Introduction

The genus Pseudomonas , subclass Gammaproteobacteria , is an ubiquitous and metabolically versatile bacterial genera and is currently the genus of Gram-negative bacteria with the largest number of species [1]. Since it first description in 1894 [2], an increasing number of species has been described in diverse environments [3,4,5]; and now this genus comprises 255 validly named species, and 13 subspecies, according to the list published in the Namesforlife Database [6]. Psychrophilic environments are the common habitats of the Pseudomonas genus. There are several isolated pseudomonads bacteria from water, freshwater and soils at low temperatures, such as psychrophilic strains of P. aeruginosa , P. fluorescens , P. putida , P. syringae , P. antarctica , P. meridiana and P. proteolytica [5, 7,8,9] and recently P. extremaustralis [10]. The type strain of the species P. extremaustralis was isolated from a temporary pond in Antarctica [10, 11]. This species presents high levels of oxidative stress and cold resistance along with production of high levels of polyhydroxybutyrate (PHB) [11,12,13]. It is also able to tolerate and to degrade hydrocarbons, allowing it to be used in extreme environments for hydrocarbon bioremediation [14]. The polyhydroxyalkanoate synthase genes are located within a genomic island, which was probably acquired by horizontal gene transfer [11, 12, 15]. Furthermore, P. extremaustralis grows under microaerophilic conditions and forms well developed biofilms that degrades long-chain and branched alkanes, while only medium-chain length alkanes are degraded by planktonic cells [14,15,16].

The type strain CT14–3T (DSM 17835) of P. extremaustralis , and its natural derivative, the strain 14–3b (DSM 25547) have been studied for a long time, but no other strains of this species have been reported to our knowledge. We have been involved on microbial diversity studies in the Nevados National Natural Park (Nevados NNP) that harbors different extreme environments, such as permanent snows, superparamo, paramo and thermal springs associated to volcanic activity [17, 18]. These studies aim to isolate and analyze culture collections of different microbes present in these habitats.

Here we present the physiological features of P. extremaustralis strain USBA-GBX-515, isolated from soils in Superparamo ecosystems, in the northern Andes of South America, as well as its draft genome. A genomic comparison with the type strain is also presented.

Organism information

Classification and features

Samples were collected in 2010 from Superparamo soil samples within the Nevados NNP at >4000 m.a.s.l with soil temperature of 9.8 °C, and pH of 5.2. Paramo and superparamo are Andean ecosystems in the neotropical high mountain biome [19].

Enrichment was initiated by resuspending 10 g of rhizospheric soil samples into M9 basal medium (BM) during 30 m at 150 r.p.m. Then, the cultures were serially diluted, inoculated into M9 BM (10−2 to 10−6) and amended with 10 mM tributyrin at pH 6.0, and then incubated at 30 °C for two weeks. The M9 basal medium contained: 0.5 g NaCl, 3 g KH2PO4, 6 g Na2HPO4, 1.0 g NH4Cl, and 0.05 g yeast extract. We obtained pure colonies using agar plates with the same medium. Several of the pure isolates obtained were morphologically similar and 16S rRNA genes were 99% similar among them (data not shown). One strain, designated strain USBA-GBX-515, was selected for this study. The isolated bacterium was stored since the collection date at the Collection of Microorganisms of Pontificia Universidad Javeriana as P. extremaustralis strain CMPUJU 515 (CMPUJ, WDCM857). The general features of the strain are reported in Table 1.

Table 1 Classification and general features of Pseudomonas extremaustralis strain USBA-GBX 505, according to MIGS standards [24]
Full size table

Growth was assayed at different pHs (4.5 to 8.5) following the protocols described by Rubiano et al. (2013) [20], with the optimal growth pH being 7.0. Also, different growth temperatures (from 4 °C to 35 °C) were tested and although growth was observed at all temperatures, the optimum temperature was determined as 30 °C. Strain USBA-GBX-515 is a Gram-negative rod shaped bacterium of 1.0–3.0 μm × 0.5–1 μm (Fig. 1), aerobic, motile and unable to form spores. Cells present one single flagellum. Colonies are small, smooth, circular and they did not show pigments on Luria Bertani (LB) medium but fluorescent pigments were observed on Centrimide and King B agar. Using the API ZYM strip (BioMérieuxMarcy l’Etoile, France) positive reactions were observed for catalase and oxidase. The API50CH and API 20 (BioMérieux) tests showed positive reactions for L-arginine, sodium citrate and nitrate, nitrite, and negative for starch, casein, urea, indole, D-mannitol, L-arabinose and gelatin. Strain USBA-GBX-515 exhibited alkaline phosphatase and phosphohydrolase activities. This strain presents susceptibility to imipenem, piperacilin, ticarcilin, meropenem, levofloxacin, ceftriaxone, cefoxitin and ceftazidime. On the other hand, strain USBA-GBX-515T showed resistance to penicillin, colistin or polymyxin E, and nitrofurantoin.

