Abstract
Background
Pairing of homologous chromosomes at meiosis is an important requirement for recombination and balanced chromosome segregation among the products of meiotic division. Recombination is initiated by double strand breaks (DSBs) made by Spo11 followed by interaction of DSB sites with a homologous chromosome. This interaction requires the strand exchange proteins Rad51 and Dmc1 that bind to single stranded regions created by resection of ends at the site of DSBs and promote interactions with uncut DNA on the homologous partner. Recombination is also considered to be dependent on factors that stabilize interactions between homologous chromosomes. In budding yeast Hop2 and Mnd1 act as a complex to promote homologous pairing and recombination in conjunction with Rad51 and Dmc1.
Results
We have analyzed the function of the Arabidopsis orthologue of the budding yeast MND1 gene (AtMND1). Loss of AtMND1 did not affect normal vegetative development but caused fragmentation and missegregation of chromosomes in male and female meiosis, formation of inviable gametes, and sterility. Analysis of the Atmnd1 Atspo11-1 double mutant indicated that chromosome fragmentation in Atmnd1 was suppressed by loss of Atspo11-1. Fluorescence in situ hybridization (FISH) analysis showed that homologous pairing failed to occur and homologues remained apart throughout meiosis. AtMND1 showed strong expression in meiocytes as revealed by RNA in situs.
Conclusion
We conclude that AtMND1 is required for homologous pairing and is likely to play a role in the repair of DNA double strand breaks during meiosis in Arabidopsis, thus showing conservation of function with that of MND1 during meiosis in yeast.
Similar content being viewed by others
Background
The formation of at least one crossover between pairs of homologous chromosomes is necessary for their correct segregation at meiosis I. The stages of interactions between homologous chromosomes that lead to crossover formation have been broadly grouped as: an initial localization of homologous chromosomes within the same region, mediated by interstitial interactions; close pairing and strand exchange at the DNA level as a part of recombination; and synapsis between homologous chromosomes together with completion of recombination [1].
Recombination at the DNA level in yeast and in other organisms is initiated by double strand breaks (DSBs) made by Spo11 [2, 3]. Interaction between DSBs and a homologous intact chromosome can lead to crossover and noncrossover recombination products which are formed by two different pathways [4]. Processing of DSBs by 5' end resection yields 3' single-stranded ends that asymmetrically invade a homologous chromosome and lead to the formation of a double-Holliday junction intermediate which has been proposed to account for the majority of crossovers [5, 6]. Interaction between homologous chromosomes at the sites of DSBs is promoted by the action of the RecA-like strand exchange proteins Rad51 and Dmc1 [7, 8]. Several lines of evidence suggest that Rad51 and Dmc1 have different but overlapping functions [9, 10] and interact with distinct sets of proteins in promoting recombination [11–13]. Rad51 acts in mitosis and in meiosis [14] whereas Dmc1 is meiosis specific [15].
MND 1 was identified in Saccharomyces cerevisiae using three different screens based on genetic and functional genomic approaches that were directed at identifying genes that played a role in meiotic recombination and/or chromosome segregation [16–18]. The mnd1 mutant shows defects in nuclear division, meiotic recombination, and repair of DSBs. Mnd1 has been shown to act as a complex with Hop2 [18, 19] and the Mnd1/Hop2 complex localizes to chromosomes independently of Rad51 and Dmc1 [18, 20]. Genetic studies have provided evidence that Hop2 and Mnd1 act in the same pathway as Dmc1 and Rad51 [17–21]. Biochemical studies using yeast, human, and mouse orthologues have provided evidence that Mnd1/Hop2 stimulates the strand exchange activity of Dmc1 and that of Rad51 [19, 22, 23]. The interaction of Mnd1 with Hop2 has been shown to promote the interaction of Hop2 with Dmc1 and stimulate the strand exchange activity of Dmc1 [24]. Additional roles for Mnd1/Hop2 that have been proposed are in promoting interhomologue associations at DSBs through interaction with the axial elements or other proteins perhaps by relieving structural constraints [18, 20, 25] and in the designation of DSBs for noncrossover recombination [26].
Orthologues of MND1 have been identified in protists, fungi, plants, and animals and some of these have been characterized and shown to have closely related functions [27]. In yeast an mnd1 disruption has been reported to cause defects only in meiosis and does not result in sensitivity to radiation induced DNA damage [17]. However, an Arabidopsis mutant, Atmnd1-Δ1 has been recently shown to be sensitive to gamma radiation indicative of a role in mitotic repair, and also to undergo chromosome fragmentation during meiosis [28]. Here we have used the same mutant allele to analyze the role of the AtMND1 gene in meiosis. We show that AtMND1 is required for homologous pairing, an early step in the recombination process and that chromosome fragmentation in the Atmnd1 mutant is likely to be due to defective repair of meiotic DSBs. We also show that consistent with its role in meiosis, AtMND1 is strongly expressed in meiocytes.
