Background

Helicobacter pylori (H. pylori) is a genetically diverse Gram-negative bacteria pathogen that had been identified as group I carcinogen by the International Agency for Research on Cancer (Peter and Beglinger 2007). It chronically infects approximately half of the world population (Malaty 2007). In developing countries, its prevalence could be as high as 90% compared to below 40% in developed countries (Tonkic et al. 2012). The prevalence also varies with geographic regions, age, socioeconomic status, educational level, living environment, and occupation (Wang and Peura 2011).

Although the majority of infections are asymptomatic, clinical manifestations develop in less than 20% of those affected (Cover and Blaser 2009). Chronic H. pylori infection is associated with variable pathological outcomes, including chronic gastritis, peptic ulcers, atrophic gastritis, intestinal metaplasia, and gastric lymphoma, or cancer development (Ferreira et al. 2008; Kandulski et al. 2008). However, studies suggested that some H. pylori infections could protect against illnesses such as esophageal reflux disease, cancer of the cardia and esophagus, asthma, other allergic disease manifestations, inflammatory bowel disease, and tuberculosis (Cover and Blaser 2009; Kyburz and Müller 2017).

The variability of the outcome of this chronic infection may be due to differences in the host genetics, environmental factors, and H. pylori genetic diversity. Such diversity, which is geographically and ethnically structured, was found to affect the function, and antigenicity of virulence factors associated with infection (Arents et al. 2009; Falush et al. 2003). H. pylori virulence factors have the ability to modulate its reaction to the host’s immune response and thereby adapt to individual host’s conditions (Sokic-Milutinovic et al. 2014).

Globally, H.pylori is divided into seven discrete population, hpEurope, hpNEAfrica, hpAfrica1, hpAfrica2, hpAsia2, hpSahul, and hpEastAsia, and subpopulations (hspWafrica and hspSAfrica in hpAfrica1, AE1 and AE2 in hpEurope, hspIndia in hpAsia2, hspEAsia, hspAmerind and hspMaori in hpEastAsia) that are related to geographic localization (Falush et al. 2003).

Differentiation and identification of H. pylori strains could be done based on their 16 s ribosomal RNA (16s rRNA) gene sequence (Banerjee et al. 2011). The 16s rRNA gene is found in all bacteria and comprises nucleotide sequences that are specific to a given bacterial genus (Smith et al. 2004). Molecular tests targeting 16s rRNA gene—of a certain pathogen—are considered specific to confirm infection. As a result, positive amplification of H. pylori-specific DNA is thought-out as a direct evidence of its presence (Chong et al. 1996).

The relation between H. pylori strains and endoscopic findings was not examined before in Egypt. Therefore, this study aims to examine the association between H. pylori strain as dedicated by 16s rRNA gene sequences and the endoscopic outcomes in Egyptian patients with upper gastrointestinal disorders.

Patients and methods

A descriptive study included 50 adult patients from Suez Canal province and Sinai Peninsula presented with dyspeptic symptoms and referred for upper gastro-duodenoscopy at the Suez Canal University Hospital. Written informed consent was obtained from all patients after explaining the aims, outcomes, and possible risks of the study. The study protocol conforms to the ethical guidelines of the 1975 Declaration of Helsinki as reflected in a prior approval by the institution’s human research committee, and was approved by the Ethics Committee at Suez Canal University. The study was carried out at the gastrointestinal endoscopy unit of Suez Canal University Hospital, Oncology Diagnostic Unit Faculty of Medicine, Suez Canal University, Ismailia, Egypt. Patients were selected according to the following: being more than 18 years, of either sex, no history of recent treatment for H. pylori, or proton pump inhibitors. However, patients with a history of gastric surgery, upper gastrointestinal bleeding, or bleeding tendency were excluded.