Fig. 1
figure 1

Scanning electron micrograph of P. extremaustralis USBA-GBX-515 in exponential phase. The image was obtained under a JSM6490 Scanning Electron Microscope at an operating voltage of 20.0 kV, using a modified protocol of Read & Jeffree [70]. Scale bar represents 5 μm

Full size image

Due to our particular interest on lipase enzymes, we also evaluated the lipolytic activity of strain USBA-GBX-515, following the protocols described in [21]. We observed growth on Tween 80, olive oil, triolein, tricaprylin and tributyrin when these compounds were used as carbon sources. We measured the lipolytic activity using p-nitrophenyl butyrate during its growth for 42 h at 30 °C, using tributyrin as carbon source. We detected the maximum activity, 2.0 UL μmol/L/min at 15 h at the end of the exponential phase, as previously reported for the species of the genus [22, 23]. Additionally, we observed the higher activity in the extracellular fraction than in the intracellular fraction.

Analysis for initial phylogenetic inferences was done using universal amplification primers 27F (5′ CAGAGTTTGATCCTGGCTCAG 3′) and 1492R (5′ TACGGYTACCTTGTTACGACTT 3′). PCR products were sequenced using Sanger technology with an eight capillary Applied Biosystems GA-3500 sequencer. Neighbor-joining phylogenetic tree reconstruction was done using MEGA 7.0.25. Phylogenetic analysis of the 16S rRNA gene sequence (Fig. 2) confirmed that USBA-GBX-515 is a member of Pseudomonas genus. The most closely related strain was P. extremaustralis CT14–3T and then, our isolate was assigned to P. extremaustralis , by comparison of the 16S rRNA sequence. Strain USBA-GBX-515T exhibited a 100% 16S rRNA sequence identity (e-value = 0.0) with P. extremaustralis CT14–3T.

Fig. 2
figure 2

Phylogenetic tree based on 16S rRNA gene sequences showing the phylogenetic position of Pseudomonas extremaustralis USBA-GBX-515. Bootstrap values were based on 1000 resamplings. Sequence accession numbers are given in parentheses

Full size image

P. extremaustralis strain USBA-GBX-515 was stored at the Collection of Microorganisms of Pontificia Universidad Javeriana (CMPUJ, WDCM857) (ID CMPUJ U515) with the ID USBA-GBX 515, growing aerobically on the same medium as mentioned above. Cells were preserved at −20 °C in BM supplemented with 20% (v/v) glycerol.

Genome sequencing information

Genome project history

The strain was selected to sequencing on the basis of its metabolic versatility and the biotechnological potential as revealed by previous studies [10,11,12]. This work is part of the bigger study aiming at exploring the microbial diversity in extreme environments in Colombia. More information can be found on the Genomes OnLine database under the study Gs0118134. The JGI accession number is 1,094,800 and consists of 69 scaffold. Table 2 depicts the project information and its association with MIGS version 2.0 compliance [24]. The USBA-GBX-515T draft Genome has the ENA accession number FUYI01000001-FUYI01000069, and is also available through the Integrated Microbial Genomes system under the accession 2,671,180,025.

Table 2 Project information
Full size table

Growth conditions and genomic DNA preparation

Pseudomonas extremaustralis strain USBA-GBX-515 grew aerobically on LB medium at 30 °C. A 1 mL of overnight culture was centrifuged for 2 min at 13000 g. the pellet was immediately used for DNA extraction using the Wizard SV GEnomic DNA purification kit (Promega, USA). The integrity and quality of the DNA was verified using agarose gels (Sigma-Aldrich, St. Louis, USA) 0.8% (w/v) and using the NanoDropTM system (Thermo Scientific). The genomic DNA concentration was measured by the Qubit® dsDNA by fluorometric quantitation (Invitrogen, USA).