Results
AtMND1 shows increased expression in reproductive tissues
The Arabidopsis genome contains a single orthologue of MND1 (AtMND1) corresponding to the annotated gene ID No. At4g29170 and supported by a cDNA (Accession No. AA063855). The encoded protein shows 26% identity (47% similarity) to Mnd1 and is 230 aa in length which is close to that of Mnd1 (219 aa). Expression of AtMND1 was compared between rosette leaves and inflorescence using real time PCR (Fig. 1B). The results indicated a 9-fold higher expression of AtMND1 in reproductive tissues over leaves consistent with a possible role in reproductive development.
Mutation of AtMND1 causes male and female sterility due to production of defective gametes
To examine the function of the AtMND1 gene we obtained bulked T4 seeds of an insertion line SALK_110052 [29] carrying a T-DNA insertion in AtMND1 and identified 2 plants that were homozygous for the insertion. Both plants were found to be sterile (Fig. 2) whereas 14/14 plants that were not homozygous for the insertion were fertile. No defects in vegetative development were observed. The progeny of a single plant that was heterozygous for the insertion segregated 84:23 fertile:sterile consistent with a single gene recessive trait (0.5 > p > 0.25 for a single gene model; 0.001 > p for a two gene model). 31 plants at random were genotyped with respect to the presence of the insertion and all 4 that were found to be homozygous for the insertion were also sterile indicating that the phenotype was closely linked to the insertion (0.001 > p for an unlinked gene model). The mutant showed a greater than 100-fold reduction in AtMND1 expression suggesting that AtMND1 function is severely reduced and is probably null (data not shown). To determine whether sterility was caused by mutation of AtMND1, a 3.9 kb genomic fragment comprising the AtMND1 gene and its promoter region was cloned into a plant binary vector pCAMBIA1300 [30] and transformed into Arabidopsis plants that were heterozygous for the Atmnd1 insertion allele, using in-planta transformation. 4 T1 transformant plants that were homozygous for the Atmnd1 insertion allele were identified out of 24 screened and all 4 were fertile, whereas among untransformed plants in a segregating population, 12 were identified to be homozygous for the Atmnd1 insertion allele and all were sterile (Fig. 2B) which demonstrates that the sterile phenotype is caused by mutation of AtMND1.
Reciprocal crosses were carried out between wild type and mutant to identify the developmental defects underlying sterility, and the results in Table 1 indicate that the mutant shows both male and female sterility. Observation of anthers showed that the pollen grains in the mutant were shrunken (Fig. 2F,G) and inviable (Fig. 2K,O) as determined by Alexander staining [31]. Also the anther lobes remained below the level of the stigma as a result of reduced elongation of the anther filament. Likewise, examination of cleared ovules showed that in the mutant, postmeiotic development of the female gametophyte was arrested at the functional megaspore stage followed by degeneration of the functional megaspore (Fig. 2H–J,L–N; Table 2). About 0.6% of the developed ovules contained a mature embryo sac, which is consistent with the small number of seeds produced in the mutant. These results indicated that the mutant is male and female sterile due to both pollen and embryo sac formation being defective.
AtMND1 is strongly expressed at meiosis
To obtain more detailed information on the expression pattern of AtMND1 in relation to the mutant phenotype we examined expression in inflorescence tissue sections by RNA in-situ hybridization using antisense RNA complementary to AtMND1 cDNA (Fig. 3). A basal level of expression was observed throughout reproductive tissues. In addition strong expression of AtMND1 was found within anther lobes at meiotic stages (Fig. 3A–E). The earliest increase in expression was detected in sporogenous cells at anther stage 4 [32]. Strong expression was observed in stage 5 anthers within microspore mother cells and also the tapetum. A high level of expression continued to be observed within meiotic cells during anther stage 6 and declined after meiosis. An increase in expression of AtMND1 was also detected within the megaspore mother cell in ovules although not as strongly as observed in microsporocytes (Fig. 3G).
AtMND1 is required for homologous pairing
The expression pattern of AtMND1 and the phenotype of the AtMND1 mutant are together suggestive of a defect in meiosis. We therefore compared meiotic prophase stages from the mutant and wild type using spread preparations of meiotic chromosomes following the method of Ross et al., 1997 [33]. The initial stages of meiotic prophase corresponding to early leptotene were seen to occur in the Atmnd1 mutant and thread-like chromosomes were apparent (Fig. 4). Association of the nucleolar heterochromatin present on chromosomes 2 and 4 as well as the synizetic knot, which is formed during late leptotene concomitant with pairing and the start of synapsis [34] could also be observed (Fig. 4A,F). However, abnormalities could be detected starting at the zygotene stage, both with respect to the appearance of the chromosomes and the organization of pericentromeric heterochromatin. Chromosomes in the mutant appeared less compact when compared to wild type and pericentromeric heterochromatin regions were more extended and unpaired than at the corresponding stage in wild type (Fig. 4B,G). During the course of zygotene, the differences became more pronounced, and synapsis was defective. The thickening of chromosomes along segments of their length representing synapsed regions, that characteristically appears during zygotene and is complete by pachytene, did not take place in the mutant (Fig. 4C,H). At diplotene the chromosomes appeared as a diffuse and fragmented mass with 10–12 separate spots of condensed pericentromeric heterochromatin (Fig. 4D,I). At diakinesis, separated chromosomes and fragments could be clearly distinguished (Fig. 4E,J). The sorting of these fragments at anaphase I and II was irregular and bridges could be observed (Fig. 4K–N,P–S). Following meiosis polyads that contained a variable number of fragmented chromosomes were formed (Fig. 4O,T). These gave rise to defective spores that did not form viable pollen. Female meiosis in the mutant was also defective and chromosome fragmentation was observed (Fig. 4U–W). These data suggested the possibility that the mutant is defective in homologous pairing and synapsis and the accumulation of fragments may arise from defects in repair of DSBs.