Endoscopy and histopathology

In the endoscopy room, patients’ age, sex, complaint, and endoscopic examination findings were recorded. Antrum and body gastric biopsies including the epithelium and muscularis mucosa were taken. Slides sectioned from specimens were examined for the presence of H. pylori by Giemsa stain, and histopathologically using hematoxylin and eosin stain. The pathologist was blind regarding patients’ data and findings.

DNA extraction and PCR amplification of the 16s rRNA gene

DNA was extracted from 1 × 3 mm endoscopic gastric biopsy of 50 pateints, which proved to be H. pylori positive by Giemsa stain and histopathologically by hematoxylin and eosin stain, using WizardSV Genomic DNA Purification System (Promega Corporation, Madison, USA). Extracted DNA was quantitated using NanoDrop® (ND)-1000 Spectrophotometer (NanoDrop Technologies Inc., Washington, USA) and stored in – 20 °C until used.

PCR was carried out as described previously (Pellicano et al. 2004), using the following primers: F1: 5′ATTAGTGGCGCACGGGTGAGTAA3′, R1: 5′TTTAGCATCCCGACTTAAGGC3′; 2nd amplification: F2: 5′GAACCTTACCTAGGCTTGACATTG 3′; R2: 5′TTTAGCATCCCGACTTAAGGC3′; PCR cycling condition: initial denaturation at 94 °C for 2 min, 35 cycles of denaturation at 94 °C for 1 min, annealing for 30 s at 56 °C, extension at 72 °C for 90 s, and final extension at 72 °C for 5 min using Robocycler Gradiant 96 Thermo cycler (STRATAGEN, LA, USA). PCR products were visualized on 2% ethidium bromide-stained agarose electrophoresed gel.

DNA sequencing and bioinformatics analysis

PCR products (480 bp) were purified (Qiagen, Hilden, Germany) and sequenced as described (Pellicano et al. 2004). The sequencing results were aligned and compared using Basic Local Alignment Search tool “http://blast.ncbi.nlm.nih.gov/Blast.cgi”. Highly similar sequences were retrieved from NCBI and subjected to multiple sequence alignment using the BioEdit software.

Statistical analysis

Statistical analysis was done using IBM Statistical Package of Social Sciences (SPSS) software version 20.0 for Windows ® software. Data was presented as mean + standard deviation or percentages. Chi-squared test was used for categorical variables. P value was significant at < 0.05.

Results

H. pylori 16s rDNA by PCR (Fig. 1) was found in the gastric tissue of 47/50 (94%) patients. Patients’ mean age was 42.3 + 10.6 years, 52% were male, and 53% lived in rural area. The majority were married (85%) and 29% were smokers.

Fig. 1
figure 1

Two percent agarose gel electrophoresis of PCR products of H. pylori 16s rRNA. Lane M: molecular weight marker (100 bp). Lanes 1, 4, and 5: positive DNA. Lanes 2 and 3: negative DNA samples. Arrow points to expected amplicon band size (480 bp)

Full size image

Endoscopic findings and H. pylori detection

Non-ulcerative lesions (NUL; non-erosive gastritis, esophagitis due to acid reflux, and erosive gastroduodenitis) were diagnosed in 21patients, 90% of specimens were positive for H. pylori DNA. Ulcerative lesions (UL; gastric ulcer, duodenal ulcer, and esophageal ulcer) were diagnosed in 19 patients, whereas 95% of specimens were positive for H. pylori DNA. Neoplastic lesions (NL; adenocarcinoma, adenoma (precancerous), and mucosa-associated lymphoid tissue (MALT) lymphoma) were found in 10 patients, and all were positive for H. pylori DNA.

16s rRNA sequencing results

Sequence analysis of PCR fragments showed that 79% of sequenced fragments are congruent to 16s rRNA sequences of five bacteria: H. pylori, Gemella species, Gemella haemolysan, Neisseria, and Streptococcus species. The remaining 21% showed no similarity to any bacterial 16s rRNA sequences at GenBank to date (Table 1, Fig. 2).