Genome sequencing and assembly

Genomic DNA for Pseudomonas extremaustralis strain USBA-GBX-515 was sequenced on a HiSeq 2500 sequencer (Illumina, SanDiego, CA, USA) with a paired-end strategy (PE150) of 300-bp reads. The sequencing platform generated 10,817,988 reads. After trimming a total of 10,000,000 paired end reads were obtained and assembled into 77 contigs and 69 scaffolds using ALLPATHS [25] and Velvet [26] softwares. All samples were processed using BUSCO [27], which offers a measure for quantitative assessment of genome assembly and annotation quality based on evolutionarily informed expectations of gene content. With the raw data (FastQ read files), the estimated genome size was calculated using different k-mer sizes in Kmergenie [28]. Finally, to obtain assembly metrics of the different genomes, QUAST [29] was run. The draft genome of P. extremaustralis strain USBA-GBX-515 consisted of 6,143,638 Mb with a G + C content of 60.9% mol. Table 3 contains all the genome statistics.

Table 3 Genome statistics
Full size table

Genome annotation

Genes were identified using Prodigal [30] as part of the DOE-JGI Annotation pipeline [31, 32]. The predicted CDSs were translated and used to search the National Center for Biotechnology Information (NCBI) non-redundant database, UniProt, TIGRFam, Pfam, PRIAM, KEGG, COG, and InterPro databases. Additional gene prediction analysis and functional annotation was performed within the Integrated Microbial Genomes (IMG-ER) [33].

Biosynthetic clusters were predicted running antiSMASH [34], BAGEL3 [35] and NaPDoS [36]. AntiSMASH was run using the GenBank file generated during annotation from the IMG-ER as the input. Before running the antiSMASH server tool, ClusterFinder algorithm [37], whole-genome PFAM analysis [38] and Enzyme Commission (EC) number prediction were selected. BAGEL3 is a tool specialized in predicting RiPPs and Bacteriocins using as FASTA file as the input. Finally, the NaPDoS tool was run four times per genome; first with a FASTA nucleotide file as the input and seeking KS domains and second with the same input but seeking C domains. The third and fourth runs were with FASTA amino acid files, seeking KS and C domains respectively. A list of all biosynthetic clusters is available through IMG and IMG-ABC systems [32, 39].

Genome properties

The genome of Pseudomonas extremaustralis strain USBA-GBX-515 is 6,143,638 bp –long with a G+ C content of 60.9 mol%. A total of 5665 genes were predicted and of those, 5544 were protein coding genes and 121 RNA genes. The properties and statistics of the genome are summarized in Table 3, of the total CDSs, 72.2% represent COG functional categories. The distribution of genes into COGs functional categories is presented in Table 4. Most genes were classified in the category of amino acid transport and metabolism (10.5%), followed by transcription (8.38%) and signal transduction mechanisms (7.3%).

Table 4 Number of genes associated with general COG functional categories
Full size table

Insights from the genome sequence

We performed taxonomic genome comparisons between Pseudomonas USBA-GBX-515 and P. extremaustralis strain CT14–3T. The average nucleotide identity (ANI) calculated with the MiSI (Microbial Species Identifier) method [40] is 98.9% with an Alignment Fraction (AF) of 0.91. Using GGDC web server version 2.1 [41], the DNA-DNA hybridization was calculated, and it showed 96.7% of similarity; the difference in G + C content was less than 1% (0.27 of difference) within both strains. Finally, a pairwise genome alignment performed with Mauve [42] between our strain and the type strain CT14–3T of P. extremaustralis (17835T) was performed, showing the similarity and conserved synteny of genes (Fig. 3). There are few regions that were unassembled in our genome and those remain in small separated contigs. All analyses corroborate the affiliation of our strain to the species P. extremaustralis .

Fig. 3
figure 3

Multiple Alignment performed using Mauve [42] of P. extremaustralis genomes. The type strain CT14–3T of Pseudomonas extremaustralis (17835T) is shown in the top and the strain USBA-GBX 515 described here at the botton. Conserved blocks are represented with direct lines from type strain to our strain showing synteny of genes among the genome. Small regions between conserved blocks from type strain are assembled in small contigs at the end of our genome

Full size image

This isolate was screened for lipolytic activities, and the genome analysis showed two genes lip515A and est515A related to a triacylglycerol lipase and carboxylesterase, respectively. Both genes showed a conserved α/β hydrolase motif which is common in lipolytic enzymes [43, 44], and are required for the lipids and fatty acid metabolisms. Particularly, the deduced amino acid sequence (296aa) from Gene lip515A showed an identity of 49% (E value 3e-80) with a triacylglycerol lipase from Pseudomonas fragi [45], while gene est515A had a 68% identity (E value 2 e-85) with a hypothetical protein from Colwellia sp. TT2012.