To examine homologous pairing we carried out FISH experiments (Fig. 5) using a telomere repeat based oligonucleotide probe that hybridizes strongly to the centromere of chromosome 1 but not to centromeres of the remaining chromosomes [35]. In wild type, two well separated signals were observed at leptotene indicating that chromosomes were unpaired (Fig. 5A). A single signal was observed at late zygotene (46/46 nuclei) and pachytene (23/23 nuclei) indicative of pairing and synapsis having taken place (Fig. 5C,D). At diplotene, twin signals close to each other (6/6 nuclei) were seen indicative of centromere regions having desynapsed (Fig. 5E). These twin signals again merged and at metaphase I only a single signal was seen (data not shown). The Atmnd1 mutant showed two widely separated signals starting from leptotene and throughout all subsequent stages (58/61 nuclei for zygotene and 42/43 for pachytene) indicating that homologous pairing as well as synapsis was defective (Fig. 5F–J).
Chromosome fragmentation in Atmnd1 is suppressed by a mutation in AtSPO11-1
The chromosome fragmentation phenotype together with the absence of homologous pairing suggested that the Atmnd1 mutant was defective in recombination possibly due to defects in the repair of meiotic DSBs. AtSPO11-1 is one of three SPO11 homologues in Arabidopsis and is specifically required for recombination and synapsis during meiosis [36, 37]. To test whether fragmentation was dependent upon Atspo11-1, a plant that was heterozygous for Atmnd1 was crossed to a SALK insertion line (SALK_146172) that was heterozygous for a T-DNA insertion in the seventh intron of Atspo11-1 [29]. F1 plants that carried both insertions were identified in the F1 and homozygous Atmnd1 Atspo11-1 double mutants were obtained in the F2. Analysis of male meiotic chromosome spreads of the double mutant and comparison to the Atspo11-1 single mutant indicated that the chromosome fragmentation phenotype of Atmnd1 was suppressed by Atspo11-1 (Fig. 6). Chromosomes in the double mutant did not undergo fragmentation after diplotene (Fig. 6B,C) and remained as intact univalents that segregated randomly at the first meiotic division (Fig. 6C,D,H,I). The double mutant phenotype resembled that of the Atspo11-1 mutant. Atspo11-1 is therefore epistatic to Atmnd1.
Discussion
Pairing and recombination between homologous chromosomes at meiosis relies on search for homology using resected ends that are created at the sites of DSBs. This search is mediated by the action of RecA-like strand exchange proteins Rad51 and Dmc1 which bind to single stranded DNA and promote the formation of joint molecules [7, 8]. The strand exchange activity of Dmc1 and Rad51 is stimulated by Hop2 and Mnd1 which cooperate together as a complex [18, 19]. Both Hop2 and Mnd1 are required in yeast for homologous pairing and meiotic DSB repair [16–18, 20]. We have shown in this study that the Arabidopsis orthologue of MND1, AtMND1 is required for homologous pairing during meiosis in Arabidopsis where it is likely to play a role in the repair of meiotic DSBs. AtMND1 also shows strong expression in meiocytes.
The early defects in the Atmnd1 mutant with respect to overall appearance of chromosomes during meiosis were a lack of thickening during zygotene and absence of subsequent synapsis at pachytene. Fragmentation of chromosomes became apparent at diplotene and isolated univalents and fragments were first visible at diakinesis. FISH analysis using a centromere 1 specific probe indicated that homologous pairing did not take place in the mutant during zygotene and homologous chromosomes remained apart throughout meiotic prophase and meiosis I.
The meiotic phenotype of Atmnd1 is similar to that caused by a mutation in AHP2 which encodes the Arabidopsis orthologue of HOP2 [38]. In both cases there is chromosome fragmentation and a defect in homologous pairing. The failure to synapse and the appearance of fragmented chromosomes late in meiotic prophase I is a feature of several Arabidopsis mutants that are implicated in processing and repair of DSBs [39, 40]. The observation that Atspo11-1 suppressed the chromosome fragmentation phenotype of Atmnd1 supports the interpretation that Atmnd1 is also defective in meiotic DSB repair. A major difference between the meiotic phenotype of yeast mnd1 and that for Atmnd1 in Arabidopsis is the absence of meiotic arrest in Arabidopsis whereas mnd1 shows prophase arrest which is alleviated by a mutation in MEC1, a major regulator of DNA damage induced checkpoints [25]. A lack of arrest is also seen in the case of ahp2 whereas hop2 shows prophase arrest [20]. The failure to arrest in the case of Arabidopsis is likely to be due to the absence or leakiness of meiotic DNA damage checkpoints and has also been observed for other Arabidopsis meiotic mutants for which the yeast counterparts show prophase arrest [41].