Table 1 Sequence blast of PCR products amplified from gastric biopsies and its distribution among endoscopic lesions of 47 studied patients
Full size table
Fig. 2
figure 2

Chromatograms of gel-purified PCR fragments. a Unidentified sequences with multiple bands and base substitutions. b H. pylori 16rRNA gene sequences

Full size image

16s rRNA sequencing results and endoscopic findings

The allocation of 16s rRNA gene sequences among endoscopic lesions revealed that H. pylori sequences were significantly higher in ulcerative lesions than NUL and NL lesions [P < 0.05], whereas 75% of non-Helicobacter bacteria and 50% of the undefined sequences were detected in patients with NUL without statistical significant association (Table 1).

NUL non-ulcerative lesions, UL ulcerative lesions, NL neoplastic lesions, NS not significant

Blast results of Egyptian H. pylori 16s rRNA isolates and pathological lesions

Sequence BLAST of Egyptian H. pylori 16s rRNA gene showed identity to several accessions of H. pylori 16s rRNA sequences obtained from GenBank (Table 2), whereas, 17/33 (52%) of the Egyptian H. pylori isolates showed identity to hpAfrica1 population [hspSAfrica subpopulation (33%), hspWAfrica subpopulation (18%)], 12/33 (36%) H. pylori isolates showed identity to hspEAsia subpopulation, and the least number 4/33 (12%) showed identity to hpEurope subpopulation.

Table 2 Blast results of Egyptian H. pylori 16s rRNA partial sequence with Gene bank nucleotide consensus sequences
Full size table

In ulcerative lesions, the frequency of H. pylori isolates that exhibit identity to hspEAsia subpopulation (47%) is statistically significantly higher than isolates that show identity to other subpopulations (P < 0.05). On the other hand, although the frequencies of H. pylori isolates from patients with non-ulcerative lesions that showed identity to hspSAfrica subpopulation (55%) and isolates from neoplastic lesions that showed identity to hspWAfrica subpopulation (58%) were high but with no significant association (Table 3).

Table 3 Relation between H. pylori subpopulations and endoscopic diagnosis of the studied patients (no. 33)
Full size table

Allelic variation among Egyptian H. pylori 16s rDNA isolates

Partial sequences within the variable region V9 and universal U6 region of Egyptian H. pylori 16s rDNA isolates were subjected to multiple sequence alignment against 62-base sequences (16s rRNA gene, 1199–1260) that are 100% homologs among H. pylori reference strains; ATCC 43504 and NCTC11637. Based on the nucleotide sequence in V9, the isolates could be categorized into three alleles. Allele 1 comprises one isolate (from duodenal ulcer) and showed two nucleotide mutations in comparison to H. pylori ATCC 43504 and NCTC11637 strains (Fig. 3). Allele 2 embraces four isolates (three adenocarcinomas and one gastric ulcer) and illustrates one nucleotide mutation compared to the reference H. pylori strains. The third allele includes the rest of isolates and had a sequence identical to that of H. pylori ATCC 43504 and NCTC11637 strains (Fig. 3).

Fig. 3
figure 3

Partial sequence alignment of the 16 s rDNA variable V9 and universal U6 regions of H. pylori isolates from Egyptian patients that are 100% homologous among H. pylori ATCC 43504 and H. pylori NCTC11637 reference strains. Dots indicate the identity with the reference strains and letters indicate the base substitution. Isolates specify three individual 16S rDNA V9 alleles (signature sequences) at positions 1239–1260 (Escherichia coli nomenclature (DSRG (DNA Sequencing Research Group) n.d.))

Full size image

Discussion

H. pylori and humans are in intimate relation since the origin of both species in Africa, where three separate H. pylori ancestors differentiated: hpAfrica2, hpAfrica1, and hpNEAfrica. hpAfrica2 was a predominant inhabitant in southern Africa, whereas the others were widespread throughout Africa and accompanied human race migration out of Africa and resulted in the emergence of Asian and Oceanic ancestors: hpAsia2, hpAsia, and hpSahul. Subsequent migrations of the African hpNEAfrica and/or the Asian hpAsia2 populations resulted in the appearance of hpEurope population which then became the predominant population of H. pylori in Europe, the Middle East, and western Asia (Moodley et al. 2012).