Ammonification genes were also observed, mainly nitrate reductase genes (narG,H,I,J,L,X and napA). Markers of nitrifying bacteria, norB and nosZ reductases were found, both genes were described previously in Pseudomonas stutzeri , a nitrate respiring bacterium [46]. We found a norVW gene, which has a role in protection against reactive nitrogen intermediates [47, 48]. A total of 732 genes were identified to play a role in amino acid transport and metabolism, which depends on nitrogen fixation metabolism.

The presence of proline operon proHJ and proA gene demonstrate the response to high osmolarity due to the de novo synthesis of proline as a stress protectant of the cell [49]. Cell protection from toxic effects of hydrogen peroxide was determined by the presence of the catalase (katE) gene.

Similar to previously observed on P. extremaustralis CT14–3T, we found genes related with the synthesis of poly-hydroxyalkanoates (PHAs). Especially poly-hydroxybutyrates genes (PHBs), were detected in the bacterial genome using BlastP (e-value <0.05 and 90% coverage of the gene). The phaABC operon was present, containing the PHA synthase (phaC), β-ketothiolase (phaA), and NADP-dependent acetoacetyl-CoA reductase (phaB). The phbABC operon is also present into the genome, corresponding to the same enzymes.

In order to gain knowledge about the strain USBA-GBX-515T, we explored the potential production of secondary metabolites by data mining (Fig. 4). The genes responsible for the secondary metabolites were organized in 32 biosynthetic gene clusters using IMG tools. Those contained approximately 400 genes, the 78% of clusters were designed as putative, whilst 22% were related to NRPS and bacteriocin, but it was not possible to identify known metabolites.

Fig. 4
figure 4

Secondary metabolites predicted by antiSMASH 3.0 [71], BAGEL3 [35] and NaPDoS [36] softwares in the genome of Pseudomonas extremaustralis strain USBA-GBX-515

Full size image

Using antiSMASH 3.0 platform we detected 57 cluster of biosynthetic genes. The 56% of clusters were classified as putative. Two biosynthetic clusters (classified as putative) were assigned to fengycin and alginate clusters. Fengycin is a cyclic lipopeptide acting against phytopathogenic viruses, bacteria, fungi, and nematodes. The lipopeptides are synthesized at modular multienzymatic templates [50, 51]. The polymer alginate had been identified mainly in the genus Pseudomonas as an exopolysaccharide involved on biofilm formation and pathogenicity [52]. A total of 24.5% of the clusters were classified as saccharides. Five of the biosynthetic clusters included in this category were related to lipopolysaccharide, pseudopyronine, colonic acid, O-antigen and glidobactin. The proteins coded by the cluster associated to lipopolysaccharide (LPS) (Fig. 5) are secreted to the outer surface and the cluster is expressed as a mechanism of resistance to detergents and hydrophobic antibiotics [53]. Colanic acid is an extracellular polysaccharide related to desiccation resistance [54] and to adhesion as pathogenic factor [55] (Fig. 6). O-antigen is a lipopolysaccharide which is associated to adhesion [56] (Fig. 7). The last saccharide cluster is related to glidobactin (Fig. 8), a PKS/NPRS cytotoxic compound which is an antifungal and antitumor antibiotic complex [57]. The structure of this cluster shows a 36% similarity to the cluster of “ Pseudomonas batumici” strain UCM B-321. A PKS/NRPS compound has been founded from “ Pseudomonas batumici” named batumin which exhibits potent and selective antibiotic activity against Staphylococcus species [58]. A biosynthetic gene cluster related to arylpolyene-saccharide was detected (Fig. 9), and this metabolite has a similar structure to a pigment produced by members of the genus Xanthomonas and Flexibacter , which is involved on Gram negative bacteria protection against exogenous oxidative stress [37]. Other clusters were associated to coronatine (Fig. 10) and mangotoxin (Fig. 11) compounds. Both are antimetabolites related to phytotoxins. The coronatine acts as a virulence factor and induces hypertrophy, inhibits root elongation, and stimulates ethylene production [59]. The mangotoxin is a small peptidic molecule, which inhibits the biosynthesis of essential amino acids, resulting in an amino acid deficiency [60]. These toxins could be used as herbicides such as glufosinate and bialaphos, two commercial herbicides that mimic bacterial toxins [60]. Finally, we found a cluster related to pyoverdine (Fig. 12), a nonribosomal peptide siderophore [61].