The yeast MND1 gene is expressed and functions only in meiosis and is not considered to play a role in mitotic DNA repair [17]. The AtMND1 gene is dispensable for somatic development, however the Atmnd1 mutant is defective in mitotic DNA repair and AtMND1 is induced in response to gamma irradiation [28] pointing to an evolutionary difference between yeast and plants with respect to the role of MND1. In plants the major pathway for repair of DSBs in somatic cells is non-homologous end joining (NHEJ) whereas in yeast the homologous recombination pathway predominates, which may explain the requirement for Hop2/Mnd1 in promoting efficient repair of DSBs and the maintenance of genome integrity in somatic cells [42]. Orthologues of MND1 and HOP2 are not present in C. elegans and Drosophila melanogaster both of which do not require DSBs for homologous synapsis at meiosis [43].
In addition to being strongly induced in meiocytes at the time of meiosis we found that AtMND1 is also expressed in the tapetum at the same time. We have earlier noticed this to also be the case for the DUET gene which has a male meiosis specific phenotype [44]. It is possible that the tapetal expression at the same time as in meiocytes may reflect an overlap in the expression profile between tapetal cells and microspore mother cells which form adjacent layers and are both descended from the archesporial cell. Indeed the secondary parietal cells that are the precursors of the tapetum appear to retain the developmental potential to form meiocytes as revealed by mutations in EXS/EMS1 [45, 46] and TPD1 [47] where microsporocytes are formed in place of tapetal cells. We also note that the onset of increased expression of AtMND1 appears to be at anther stage 4 in a region occupied by sporogenous cells that are the precursors of male meiocytes. This stage is prior to the formation of meiocytes and initiation of recombination. These observations would suggest that the regulatory mechanisms responsible for increased expression of AtMND1 in reproductive tissues may be distinct from those for DNA damage inducible expression [28].
Conclusion
In summary we have shown that AtMND1 is required for homologous pairing and repair of DSBs during meiosis in Arabidopsis. Loss of AtMND1 does not affect normal vegetative development but causes male and female sterility due to fragmentation and defective segregation of chromosomes in meiosis.
Methods
Plant material and growth conditions
All the plants described in this study were Arabidopsis ecotype Col-0. The T-DNA insertion lines SALK_110052 and SALK_146172 used in this study were obtained from the Arabidopsis Biological Resources Centre, Ohio State University. Plants were grown as described previously [48].
Characterization of the T-DNA Lines
Genomic DNA was extracted from the SALK T-DNA insertion lines using the method of Dellaporta et al.,1983 [49]. Presence of the T-DNA insert in Atmnd1 was confirmed by PCR using a left border outwardly directed primer (LB1) in combination with a gene-specific primer (AtMND1F1) flanking the site of insertion. Based on our analysis, there are at least two tandemly placed T-DNA inserts placed next to each other such that the orientation in the genome is LB-RB-LB. Junction fragments on either ends of T-DNA were amplified using primer combinations AtMND1F1 and LB1 and AtMND1R1 and LB2. Sequencing of the AtMND1R1-LB2 product revealed the presence of a 86 bp deletion within intron 7. Primers AtMND1F1 and AtMND1R1 were utilized to amplify the wild type allele. For the Atspo11-1 line the presence of the T-DNA insert was confirmed using the primer TSPO11R in combination with LB1 and wild type copy using TSPO11F in combination with TSPO11R. Homozygous insertion lines showed a phenotype that was the same as that of Atspo11-1-1 [36].
Complementation analysis
A full-length genomic clone spanning 3891 bp (AGI coordinates 14382003–14385894) was amplified using primers MndF1 and MndR1 that incorporates restriction sites, Bam H1 at 5' and Eco R1 at 3' end respectively. The amplification was done using TripleMaster PCR system (Eppendorf) as per the manufacturer's instructions. The resulting 3.89 kb fragment was cloned into the pGEM-T vector (Promega) followed by sequencing of the fragment. Restriction digestion with enzymes Bam H1 and Eco R1 was performed to release the fragment, which was sub-cloned into the binary vector pCAMBIA1300. The fragment was mobilized into Agrobacterium strain AGL1 by tri-parental mating. The in planta transformation was carried out on heterozygous Atmnd1 plants by vacuum infiltration as reported earlier [50]. The transformants were selected on medium comprising of 1% bacto agar, 1% sucrose, 1 mM KNO3 and 50 μg/ml of hygromycin B and genotyped by PCR using Atmnd_out_FG_Rev1 and Atmnd_out_FG_For1 primers.
