Skip to main content
SpringerLink
Log in

Anisotropic elastic bending models of DNA

  • Published:
Journal of Biological Physics Aims and scope Submit manuscript

Abstract

Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs [(aaaattttgc)n, (tctctaaaaaatatataaaaa)n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs [(a)n, (atctaatctaacacaacaca)n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Similar content being viewed by others

References

  1. Travers, A.A. and Klug, A.: In N.R. Cozzarelli and J.C. Wang (eds), DNA topology and its biological effects, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, N.Y., 1990, pp. 57–106.

    Google Scholar 

  2. Travers, A.A.: DNA transcription, keeping the writhe, Curr. Biol. 4 (1994), 659–661.

    Article  Google Scholar 

  3. Ulyanov, N.B. and Zhurkin, V.B.: Sequence dependent anisotropic flexibility of B-DNA: A conformational study, J. Biomol. Str. Dyn. 2 (1984), 361–385.

    Google Scholar 

  4. Calladine, C.R. and Drew, H.R.: Principles of sequence dependent flexure of DNA, J. Mol. Biol. 192 (1986), 907–918.

    Google Scholar 

  5. Wu, H-M. and Crothers, D.M.: The locus of sequence directed and protein induced DNA bending, Nature 308 (1984), 509–513.

    Google Scholar 

  6. Haran, T.E., Kahn, J.D. and Crothers, D.M.: Sequence elements responsible for DNA curvature, J. Mol. Biol. 244 (1994), 135–143.

    Article  Google Scholar 

  7. Lavery, R. and Hartmann, B.: Modelling DNA conformational mechanics, Biophys. Chem. 50 (1994), 33–45.

    Article  Google Scholar 

  8. Vologodskii, A.V. and Frank-Kamenetskii, M.D.: Modelling supercoiled DNA, Methods Enzymol 211 (1992), 467–480.

    Google Scholar 

  9. Yang, Y., Westcott, T.P., Pederson, S.C., Tobias, I. and Olson, W.K.: Effect of localized bending on DNA supercoiling, Trends. Biochem. Sci. 20 (1995), 313–319.

    Article  Google Scholar 

  10. Olson, W.K.: Simulating DNA at low resolution, Curr. Opin. Str. Biol. 6 (1996), 242–256.

    Article  Google Scholar 

  11. Schlick, T. and Olson, W.K.: Supercoiled DNA energetics and dynamics by computer simulation, J. Mol. Biol. 223 (1992), 1089–1119.

    Google Scholar 

  12. Barkley, M.D. and Zimm, B.H.: Theory of twisting and bending of chain macromolecules: Analysis of the fluorescence depolarization of DNA, J. Chem. Phys. 70 (1979), 2991–3007.

    Article  Google Scholar 

  13. Yakushevich, L.V.: Nonlinear DNA dynamics, Physica D 79 (1994), 77–86.

    Google Scholar 

  14. Zhurkin, V.B., Ulyanov, N.B., Gorin, A.A. and Jernigan, R.L.: Static and statistical bending of DNA evaluated by Monte Carlo simulations, Proc. Natl. Acad. Sci. USA 88 (1991), 7046–7050.

    Google Scholar 

  15. Sanghani, S., Zakrzewska, K., Harvey, S.C. and Lavery, R.: Molecular modelling of (A4T4NN)n and (T4A4NN)n: Sequence elements responsible for curvature, Nucl. Acids Res. 24 (1996), 1632–1637.

    Article  Google Scholar 

  16. Yang, Y., Tobias, I. and Olson, W.K.: Finite element analysis of DNA supercoiling, J. Chem. Phys. 98 (1993), 1673–1686.

    Article  Google Scholar 

  17. Bauer, W.R., Lund, R.L. and White, J.H.: Twist and writhe of a DNA loop containing intrinsic bends, Proc. Natl. Acad. Sci. 90 (1993), 833–837.

    Google Scholar 

  18. Calladine, C.R. and Drew, H.R.: Understanding DNA: the molecule and how it works, Academic Press, 1992.

  19. Smith, S.B., Cui, Y. and Bustamante, C.: Overstretching B-DNA: The elastic response of individual double stranded and single stranded DNA molecules, Science 271 (1996), 795–799

    Google Scholar 

  20. Strick, T.r., Allemand, J-F., Bensimon, D., Bensimon, A. and Croquette, V.: The elasticity of a single supercoiled molecule, Science 271 (1996), 1835–1837.

    Google Scholar 

  21. Smith, S.B., Finzi, L. and Bustamante, C.: Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads, Science 258 (1992), 1122–1126.

    Google Scholar 

  22. Hogen, M.E. and Austin, R.H.: Importance of DNA stiffness in protein-DNA bending specificity, Nature 329 (1987), 263–266.