Fig. 5
figure 5

Genetic map of lipopolysaccharide biosynthetic gene cluster 1 detected by AntiSMASH 3.0. The genes were designated by colors. Same color means equal genes in different strains, not-colored means other genes. 1. pyruvate dehydrogenase subunit E1; 2. UDP-glucose:(heptosyl) LPS alpha 1,3-glucosyltransferase WaaG; 3. hypothetical protein PA5008; 4. Serine/threonine protein kinase; 5. sugar ABC transporter substrate-binding protein; 6. ABC transporter ATP-binding protein; 7. bifunctional carbohydrate binding and transport protein; 8. bifunctional carbohydrate binding and transport protein; 9. glycosyl transferase family protein; 10. glycosyl transferase family protein; 11. lipid A export permease/ATP-binding protein MsbA; 12. adenylyl-sulfate kinase; 13. bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase; 14. Epimerase; 15. hypothetical protein PA4992;16. FAD-dependent oxidoreductase; 17. transcriptional regulator; 18. hypothetical protein PA4974; 19. 3-deoxy-D-manno-octulosonic acid transferase

Full size image
Fig. 6
figure 6

Genetic map of colanic acid biosynthetic gene cluster 2 detected by AntiSMASH 3.0. The genes were designated by colors. Same color means equal genes in different strains; not colored means other genes. 1. Thiosulfate sulfurtransferase; 2. transcriptional regulator; 3. nucleotide sugar dehydrogenase; 4. colanic acid production tyrosine-protein kinase; autokinase; Ugd phosphorylase; 5–7. hypothetical protein; 8. putative acyl transferase; 9. Glycosyl transferase; 10. GDP-D-mannose dehydratase, NAD(P)-binding; 11. bifunctional GDP-fucose synthetase: GDP-4-dehydro-6-deoxy-D-mannose epimerase/ GDP-4-dehydro-6-L-deoxygalactose reductase; 12. colanic acid biosynthesis glycosyl transferase WcaI; 13. mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase

Full size image
Fig. 7
figure 7

Genetic map of O-antigen biosynthetic gene cluster 3 and 4 detected by AntiSMASH 3.0. The genes were designated by colors. Same color means equal genes in different strains; not colored means other genes. Cluster 3: 1. Transporter; 2. GntR family transcriptional regulator; 3. TetR family transcriptional regulator; 4. nucleotide sugar epimerase/dehydratase WbpM; 5. NAD-dependent epimerase/dehydratase family protein; 6. glycosyltransferase WbuB; 7. PREDICTED: UDP-glucuronic acid decarboxylase 6; 8. bifunctional UDP GlcNAc C6 dehydratase/C5 epimerase PseB; 9. CPS-53 (KpLE1) prophage; bactoprenol glucosyl transferase; 10. imidazole glycerol phosphate synthase subunit HisF; 11. LPS biosynthesis; 12. 3-oxoacyl-ACP reductase; 13. hypothetical protein; 14. pilin glycosylation protein PglB; 15. mannose-1-phosphate guanyltransferase beta. Cluster 4: 1. two-component sensor; 2. NAD(P)-dependent oxidoreductase; 3. hypothetical protein spr0320; 4. dTDP-D-glucose 4,6-dehydratase; 5. ethanolamine-phosphate phospho-lyase; 6. Epimerase; 7. pellicle/biofilm biosynthesis glycosyltransferase PelF

Full size image
Fig. 8
figure 8

Genetic map of glidobactin biosynthetic gene cluster 5 detected by AntiSMASH 3.0. The genes were designated by colors. Same color means equal genes in different strains; not colored means other genes. 1. ABC transporter permease; 2. ABC transporter ATP-binding protein; 3. prolyl aminopeptidase; 4. glucan biosynthesis glucosyltransferase; 5. amino acid ABC transporter substrate-binding protein; 6. ABC transporter, PAAT family; 7. ABC transporter permease; 8. ABC transporter substrate-binding protein

