Background

miRNAs participate in the regulation of the expression of protein-coding genes at the post-transcriptional stage [1]. miRNAs, as a part of the RNA-induced silencing complex, bind to mRNAs and interfere with translation or promote mRNA destruction [2]. In the last two decades, properties of miRNAs and their influences on the expression of the genes involved in all key cellular processes have been established. The actions of miRNAs on the cell cycle [3], apoptosis [4], differentiation [5], and growth and development of plants [6] and animals [7] have been shown. Connections between miRNA expression and the development of various diseases have been established. miRNA concentrations change in cancer [8] and cardiovascular diseases [9]. Metabolic perturbations change miRNA concentrations in cells [10]. The aforementioned roles do not encompass all of the biological processes in which miRNAs participate, which further proves the importance of their biological functions. Despite the significant success in the study of miRNA properties, there are obstacles in identifying the target genes of miRNAs. Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs, which significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. There are more than 2,500 miRNAs in the human genome, and they are believed to act on 60% or more genes. Therefore, it is difficult to draw specific conclusions about the participation of miRNAs in specific biological processes, and until then the connections between the majority of miRNAs and their target genes will remain unknown. Recently, a set of unique miRNAs (umiRNA) were identified that have hundreds of target genes and bind to mRNAs with high affinity [11,12,13,14]. The binding sites of these umiRNAs are located in the 3’UTRs, CDSs, and 5’UTRs of mRNAs. Among these umiRNAs, miR-619-5p interacts with the largest number of target genes that have the greatest number of binding sites with complete complementarity of miR-619-5p and mRNAs. It is necessary to identify many miRNA binding sites in the mRNAs of these genes for the control of gene expression. Furthermore, it is important to control the expression of the corresponding gene complexes that are functionally associated with miRNAs. Therefore, we have studied a unique miR-619-5p that binds to the mRNAs of several hundred human and orthologous genes.

Methods

The nucleotide sequences of mRNAs of human genes (Homo sapience – Hsa) and orthologous genes (Bos mutus - The wild yak (Bmu), Callithrix jacchus – The common marmoset (Cja), Camelus dromedarius – Arabian camel (Cdr), Camelus ferus – The wild Bactrian camel (Cfe), Chlorocebus sabaeus – The green monkey (Csa), Colobus angolensis palliatus – The Angola colobus (Can), Equus caballus - The horse (Eca), Gorilla gorilla - The western gorilla (Ggo), Macaca fascicularis – The crab-eating macaque (Mfa), Macaca mulatta – The rhesus macaque (Mmu), Macaca nemestrina - Pig-tailed macaque (Mne), Mandrillus leucophaeus – The drill (Mle), Nomascus leucogenys - The northern white-cheeked gibbon (Nle), Ovis aries – The sheep (Oar), Pan paniscus - Bonobos (Ppa), Pan troglodytes – The common chimpanzee (Ptr), Papio anubis – The olive baboon (Pan), Pongo abelii - The Sumatran orangutan (Pab), Rhinopithecus roxellana – The golden snub-nosed monkey (Rro)) were downloaded from NCBI GenBank (http://www.ncbi.nlm.nih.gov) [15] in FASTA format using Lextractor002 script [11]. Nucleotide sequences of human mature miR-619-5p (GCUGGGAUUACAGGCAUGAGCC) were downloaded from the miRBase database (http://mirbase.org) [16]. The miR-619-5p binding sites in the 5’-untranslated regions (5’UTRs), the coding domain sequences (CDSs) and the 3’-untranslated regions (3’UTRs) of several genes were predicted using the MirTarget program [12]. This program defines the features of binding: a) the localization of miRNA binding sites in the 5’UTRs, the CDSs and the 3’UTRs of the mRNAs; b) the free energy of hybridization (∆G, kJ/mole). The ratio ΔG/ΔGm (%) was determined for each site (ΔGm equals the free energy of miRNA binding with its perfect complementary nucleotide sequence).

Results

The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. The mRNAs have different miRNA binding site origins, lengths, quantities, and properties. The list of miR-619-5p target genes and the positions of binding sites are outlined in Table 1. miR-619-5p is 22 nucleotides in length and is coded by an intron of the slingshot protein phosphatase 1 (SSH1) gene, which is located on chromosome 12 [17, 18]. mRNAs of 201 genes have complete complementary binding sites for miR-619-5p (ΔG/ΔGm = 100%). Therefore, the energy of interaction of miR-619-5p with mRNA of all the genes listed in the table is the same and equal to ΔG = −121 kJ/mole.

