
Bangpanwimon, K., Sottisuporn, J., Mittraparp-arthorn, P. et al. Correction to: CRISPR-like sequences in Helicobacter pylori and application in genotyping. Gut Pathog 9, 72 (2017). https://doi.org/10.1186/s13099-017-0221-x
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s13099-017-0221-x