In the present study, the sequence analysis of H. pylori 16s rDNA PCR fragments revealed that the H. pylori isolated from Egyptian patients showed identity to four H. pylori subpopulations: hspSAfrica, hspWAfrica, hspEAsia, and hpEurope, with predominance of African and Asian strains (52.5% and 36%, respectively), which contradict a previous report that assigned H. pylori isolated from Egyptians to European H. pylori populations (Linz et al. 2007).

The variety of H. pylori populations observed in the current study may be due to the modern Egyptian population which is composed of a majority of ethnic Egyptians; who are a product of, a mixture of ancient Egyptians; multiple invaders from various parts of Asia and Africa; and a minority of multiple ethnicities include the Turks, Greeks, Abases, Nubians, Armenians, Greeks, Italian, and French (http://countrystudies.us/egypt/59.htm, http://countrystudies.us/egypt/59.htm).

The H. pylori pathogenicity and the disease outcome are related to its strains, as certain strains are linked to more severe gastric lesions than others. Different strains confer polymorphic genetic loci, including the cag pathogenicity island (cag PAI), the vacA gene, and the babA2 gene that seem to be interdependent markers that could reflect the degree of disease risk (Kao et al. 2016).

In the present study, the frequency of H. pylori isolates that exhibits identity to East Asia H. pylori strains (hspEAsia subpopulation) is statistically significantly higher in ulcerative lesions than other lesions, confirming a previously published report (Gunaletchumy et al. 2014).

Nearly 100% of East Asia H. pylori isolates are cagA+ and vacA s1 strains which are linked to peptic ulcer disease (Parsonnet et al. 1997; Lai et al. 2002). H. pylori cag A+ strains possess intact cag PAI (pathogenicity-associated island) that encodes antigenic effector protein (CagA), which contains East Asian strains, a tyrosine motif (EPIYA-D) that is highly phosphorylated by Src and Abl family kinases, a process associated with dephosphorylation of host-cell proteins results in impairment of a variety of intracellular signaling systems, morphological changes in gastric epithelium, increase induction of IL-8, and inflammation in human gastric mucosa (Odenbreit et al. 2000; Vilaichone et al. 2004).

VacA (vacuolating cytotoxin) is a pore-forming cytotoxin upon interring host cells; it induces multiple cellular activities, including mitochondria-membrane-channel formation leading to cytochrome C release and apoptosis. It also binds to cell membrane receptors and initiates a proinflammatory response (Kusters et al. 2006). In addition, VacA in combination with heparan sulfate-binding proteins, released by H. pylori, bind host growth factors and may impair mucosal repair, thus contributing to ulcer pathogenesis (Ricci et al. 1996; Ascencio et al. 1995). vacA s1 strains have the highest cytotoxicity because they consistently induce cell vacuolation and are associated with high levels of inflammation in the gastric mucosa (Miftahussurur and Yamaoka 2015).

In the current study, more than half of the H. pylori isolates from neoplastic lesions exhibit identity to hspWAfrica (Gambia94/24, USU-102) and hspEAsia (Japan strains) subpopulations; west Africa and Japan are among the highest incidence of gastric cancer in Africa and East Asia (20.3/100000 and 31.1/100000 people, respectively) (Asombang et al. 2014; Lin et al. 2011).

hspWAfrica and hspEAsia are cagA+ strains (Bullock et al. 2017), a virulence factor that is directly related to gastric cancer development by several studies (Matos et al. 2013; Hatakeyama 2014). Intracellulary, the phosphorylated CagA binds to the phosphatase SHP-2 and affects the adhesion, spreading, proliferation, and migration of the host cell (Yamazaki et al. 2003; Boonyanugomol et al. 2011). Furthermore, de-phosphorylated CagA affects Akt signaling pathway which in turn activates NF-κB and β-catenin and, as a result, contributes to cellular proliferation and inflammation (Suzuki et al. 2009).