Table 1 Positions of miR-619-5p binding sites and disease or function of target genes
Full size table

The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3’UTR (214 sites), CDS (3 sites), and 5’UTR (4 sites). The mRNAs of 27 genes have four binding sites, seven genes have five binding sites, and CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites. The mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these sites are located in the 3’UTRs of mRNAs.

The target genes of the miR-619-5p carry out one or more different functions and are involved in the development of various diseases (Table 1).

The mRNAs of the C17orf75, C8orf44, CIAO1, CPM, CYP20A1, DCAF10, FKBP14, RAB3IP, SYNJ2BP, VHL genes have two complete complementary binding sites for miR-619-5p, and the mRNA of the CACNG8 gene has three such binding sites. This indicates a stronger dependence of the expression of these genes on miR-619-5p.

One of the methods to establish the credibility of the presence of miRNA binding site in the mRNA is to verify this site in the mRNAs of orthologous genes. In finding the miRNA binding sites raises the question of the level of reliability of the found sites. One effective way to establish the credibility of the binding sites is to establish binding sites in the orthologous genes and the identification of orthologous miRNA. Location of binding site in the protein coding region facilitates its conservation in evolution, especially if the corresponding oligopeptide plays an important role in the function of the protein. miR-619-5p binding sites with complete complementarity (ΔG/ΔGm is 100%) to the mRNAs of the four genes are located in the 5’UTRs (Table 2).

Table 2 Variation of positions and nucleotide sequences of miR-619-5p binding sites in the 5’UTRs of mRNAs of mammal genes
Full size table

Before the 5’ end and after the 3’ end of miR-619-5p binding site, nucleotides are not homologous. The mRNAs of RGS3 and USP29 orthologous genes have binding sites in H. sapiens, N. leucogenys, P. abelii, M. leucophaeus, C. angolensis palliatus, G. gorilla, and R. roxellana.

miR-619-5p has two binding sites in the 5’UTRs of mRNAs of ANAPC16, CYB5D2, and PRR5 and three binding sites in the mRNA of DNASE1.

mRNAs of some genes have binding sites for miR-619-5p within their 5’UTRs and 3’UTRs or CDSs and 3’UTRs. For example, ATAD3C, C14orf182, and CYB5RL have miR-619-5p binding sites in the 5’UTRs and 3’UTRs, and C8orf44, ISY1, and ZNF714 have miR-619-5p binding sites in the CDSs and 3’UTRs.

The nucleotide sequences of miR-619-5p binding sites are located in the CDSs of the C8orf44, C8H8orf44, ISY1, ZNF429, and ZNF714 genes and encode the following oligopeptides (Table 3).

Table 3 Variation of amino acid sequences coding in miR-619-5p binding sites in the mRNAs of orthologous genes
Full size table

C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is also present in the orthologous proteins of P. abelii, P. anubis, P. paniscus, and P. troglodytes. The mRNA of transcription factor ZNF429 and ZNF429 genes binding sites are encoded the AHACNP oligopeptide in the another reading frame. The first two oligopeptides are encoded in one open reading frame (ORF) and the amino acid sequences are highly conserved. The homologous oligonucleotide of the miR-619-5p binding site in the mRNA of ZNF714 gene codes for an oligopeptide in a different ORF.

The presence of miR-619-5p binding sites in the CDSs of five genes with different functions and the evolutionary conservation of these sites signify the role of miRNA in the regulation of the expression of these genes. The nucleotide sequences of specific regions of mRNAs of C8H8orf44, C8orf44, ISY1, ZNF429, and ZNF714 genes that contain miR-619-5p binding sites in the CDSs are homologous among themselves and to the binding sites located in the 5’UTRs and 3’UTRs.

The miRNA binding sites in the coding region, as opposed to the 3’UTR and 5’UTR, clearly demonstrate the relationship between miRNA and mRNA by their conserved amino acid sequences in orthologous proteins. miRNA binding site can be translated by two open reading frames that encode WLTPVIPA and AHACNPS oligopeptides. In the third reading frame, the miR-619-5p binding site has a stop codon. However, in the genes studied, no such sequence was found. In the absence of complete complementarity between miR-619-5p and its binding site, miR-619-5p uses a site containing the corresponding mutation in the CDS for the regulation of gene expression. Thus, a single miRNA binding site in the mRNA of various genes may correspond to three different oligopeptides. Generally, one out of these three oligopeptides is present in the proteins encoded by the orthologous genes.

ISY1 orthologous genes in H. sapiens, P. troglodytes, and N. leucogenys encode a protein containing QVRWLMPVIPALWEAEAGGSQA oligopeptide sequence (Table 4).