Expression analysis by Real Time RT-PCR
Total RNA was isolated using Trizol (Sigma) as per the manufacturers protocol. cDNA was synthesized from 5–7 μg of RNA using the Superscript first strand synthesis system (Invitrogen) with Oligo dT primers. Real Time PCR reactions were done in a 10 μl volume comprising of primer, cDNA template and 1× SYBER Green PCR master mix (Applied Biosystems). GAPC was used as the internal normalization control. PCR was performed on the ABI Prism 7900 HT Sequence Detection System (Applied Biosystems) in a 384 well reaction plate according to the manufacturer's recommendations. Primers were MNDRTF1 and MNDRTR1 for AtMND1 and GAPRTF1 and GAPRTR2 for GAPC. Cycling parameters consisted of 2 minutes incubation at 50°C, 10 minutes at 95°C and 40 cycles of 95°C for 15 seconds, 57°C for 30 seconds and 67°C for 30 seconds. Each PCR reaction was performed in triplicate and the experiment were repeated twice. Specificity of the amplifications was verified at the end of each PCR run using ABI prism dissociation curve analysis software. Results from the ABI Prism 7900 HT Sequence Detection System were analyzed further using Microsoft Excel. Quantification of mRNA was calculated from threshold points (Ct values) located in the log-linear range of real time PCR amplification plots.
RNA In situ Hybridizations
In situ hybridizations were carried out as described earlier [48]. Anti-sense RNA specific to the AtMND1 gene was used as probe along with sense control. We used the full-length AtMND1 cDNA amplified from the cDNA clone using Nco 1F and Eco R1R primers and subcloned into pGEM-T vector for strand specific probe synthesis. Floral stages are according to [51].
Microscopy
Developmental analysis of whole mount anthers and ovules was done after fixing and clearing the inflorescence in methyl benzoate as described previously [46]. The slides were observed on a Zeiss Axioplan 2 Imaging microscope under DIC optics using a 40× oil immersion objective. Pollen viability was examined using the method of Alexander staining [31]. Meiotic chromosome spreads were prepared, analyzed, and staged based on chromosomal morphology and with respect to the stage of the surrounding tapetal cells, according to Ross et al., 1996 [33] with minor modifications as described in [52]. Chromosomes were stained with DAPI (1 μg/ml) and observed on a Zeiss Axioplan 2 Imaging microscope using a 365 nm excitation and 420 nm long pass emission filter and a 100× oil objective. Images were captured on an Axioplan CCD camera using Axiovision (version 3.2) and processed using Adobe Photoshop 6.0.
Fluorescence In situ Hybridization (FISH)
Meiotic spreads were carried out as described above and FISH analysis was done according to [53] with incorporation of minor modifications. The hybridization mix was prepared with 5' FITC labeled probe FITC-(CCCTAAA)6 [35] at a concentration of 5 μg/ml in 50% deionised formamide, 2× SSC and 10% dextran sulphate. The hybridization mix was denatured on a hot block for 3 minutes at 100°C and immediately cooled on ice. The slides were denatured separately with 100 μl denaturation mix comprising of 70% deionised formamide, 2× SSC and 50 mM sodium phosphate buffer pH 7.0 mounted under a 24 × 50 mm2 cover slip and incubated at 80°C for 5 minutes. After the incubation, the slides were washed in ice-cold 70% ethanol for two minutes followed by dehydration in 70%, 90% and 100% ethanol respectively (2 minutes each) and air dried. Denatured probe (100 μl) was then applied to the slides and covered with a 24 × 50 mm2 cover slip. Hybridization was carried out in a moist chamber for 18 hours at 37°C. Post-hybridization washes were performed in 2× SSC, pH 7.0 (two washes each for 5 minutes at room temperature) followed by 2× SSC for 5 minutes at 42°C. Chromosomes were counter stained with DAPI (1 μg/ml) in Vectashield (Vector Laboratories). Fluorescence detection was done on a Zeiss Axioplan 2 Imaging microscope equipped with epifluorescence illumination and distinct filters for DAPI and FITC using a 100× oil immersion objective. The images were captured with a Axioplan CCD camera using Axiovision software (Zeiss, version 3.2) and processed using Adobe Photoshop 6.0.
Primers used in this study
1. AtMND1F1 ACCGAAGAAGGGTGTAATTAGTCAGTC
2. AtMND1R1 ATTGTCGCAGTGTGAAGATGTTATCTG
3. MndF1 CAGGAGAATTCAAACCGAGAACATGAAACAGATCC
4. MndR1 GACGAGGATCCAATCATAGAAACAGACTTGGACC
5. Atmnd_out_FG_Rev1 CCTGGACCAGAAGAAGGTAAGGGTTTTG
6. Atmnd_out_FG_For1 GAGCTATTCACATGCTTAACAAGTTGCTAACAG
7. Nco1 F GCTCGCCCATGGCTATGTCTAAGAAACGGGGAC
8. EcoR1 R GCGGAGAATTCCTAAGCTTCATCTTGTACTAGCT
9. LB1 AACCAGCGTGGACCGCTTGCTGCAACTC
10. LB2 CAGGGCCAGGCGGTGAAGG
11. MNDRTF1 TCGATGATGATCTTGTTGCGAA
12. MNDRTR1 TCACACTGATCAACAAGTTCTGCt
13. GAPRTR2 CAGTCTTCTGAGTAGCAGTGATTGA
14. GAPRTF1 AGCACGAATACAAGTCCGACCT
15. TSPO11R ACTGTGATAACAATGCAGCGGTTCG
16. TSPO11F CAGCACAATCCATTGTGGACCGTGC
Note added in proof
While this manuscript was under review, a paper was published by Kerzendorfer et al., also describing work on the role of AtMND1 in homologous pairing and recombination [55].