Full size image
Fig. 9
figure 9

Genetic map of arylpolyene saccharide biosynthetic gene cluster 6 detected by AntiSMASH 3.0. The genes were designated by colors. Same color means equal genes in different strains, not-colored means other genes. 1. 3-dehydroquinate synthase; 2. hypothetical protein PA5037; 3. major facilitator superfamily transporter; 4. Transcriptional regulator; 5. 3-oxoacyl-(acyl-carrier-protein) synthase II FabF; 6. beta-ketoacyl synthase; 7. SAM-dependent methyltransferase type 11; 8. FAD-binding protein; 9. MMPL family efflux pump permease component. 10. glycosyl transferase; 11. AMP dependent synthase; 12. acyl carrier protein; 13. Acyltransferase; 14. acyl-CoA dehydrogenase; 15. fused DNA-binding transcriptional regulator/proline dehydrogenase/pyrroline-5-carboxylate dehydrogenase

Full size image
Fig. 10
figure 10

Genetic map of coronatine biosynthetic gene cluster 7 detected by AntiSMASH 3.0. The genes were designated by colors. Same color means equal genes in different strains; not colored means other genes. 1. hypothetical protein PA4617; 2. quorum-sensing control repressor; 3. Motility regulator; 4. serine hydroxymethyltransferase; 5. hypothetical protein PA4604; 6. threonine transporter RhtB; 7. Thioesterase; 8. non-ribosomal peptide synthetase; 9. coronamic acid synthetase CmaD; 10. hypothetical protein; 11. transcriptional regulator of proline and 4-hydroxyproline utilization HypR; 12.ABC transporter ATP-binding protein

Full size image
Fig. 11
figure 11

Genetic map of Mangotoxin biosynthetic gene cluster 8 detected by AntiSMASH 3.0. The genes were designated by colors. Same color means equal genes in different strains; not colored means other genes. 1. ABC transporter permease; 2. ABC transporter ATP-binding protein; 3. hypothetical protein PA2310; 4. transcriptional regulator of proline and 4-hydroxyproline utilization HypR; 5. non-ribosomal peptide synthetase

Full size image
Fig. 12
figure 12

Genetic map of Pyoverdine biosynthetic gene cluster 9 detected by AntiSMASH. The genes were designated by colors. Same color means equal genes in different strains; not colored means other genes. 1. two-component system response regulator; 2. two-component system response regulator; 3. chemotaxis signal transduction system response regulator CheV; 4. geranyl-CoA carboxylase subunit alpha; 5. Isohexenylglutaconyl-Coa hydratase; 6. citronellyl-CoA dehydrogenase; 7. geranyl-CoA carboxylase subunit beta; 8. citronellol- dehydrogenase; 9. atu genes repressor; 10. amino acid ABC transporter substrate-binding protein; 11. extracytoplasmic-function sigma-70 factor; 12. pyoverdine biosynthesis protein PvdG; 13. Peptide synthase; 14. thiol:disulfide interchange protein DsbG; 15. two-component sensor histidine kinase; 16. two-component response regulator; 17. diaminobutyrate--2-oxoglutarate aminotransferase; 18. pseudouridine synthase

Full size image

According to NapDOs program [36], several genes were related to fatty acid biosynthesis, particularly two genes fat478 and fat3803 (related to proteins FabB and FabF, respectively); those proteins are chain elongation condensing enzymes (synthases) that control fatty acid composition and influence the rate of fatty acid production [37].

Using BAGEL3 we found the cluster class III related to S-type Pyocin, a compound with a killing activity causing cell death by DNA breakdown through endonuclease activity [62].

Conclusions

The strain USBA-GBX-515 isolated from soils associated to superparamo from Andean ecosystems, is a moderate psicrophilic and denitrifier organism. The different genetic indices, the phylogenetic analysis of the 16S rRNA gene sequence and the phenotypic characterization confirmed that USBA-GBX-515 belongs to the Pseudomonas extremaustralis species. In addition, the pairwise genome alignment between our strain and the type strain CT14–3T of Pseudomonas extremaustralis (17835T) showed high similarity and conserved synteny of genes. Based on physiological characterization of this strain, we demonstrated its potential as lipolytic organism. On the other hand, based on a thorough analysis of the genome, we reported this strain as a potential producer of secondary metabolites, such as bactericin pyiocin and PK/NRPS associated to glidobactin, a potential cytotoxic compound. This strain could be also an interesting producer of secondary metabolites such as pyoverdine or glidobactin.