Table 4 Amino acid sequences coding in miR-619-5p binding sites in the mRNA of ISY1 gene of orthologous genes
Full size table

However, the RAB43 gene, which is paralogous to human ISY1, lacks the nucleotide sequence encoding the QVRWLMPVIPALWEAEAGGSQA oligopeptide. Additionally, ISY1 gene in the genomes of other animals also lacks the nucleotide sequence encoding this oligopeptide (Table 4).

Nucleotide sequences of miR-619-5p binding sites in the mRNAs of ADAM17, ALDH3A2, and ARL11 orthologous genes are shown in Table 5.

Table 5 Variation of nucleotide sequences of miR-619-5p binding sites in the 3’UTR of mRNAs of ADAM17, ALDH3A2, and ARL11 of orthologs
Full size table

These orthologous genes are characterized by highly conserved nucleotide sequence GGCTCATGCCTGTAATCCCAGC of miR-619-5p binding sites. This shows that the interaction of miR-619-5p with mRNAs of these genes is conserved during evolution. Some of the human miR-619-5p target genes and their corresponding orthologous genes have two miR-619-5p binding sites in their mRNAs.

Table 6 shows the nucleotide sequences of two miR-619-5p binding sites in the 3’UTR of mRNAs of ERBB3, FBLIM1, and FKBP14 orthologous genes.

Table 6 Variation of nucleotide sequences of two miR-619-5p binding sites in the 3’UTR of mRNAs of ERBB3, FBLIM1, and FKBP14 of orthologs
Full size table

Table 7 shows the degree of conservation of miR-619-5p binding sites in the 201 mRNAs of target genes. All mRNAs with complete complementarity to miR-619-5p binding sites (ΔG/ΔGm is 100%) were divided into four groups, and the frequency of occurrence of nucleotides was determined in each group. The results suggest that miR-619-5p binding sites are highly conserved. The binding site GGCTCATGCCTGTAATCCCAGC does not change and in each of the four gene groups the observed variability of nucleotides on the right and left is high.

Table 7 Variation of nucleotide sequences of mRNA region with miR-619-5p binding sites (See Additional file 1, 2, 3 and 4)
Full size table

Discussion

Here we have identified many miRNAs binding sites in the mRNAs of 201 human genes which indicates that umiRNAs act as coordinators of gene expression by participating in many biological processes. Previous studies have shown the influences of miRNAs on the expression of genes that encode the transcription factors [19, 20] and on the expression of proteins that participate in the cellular cycle [3, 21,22,23], apoptosis [4, 24,25,26], and stress responses [27]. It was shown the role of the mir-619-5p in the regulation of different pathological processes [28]. It was investigated the correlations between the expression of MALAT1 and miR-619-5p, in addition to the association between the clinicopathological features and survival outcomes of patients with stage II and III colorectal cancer tumors [28]. It was observed, that hsa-miR-619-5p and hsa-miR-1184 microRNA expression significantly increased in prostatic cancer. MicroRNA-gene-net analysis indicated that miR-619-5p and other some miRNAs had the most important and extensive regulatory function for Qi-stagnation syndromes and Qi-deficiency syndromes in coronary heart disease [29].

One or several umiRNAs regulating the expression of hundreds of genes can create a system of interconnected processes in cells and organisms. Such role of these umiRNAs is possible because they circulate in the blood and have access to nearly all cells of an organism [30,31,32]. Our results provide the basis for studying the systemic roles of unique and normal miRNAs in the regulation of gene expression in human cells. The expression of many target genes is regulated by umiRNAs does not allow individual mRNAs of target genes to be expressed in more degree than others. The greater expression of one mRNA, the larger number of umiRNAs bind to this mRNA. This allows one umiRNA to maintain a certain balance of expression of the corresponding target genes. If umiRNA expression changes, such system is vulnerable. This will cause the development of pathology in the cell, tissue or body.

Conclusions

The majority of miR-619-5p binding sites are located in the 3’UTRs of mRNAs of target genes. Some genes have miRNA binding sites in the 5’UTRs of mRNAs. It is necessary to maintain nucleotide sequences of the binding site of umiRNA in the CDSs of several genes. Different genes have binding sites for miRNAs that are read in different open reading frames. Therefore, identical nucleotide sequences encode different amino acids in different proteins. In encoded proteins, these sites encode conservative oligopeptides. The binding sites of miR-619-5p in 3’UTRs, 5’UTRs and CDSs are conservative in the orthologous mammalian genes.