References
Zickler D, Kleckner N: The leptotene-zygotene transition of meiosis. Annu Rev Genet. 1998, 32: 619-97. 10.1146/annurev.genet.32.1.619
Bergerat A, de Massy B, Gadelle D, Varoutas PC, Nicolas A, Forterre P: An atypical topoisomerase II from Archaea with implications for meiotic recombination. Nature. 1997, 386: 414-7. 10.1038/386414a0
Keeney S, Giroux CN, Kleckner N: Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell. 1997, 88: 375-84. 10.1016/S0092-8674(00)81876-0
Allers T, Lichten M: Differential timing and control of noncrossover and crossover recombination during meiosis. Cell. 2001, 106: 47-57. 10.1016/S0092-8674(01)00416-0
Schwacha A, Kleckner N: Interhomolog bias during meiotic recombination: meiotic functions promote a highly differentiated interhomolog-only pathway. Cell. 1997, 90: 1123-35. 10.1016/S0092-8674(00)80378-5
Hunter N, Kleckner N: The single-end invasion: an asymmetric intermediate at the double-strand break to double-holliday junction transition of meiotic recombination. Cell. 2001, 106: 59-70. 10.1016/S0092-8674(01)00430-5
Sung P, Robberson DL: DNA strand exchange mediated by a RAD51-ssDNA nucleoprotein filament with polarity opposite to that of RecA. Cell. 1995, 82: 453-61. 10.1016/0092-8674(95)90434-4
Hong EL, Shinohara A, Bishop DK: Saccharomyces cerevisiae Dmc1 protein promotes renaturation of single-strand DNA (ssDNA) and assimilation of ssDNA into homologous super-coiled duplex DNA. J Biol Chem. 2001, 276: 41906-12. 10.1074/jbc.M105563200
Rockmill B, Sym M, Scherthan H, Roeder GS: Roles for two RecA homologs in promoting meiotic chromosome synapsis. Genes Dev. 1995, 9: 2684-95.
Shinohara A, Gasior S, Ogawa T, Kleckner N, Bishop DK: Saccharomyces cerevisiae recA homologues RAD51 and DMC1 have both distinct and overlapping roles in meiotic recombination. Genes Cells. 1997, 2: 615-29. 10.1046/j.1365-2443.1997.1480347.x
Dresser ME, Ewing DJ, Conrad MN, Dominguez AM, Barstead R, Jiang H, Kodadek T: DMC1 functions in a Saccharomyces cerevisiae meiotic pathway that is largely independent of the RAD51 pathway. Genetics. 1997, 147: 533-44.
Sugawara N, Wang X, Haber JE: In vivo roles of Rad52, Rad54, and Rad55 proteins in Rad51-mediated recombination. Mol Cell. 2003, 12: 209-19. 10.1016/S1097-2765(03)00269-7
Tsubouchi H, Roeder GS: The budding yeast mei5 and sae3 proteins act together with dmc1 during meiotic recombination. Genetics. 2004, 168: 1219-30. 10.1534/genetics.103.025700
Shinohara A, Ogawa H, Ogawa T: Rad51 protein involved in repair and recombination in S. cerevisiae is a RecA-like protein. Cell. 1992, 69: 457-70. 10.1016/0092-8674(92)90447-K
Bishop DK, Park D, Xu L, Kleckner N: DMC1: A meiosis-specific yeast homolog of E. coli recA required for recombination, synaptonemal complex formation, and cell cycle progression. Cell. 1992, 69: 439-56. 10.1016/0092-8674(92)90446-J
Rabitsch KP, Toth A, Galova M, Schleiffer A, Schaffner G, Aigner E, Rupp C, Penkner AM, Moreno-Borchart AC, Primig M, Esposito RE, Klein F, Knop M, Nasmyth K: A screen for genes required for meiosis and spore formation based on whole-genome expression. Curr Biol. 2001, 11. 10.1-9.