It should be noted, in the present study, non-ulcerative lesions exhibit a high prevalence of H. pylori isolates that show identity to the hspSAfrica subpopulation. The relation of humans of African origin infected with African strains under hspSAfrica subpopulation to the less invasive gastric disease is documented before, referred to as “the African enigma” as though a high percentage of populations carry H. pylori, but the rate of gastric ulcer and cancer is rather low, raising the possibility that African strains of H. pylori may have reduced virulence due to convolution of both species over a prolonged period of time. Disparity among the geographic ancestry of human hosts and the geographic origin of H. pylori strains has been associated with more severe gastric pathology and the development of premalignant gastric lesions (de Martel et al. 2013).

Sequence variation in the H. pylori 16S rDNA variable regions occurs, providing a reliable system for sub-typing (Monstein et al. 2001). In the present study, sequence analysis of 16s rRNA gene V9 revealed that one H .pylori isolate from duodenal ulcer lesion showed two nucleotide mutations in comparison to H. pylori ATCC 43504 and NCTC11637 reference strains. In addition, four isolates showed one nucleotide mutation compared to the reference strains. H. pylori allelic diversity is probably due to mutations, interspecies genetic recombination, and long evolutional history of the species (Suerbaum and Josenhans 2007).

It is worth noting that the nucleotide sequence of ten PCR fragments could not be aligned to any gene bank sequence. Chromatograms of these gel-purified PCR fragments show it properly has multiple different DNA bands of the same size, exhibiting multiple base substitutions (Fig. 2) (DSRG (DNA Sequencing Research Group) n.d.). Considering, in this study, the multiple bands were amplified from histological positive H. pylori specimens, it could be presumed that these PCR fragments belonged to different H. pylori strains colonizing the gastric mucosa of the same patients. In support of this conclusion, Israel et al. reported that a single host can carry several H. pylori strains, which can change over time owing to endogenous mutations or chromosomal recombination and rearrangement between them (Israel et al. 2001).

Unexpectedly, four 16s rRNA PCR fragments amplified from histologically positive H. pylori specimens show similarity to non-Helicobacter species, which is Gemella species, Gemella haemolysan, Neisseria, and Streptococcus species. Most of this non-Helicobacter species were upper respiratory tract microflora and capable of colonizing the stomach of H. pylori-positive patients; upper gastrointestinal disorders associated with low acid level induced by H. pylori may enable non-Helicobacter bacteria to survive and colonize in the human stomach (Husebye 2005; Yuan et al. 2012).

The reason why these organisms were amplified may be due to the discovery that, although their 16s rRNA gene sequences showed less than 80% identity to 16s rRNA gene sequences of H. pylori 43504 strain, the forward primer used in the second amplification and sequencing is 90% matched to nucleotides in 16s rRNA gene of these organisms (especially the three 3′nts of the primer are 100% matched).

In this study, non-Helicobacter bacteria colonize patients with NUL and neoplastic lesions. The co-existence of non-Helicobacter bacterias with H. pylori infection may influence the pathogenesis of stomach disorders. Non-H. pylori bacteria and/or their byproducts may act as a persistent antigenic stimulus that augments the inflammatory response induced by H. pylori infection, thus eliciting a more vigorous inflammatory response and leading to the development of atrophic corpus gastritis (Sanduleanu et al. 2001).

Conclusion

The pathology of H. pylori-associated diseases depends on the strain and subpopulation of the bacteria. Sequencing and analysis of the 16rRNA gene PCR product data could be a useful diagnostic and prognostic tool of the pathogen outcome. Further studies are needed to confirm these results and to exploring synergistic effects of non-H. pylori bacteria on H. pylori infection for gastrointestinal diseases.