    Article  Google Scholar 

  23. Brukner, I., Sanchez, R., Suck, D. and Pongor, S.: Sequence dependent bending propensity of DNA as revealed by DNase I parameters for trinucleotides, EMBO J. 14 (1995), 1812–1818.

    Google Scholar 

  24. Brukner, I., Sanchez, R., Suck, D. and Pongor, S.: Trinucleotide models for DNA bending propensity: Comparison of models based on DNase I digestion and nucleosome packaging data, J. Biomol. Str. Dyn, 13 (1995), 309–317.

    Google Scholar 

  25. Ulanovsky, L., Bodner, M., Trifonov, E.N. and Choder, M.: Curved DNA: Design, synthesis and circularization, Proc. Natl. Acad. Sci. USA 83 (1986), 862–866.

    Google Scholar 

  26. Bathe, K.J., Finite element procedures in engineering analysis, Prentice-Hall, Englewood Cliffs, N.Y., USA, 1992.

    Google Scholar 

  27. Zienkiewicz, O.C. and Taylor, R.L.: The finite element methods, 4th edn, McGraw-Hill, 1991.

  28. COSMOS/M, Release 1.75, User manual, SARC, Santa Monica, Calif., USA 1995.

    Google Scholar 

  29. Rhodes, D.: Nucleosome cores reconstituted from poly-(dA.dT) and the octamer of histones, Nucl. Acids Res. 6 (1979), 1805–1816.

    Google Scholar 

  30. Bednar, J., Furrer, P., Katritch, V., Stasiak, A.Z., Dubochet, J. and Stasiak, A.: Determination of DNA persistance length by cryo-electron microscopy: separation of the static and dynamic contributions to the apparent persistance length of DNA, J. Mol. Biol. 254 (1995), 579–594.

    Article  Google Scholar 

  31. Hagerman, P.J.: Sequence directed curvature of DNA, Nature 321 (1986), 449–450.

    Google Scholar 

  32. Takeda, Y., Sarai, A. and Rivera, V.: Analysis of the sequence-specific interactions between Cro repressor and operator DNA by systematic base substitution experiments, Proc. Natl. Acad. Sci. USA 86 (1989), 439–443.

    Google Scholar 

  33. Baleja, J.D., Pon, R.T. and Sykes, B.D.: Solution structure of phage lambda half-operator DNA by use of NMR, restrained molecular dynamics, and NOE octamer of histones, Biochemistry 29 (1990), 4228–4239.

    Google Scholar 

  34. Lyubchenko, Y.L., Shlyakhtenko, L.S., Chernov, B.K. and Harrington, R.E.: DNA bending induced by Cro protein binding as demonstrated by gel electrophoresis, Proc. Natl. Acad. Sci. USA 88 (1991), 5331–5334.

    Google Scholar 

  35. Lyubchenko, Y.L., Shlyakhtenko, L.S., Appella, E. and Harrington, R.E.: CA runs increase DNA flexibility in the complex of Cro protein with OR3 site, Biochemistry 34 (1993), 4121–4127.

    Google Scholar 

  36. Erie, D.A., Yang, G., Schultz, H.C. and Bustamante, C.: DNA bending by Cro protein in specific and nonspecific complexes: Implications for protein site recognition and specificity, Science 266 (1994), 1562–1566.

    Google Scholar 

  37. Ponnuswamy, P.K. and Gromiha, M.M.: On the conformational stability of oligonucleotide duplexes and tRNA molecules, J. Theor. Biol. 169 (1994), 419–432.

    Article  Google Scholar 

Download references

Author information

Authors and Affiliations

  1. International Centre for Genetic Engineering and Biotechnology (ICGEB), Area Science Park, Padriciano 99, 34012, Trieste, Italy

    Sándor Pongor

  2. Department of Physics, Bharathidasan University, Tiruchirapalli 620024, Tamil Nadu, India

    M. Michael Gromiha

  3. Faculty of Mechanics, University of Brasov, B-dul Eroilor 29, 2200, Brasov, Romania

    Mircea G. Munteanu

  4. Institute of Molecular Biology, Russian Academy of Sciences, Vavilov St., 32, 117984, Moscow, Russia

    Andrei Gabrielian

Authors
  1. M. Michael Gromiha
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Mircea G. Munteanu
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Andrei Gabrielian
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Sándor Pongor
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Sándor Pongor.

Rights and permissions

Reprints and permissions

About this article

Cite this article

Gromiha, M.M., Munteanu, M.G., Gabrielian, A. et al. Anisotropic elastic bending models of DNA. J Biol Phys 22, 227–243 (1996). https://doi.org/10.1007/BF00401875

Download citation

  • Accepted:

  • Issue Date:

  • DOI: https://doi.org/10.1007/BF00401875

Key words

Search

Navigation