Gerton JL, DeRisi JL: Mnd1p: an evolutionarily conserved protein required for meiotic recombination. Proc Natl Acad Sci USA. 2002, 99: 6895-900. 10.1073/pnas.102167899
Tsubouchi H, Roeder GS: The Mnd1 protein forms a complex with hop2 to promote homologous chromosome pairing and meiotic double-strand break repair. Mol Cell Biol. 2002, 22: 3078-88. 10.1128/MCB.22.9.3078-3088.2002
Chen YK, Leng CH, Olivares H, Lee MH, Chang YC, Kung WM, Ti SC, Lo YH, Wang AH, Chang CS, Bishop DK, Hsueh YP, Wang TF: Heterodimeric complexes of Hop2 and Mnd1 function with Dmc1 to promote meiotic homolog juxtaposition and strand assimilation. Proc Natl Acad Sci USA. 2004, 101: 10572-7. 10.1073/pnas.0404195101
Leu JY, Chua PR, Roeder GS: The meiosis-specific Hop2 protein of S. cerevisiae ensures synapsis between homologous chromosomes. Cell. 1998, 94: 375-86. 10.1016/S0092-8674(00)81480-4
Tsubouchi H, Roeder GS: The importance of genetic recombination for fidelity of chromosome pairing in meiosis. Dev Cell. 2003, 5: 915-25. 10.1016/S1534-5807(03)00357-5
Petukhova GV, Pezza RJ, Vanevski F, Ploquin M, Masson JY, Camerini-Otero RD: The Hop2 and Mnd1 proteins act in concert with Rad51 and Dmc1 in meiotic recombination. Nat Struct Mol Biol. 2005, 12: 449-53. 10.1038/nsmb923
Enomoto R, Kinebuchi T, Sato M, Yagi H, Kurumizaka H, Yokoyama S: Stimulation of DNA strand exchange by the human TBPIP/Hop2-Mnd1 complex. J Biol Chem. 2006, 281: 5575-81. 10.1074/jbc.M506506200
Pezza RJ, Petukhova GV, Ghirlando R, Camerini-Otero RD: Molecular activities of meiosis specific proteins Hop2, Mnd1 and the Hop2-Mnd1 complex. J Biol Chem. 2006, 281: 18426-34. 10.1074/jbc.M601073200
Zierhut C, Berlinger M, Rupp C, Shinohara A, Klein F: Mnd1 is required for meiotic interhomolog repair. Curr Biol. 2004, 14: 752-762. 10.1016/j.cub.2004.04.030
Henry JM, Camahort R, Rice DA, Florens L, Swanson SK, Washburn MP, Gerton JL: Mnd1/Hop2 facilitates Dmc1-dependent interhomolog crossover formation in meiosis of budding yeast. Mol Cell Biol. 2006, 26: 2913-23. 10.1128/MCB.26.8.2913-2923.2006
Saito TT, Tougan T, Kasama T, Okuzaki D, Nojima H: Mcp7, a meiosis-specific coiled-coil protein of fission yeast, associates with Meu13 and is required for meiotic recombination. Nucleic Acids Res. 2004, 32: 3325-39. 10.1093/nar/gkh654
Domenichini S, Raynaud C, Ni DA, Henry Y, Bergounioux C: Atmnd1-delta1 is sensitive to gamma-irradiation and defective in meiotic DNA repair. DNA Repair (Amst). 2006, 5: 455-64. 10.1016/j.dnarep.2005.12.007
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, Gadrinab C, Heller C, Jeske A, Koesema E, Meyers CC, Parker H, Prednis L, Ansari Y, Choy N, Deen H, Geralt M, Hazari N, Hom E, Karnes M, Mulholland C, Ndubaku R, Schmidt I, Guzman P, Aguilar-Henonin L, Schmid M, Weigel D, Carter DE, Marchand T, Risseeuw E, Brogden D, Zeko A, Crosby WL, Berry CC, Ecker JR: Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science. 2003, 301: 653-657. 10.1126/science.1086391
McElroy D, Chamberlain DA, Moon E, Wilson KJ: Development of gusA reporter gene constructs for cereal transformation: Availability of plant transformation vectors from the CAMBIA Molecular Genetic Resource Service. Mol Breeding. 1995, 1: 27-37. 10.1007/BF01682087.
Alexander MP: Differential staining of aborted and nonaborted pollen. Stain Technol. 1969, 44: 117-22.
Sanders PM, Bui AQ, Weterings K, McIntire KN, Hsu YC, Lee PY, Truong MT, Beals TP, Goldberg RB: Anther developmental defects in Arabidopsis thaliana male-sterile mutants. Sex Plant Reprod. 1999, 11: 297-322. 10.1007/s004970050158.
Ross KJ, Fransz P, Armstrong SJ, Vizir I, Mulligan B, Franklin FC, Jones GH: Cytological characterization of four meiotic mutants of Arabidopsis isolated from T-DNA-transformed lines. Chromosome Res. 1997, 5: 551-559. 10.1023/A:1018497804129
Ross KJ, Fransz P, Jones GH: A light microscopic atlas of meiosis in Arabidopsis thaliana. Chromosome Res. 1996, 4: 507-16. 10.1007/BF02261778
Li W, Yang X, Lin Z, Timofejeva L, Xiao R, Makaroff CA, Ma H: The AtRAD51C gene is required for normal meiotic chromosome synapsis and double-strand break repair in Arabidopsis. Plant Physiol. 2005, 138: 965-76. 10.1104/pp.104.058347
Grelon M, Vezon D, Gendrot G, Pelletier G: AtSPO11-1 is necessary for efficient meiotic recombination in plants. EMBO J. 2001, 20: 589-600. 10.1093/emboj/20.3.589
Yin Y, Cheong H, Friedrichsen D, Zhao Y, Hu J, Mora-Garcia S, Chory J: A crucial role for the putative Arabidopsis topoisomeras VI in plant growth and development. Proc Natl Acad Sci USA. 2002, 99: 10191-10196. 10.1073/pnas.152337599
Schommer C, Beven A, Lawrenson T, Shaw P, Sablowski R: AHP2 is required for bivalent formation and for segregation of homologous chromosomes in Arabidopsis meiosis. Plant J. 2003, 36: 1-11. 10.1046/j.1365-313X.2003.01850.x
Caryl AP, Jones GH, Franklin FC: Dissecting plant meiosis using Arabidopsis thaliana mutants. J Exp Bot. 2003, 54: 25-38. 10.1093/jxb/erg041
Li W, Ma H: Double-stranded DNA breaks and gene functions in recombination and meiosis. Cell Res. 2006, 16: 402-12. 10.1038/sj.cr.7310052
Couteau F, Belzile F, Horlow C, Grandjean O, Vezon D, Doutriaux MP: Random chromosome segregation without meiotic arrest in both male and female meiocytes of a dmc1 mutant of Arabidopsis. Plant Cell. 1999, 11: 1623-1634. 10.1105/tpc.11.9.1623
Puchta H: The repair of double-strand breaks in plants: mechanisms and consequences for genome evolution. J Exp Bot. 2005, 56: 1-14. 10.1093/jxb/eri123
Ramesh MA, Malik SB, Logsdon JM: A phylogenomic inventory of meiotic genes; evidence for sex in Giardia and an early eukaryotic origin of meiosis. Curr Biol. 2005, 15: 185-91.
