Background

Toxoplasmosis in dog, is recognized as an opportunistic disease which is characterized by neuromuscular, respiratory and gastrointestinal signs or by generalized infection [1]. Clinical canine toxoplasmosis rarely results from a primary infection [2] and congenital transmission by tachyzoites crossing the placenta from the infected mother to the foetus is also described [3]. In addition spontaneous abortion and foetal death have been observed in pregnant canines infected with oocysts or tachyzoites [4]. Toxoplasmosis is considered to be an important infectious disease in dogs with neurological signs but the similarity between symptomatic toxoplasmosis and neosporosis should be considered in the differential diagnosis [5].

Stray dogs in urban structures may play an underrated role in the T. gondii epidemiology also in humans, as they can easily act as mechanical carriers for oocyte parasites due to their frequent contact with contaminated environments [6]. They consume a variety of foods from garbage containers in the urban environment [7] and are highly likely to interact with synantropic animals such as stray cats by increasing the chance of spreading parasites [8]. The virulence of T. gondii is related to different genotypes that influence the progression and the severity of the disease in human and animals as well. Several studies in Europe and North America [9, 10] described that T. gondii presents a highly clonal population structure made up of three lineages: types I, II and III. The infection by types II and III lead to chronic persistence and production of tissue cysts in mice, whereas type I strain is extremely virulent, producing high levels of parasitemia, with increased risk of transplacentary transmission and severity of infection in developing foetuses [10]. Nevertheless, several studies of T. gondii isolates in human and animals in South America suggested a high genetic variability expressed by other genotypes [11,12,13].

Typing of T. gondii strains is important in epidemiological surveys, to know the distribution and virulence of different clones of the parasite among human and animal populations. Our study reports a severe clinical case of toxoplasmosis in a stray dog and showed that the detection of parasitic DNA in the tissue is a useful diagnostic method in facilitating early treatment of the disease, which is important for a prompt clinical recovery. These data confirm the importance of early diagnosis of toxoplasmosis in dog and how clinical signs are often related to specific genotypes.

Case presentation

A female stray dog approximately six-month of age was sighted nearby garbage containers with an evident paralysis of hind limbs by animalist volunteers in Santa Margherita Belice (37°41′34″N 13°01′16″E), in the province of Agrigento (south-west of Sicily, Italy). The dog was rescued and taken in a private veterinary clinic. The physical examination showed a muscular atrophy of the femoral region and hyperextension of hind limbs (Fig. 1). Body condition score (BCS) was 20% below ideal weight, ribs had almost no fat and the sensor state was depressed. Haematological values were normal and the dog did not show any neurological abnormalities. ELISA rapid tests (SNAP 4Dx® Plus; IDEEX) excluded tick-borne disease such as Lyme disease, ehrlichiosis and anaplasmosis diseases related to paralysis in dogs. A serological test for N. caninum (ID Screen® Neospora caninum indirect multi-species) resulted also negative but a positive response for T. gondii immunoglobulin G (IgG) antibodies was detected by agglutination test (Toxo-Screen DA- Biomèrieux). Two dilutions 1:40 and 1:4000 to avoid prozone effect were assayed as described previously [14]. The dog was positive only to 1:40 dilution.

Fig. 1
figure 1

Hyperextension of hind limbs before the treatment

Full size image

To confirm the suspect of T. gondii clinical infection, a muscle fibers biopsy was performed from superficial gluteus according to conventional method. Genomic DNA was extracted using E.Z.N.A Tissue DNA Kit (Omega bio-tek). PCR was performed to detect N. caninum or T. gondii DNA. Only an approximately 333 base pairs DNA fragment of T. gondii was amplified from the sample using a highly sensitive nested-PCR. The analyses were performed by a first PCR using NC 18S RNA sense primer (5’TGCGGAAGGATCATTCACACG 3′, Invitrogen) and NC25S RNA antisense primer (5’CCGTTACTAAGGGAATCATAGTT3’, Invitrogen), followed by a nested PCR using Toxo ITS1sense primer (5’GATTTG− CATTCAAGAAGC TGATAGTAT3’, Invitrogen) and Toxo ITS1 antisense primer (5’AGTTAGGAAGCA ATCTGAAAGCACATC, Invitrogen). as described in Vitale et al. [15].

The lineage type of T. gondii was determined by PCR-restriction fragment length polymorphism (RFLP) of the amplified SAG2 gene and by microsatellite (MS) markers in a multiplex PCR as described in Fuentes et al. [16] and Ajzenberg et al. [17] respectively. The amplified fragments of the SAG2 gene, 5′-end of 241 bp and 3′-end of 221 bp, were undigested with restriction enzymes Sau3AI (5′-end products) and with HhaI (3′-end products) clearly indicating genotype I.

Clonal type I infection was confirmed by MS analysis of the 12 alleles patterns (Table 1) estimated using GeneMapper analysis software (version 4.0; Applied Biosystem). Reference DNAs corresponding to the three main lineages (I, II and III) kindly donated by the European Reference Laboratory for Parasites in Rome were used for comparison and negative controls were run in each assay. To avoid cross contamination during molecular analysis all different steps (DNA extraction, PCR setting of all components, Samples DNA and negative control, reference DNAs addition) were always performed in separate rooms.

Table 1 Genotyping results with 12 MS markers in a single multiplex PCR assay
Full size table

The dog was treated according to the principles of good clinical practice and specific therapy for toxoplasmosis was initiated immediately after the diagnosis with Clindamycin hydrochloride (25 mg/kg orally twice daily for 4 weeks). In addition, classical and aquatic physiotherapy was performed to help solve the muscular atrophy. After the first week of treatment the dog started to move the hind limbs; after 2 weeks of treatment was able to stay in quadruped station (Fig. 2). In the third week of treatment the dog regained partial ambulation and after 4 weeks the ambulation returned to normal.

Fig. 2
figure 2

Dog performance after two weeks of treatment. Fully recovery was obtained after four weeks

Full size image

Discussion and conclusions

Our study reported a rare case of clinical toxoplasmosis in a stray dog due to clonal type I infection. The detection of parasitic DNA in the tissue can be a useful diagnostic method in vivo to facilitate early treatment of the disease, which is important for a timely clinical recovery.

Clonal type I is a particularly virulent strain in mice but has been associated with some severe cases of toxoplasmosis in humans [10, 16]. It is considered sporadic in Europe where a high prevalence of clonal type II with several subgroups has been observed in many cases [17,18,19]. The detection of this clonal type in Sicily in a stray dog suggests the opportunity for further studies in stray animal populations.

The control of its circulation is important for public health, especially in south Italy where a high population of stray cats and dogs is present in urban and periurban areas. Stray dogs, feeding at the same garbage containers where cats and rodents feed also, might have more chance to get contaminated with T. gondii oocysts and to spread them to larger areas of the cities.