Reddy TV, Kaur J, Agashe B, Sundaresan V, Siddiqi I: The DUET gene is necessary for chromosome organization and progression during male meiosis in Arabidopsis and encodes a PHD finger protein. Development. 2003, 130: 5975-87. 10.1242/dev.00827
Canales C, Bhatt AM, Scott R, Dickinson H: EXS, a putative LRR receptor kinase, regulates male germline cell number and tapetal identity and promotes seed development in Arabidopsis. Curr Biol. 2002, 12: 1718-27. 10.1016/S0960-9822(02)01151-X
Zhao DZ, Wang GF, Speal B, Ma H: The EXCESS MICROSPOROCYTES1 gene encodes a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in the Arabidopsis anther. Genes Dev. 2002, 16: 2021-31. 10.1101/gad.997902
Yang SL, Xie LF, Mao HZ, Puah CS, Yang WC, Jiang L, Sundaresan V, Ye D: TAPETUM DETERMINANT1 is required for cell specialization in the Arabidopsis anther. Plant Cell. 2003, 15: 2792-804. 10.1105/tpc.016618
Siddiqi I, Ganesh G, Grossniklaus U, Subbiah V: The dyad gene is required for progression through female meiosis in Arabidopsis. Development. 2000, 127: 197-207.
Dellaporta SL, Wood J, Hicks JB: A plant DNA minipreparation: version II. Plant Mol Bio Rep. 1983, 1: 19-21.
Bechtold N, Pelletier G: In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. Methods Mol Biol. 1998, 82: 259-66.
Smyth DR, Bowman JL, Meyerowitz EM: Early flower development in Arabidopsis. Plant Cell. 1990, 2: 755-67. 10.1105/tpc.2.8.755
Agashe B, Prasad CK, Siddiqi I: Identification and analysis of DYAD: a gene required for meiotic chromosome organisation and female meiotic progression in Arabidopsis. Development. 2002, 129: 3935-43.
Fransz P, Armstrong S, Alonso-Blanco C, Fischer TC, Torres-Ruiz RA, Jones G: Cytogenetics for the model system Arabidopsis thaliana. Plant J. 1998, 13: 867-76. 10.1046/j.1365-313X.1998.00086.x
Schneitz K, Hulskamp M, Pruitt RE: Wild-type ovule development in Arabidopsis thaliana: a light microscope study of cleared whole-mount tissue. Plant J. 1995, 7: 731-749. 10.1046/j.1365-313X.1995.07050731.x.
Kerzendorfer C, Vignard J, Pedrosa-Harand A, Siwiec T, Akimcheva S, Jolivet S, Sablowski R, Armstrong S, Schweizer D, Mercier R, Schlogelhofer P: The Arabidopsis thaliana MND1 homologue plays a key role in meiotic homologous pairing, synapsis and recombination. J Cell Sci. 2006, 119: 2486-96. 10.1242/jcs.02967
Acknowledgements
This work was supported by the Council for Scientific and Industrial Research (CSIR), Govt. of India and by a grant from the Department of Biotechnology (DBT) to IS. AP, JS, MM, TR were supported by fellowships from CSIR, MR by a fellowship from the University Grants Commission, and BN was supported by a fellowship from DBT. We acknowledge ABRC, Ohio for supply of seed material and DNA clones.
Author information
Authors and Affiliations
Corresponding author
Additional information
Authors' contributions
AP and IS conceived and designed the experiments. AP did the basic genetic and phenotypic analysis of plants together with BN, MM, VS, and VV. TR characterized the Atspo11-1 mutant allele and BN generated the Atmnd1 Atspo11-1 double mutant. MR did the meiotic chromosome analysis. MR and AP did the FISH analysis. JS did the Real Time PCR and RNA in situ expression analysis of AtMND1. IS wrote and BN helped edit the manuscript. All coauthors reviewed and approved the final manuscript.
Authors’ original submitted files for images
Below are the links to the authors’ original submitted files for images.
Rights and permissions
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
About this article
Cite this article
Panoli, A.P., Ravi, M., Sebastian, J. et al. AtMND1 is required for homologous pairing during meiosis in Arabidopsis. BMC Molecular Biol 7, 24 (2006). https://doi.org/10.1186/1471-2199-7-24
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/1471-2199-7-24