Background

Variants of the MYH9 gene on the long arm of chromosome 22, which encodes the heavy chain A of nonmuscle myosin of class II (NMMHC-IIA), causes a May–Hegglin anomaly with giant thrombocytopenia, hearing loss, cataracts, and nephropathy due to structural abnormalities of the actin cytoskeleton in podocytes, triggering focal segmental glomerulosclerosis (FSGS). Importantly, the May–Hegglin anomaly, Fechtner syndrome, Sebastian syndrome, and Epstein syndrome constitute a single group with a continuous clinical spectrum, varying from mild macrothrombocytopenia with leukocyte inclusions (Döhle-like bodies) to a severe form complicated by hearing loss, cataracts, and renal failure. Therefore, these four diseases have been grouped together and referred to as MYH9-related diseases (MYH9-RD) [1]. These are autosomal-dominant genetic disorder, with approximately 20% of cases caused by de novo mutations [2].

Although genetic testing has advanced markedly in recent decades, the correlations between genotype and phenotype in patients with MYH9-RD, such as renal functional prognosis and bleeding tendency, remain unclear. In addition, there is no consensus regarding the choice of renal replacement therapy or perioperative target platelet levels in patients with MYH9-RD.

Herein, we report a case of Fechtner syndrome in which hemodialysis (HD) and renal transplantation were performed safely. We describe the selection of renal replacement therapy, management of thrombocytopenia during the perioperative period, and the association of mutations in MYH9 with prognosis of renal disease in a case of MYH9-RD.

Case presentation

A 34-year-old woman was diagnosed with Fechtner syndrome after presenting with thrombocytopenia, glaucoma, cataracts, and hearing loss at the age of 2 years. No family history of thrombocytopenia or nephropathy was noted, and the patient’s condition was considered sporadic. The patient had bilateral mixed hearing loss, cataracts, and glaucoma. Urinary protein was detected since the age of three. In addition, renal failure progressed during adolescence. At the age of 18, a renal biopsy was performed, which revealed FSGS with mesangial proliferation, glomerular basement thickening, and splitting. Histological findings were in line with those of a previous report [3]. Therefore, the patient was diagnosed with Fechtner syndrome-associated nephropathy. She continued renal-protective therapy with oral renin-angiotensin system inhibitors. At the age of 30, she visited our hospital. Her serum creatinine level and estimated glomerular filtration rate (eGFR) were 2.42 mg/dL and 21 mL/min/1.73 m2, respectively. Her urinary protein-to-creatinine ratio (UPCR) was 2.65 g/gCr. Her renal dysfunction progressed to a serum creatinine level of 5.73 mg/dL, eGFR of 8 mL/min/1.73 m2, and UPCR of 2.48 g/gCr over 2 years. She selected renal transplantation as a renal replacement therapy from her mother as a donor. She was admitted for pre-transplant testing at the age of 33. On admission, renal impairment with a serum creatinine level of 8.48 mg/dL and eGFR of 5 mL/min/1.73 m2 was observed, and thrombocytopenia (39 × 109/L platelets) with giant platelets and Döhle-like bodies was detected (Table 1). The UPCR was 2.0 g/gCr (Table 1). ABO-compatible living-donor renal transplantation was scheduled with her mother as donor. However, due to the rapid progression of renal failure, dialysis therapy before kidney transplantation was necessary. Based on the findings in previous reports, we considered that her thrombocytopenia might not limit the choice of renal replacement therapy. After a shared decision-making process for dialysis as bridging therapy, the patient chose to undergo HD. Eight months before renal transplantation, an arteriovenous fistula (AVF) was created on the left forearm. The preoperative platelet count was 30 × 109/L–40 × 109/L, and ten units of platelets were transfused to maintain a platelet count of 50 × 109/L during the operation. Five months before renal transplantation, uremic symptoms, such as nausea and anorexia, appeared, for which HD was initiated. Heparin was switched to nafamostat mesylate as an anticoagulant during HD to minimize the risk of bleeding.

Table 1 Clinical laboratory data of the patient on admission
Full size table

Finally, the patient underwent living-donor renal transplantation. Since the patient was at a high risk of bleeding, the platelet count was maintained above 100 × 109/L from the perioperative period until day 10 after renal transplantation, with a total of 120 units of platelet transfusion. She was discharged 22 days after renal transplantation without any postoperative bleeding episodes. The patient received four immunosuppressive drugs: methylprednisolone, cyclosporine A, mycophenolate mofetil (MMF), and everolimus. Her renal function has remained stable, with a serum creatinine level of approximately 1.4 mg/dL, and urinary protein has not been detected for 1.5 years following transplantation.

Considering that the patient wanted to have a baby and preimplantation genetic diagnosis of MYH9-RD is not available in Japan, we provided genetic counseling, noting that patients with MYH9-RD have a 50% chance of passing the variant to their offspring. She further underwent genetic testing, which revealed an MYH9 gene 25 exon c.3195_c.3215 deletion mutation (delCGAGCTCCAGGCCCAGATCGC, p. A1065_A1072 del).

Discussion and conclusions

MYH9-RD, including Fechtner syndrome, is an autosomal-dominant disorder associated with macrothrombocytopenia and leukocyte inclusion bodies at birth, with a risk of developing nephropathy, deafness, and cataracts during infancy or adulthood.

Nephropathy is present in approximately 30% of patients with MYH9-RD, proteinuria usually develops before the age of 30, and 70% of affected patients develop renal failure within a few years [3]. The renal replacement therapies selected by patients with MYH9-RD are summarized in Table 2, which also focuses on the association between bleeding episodes and management of thrombocytopenia due to genetic mutations. In the case of MYH9-RD, HD, peritoneal dialysis (PD) and renal transplantation have been reported [4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21]. Since the patient hoped to conceive after renal transplantation in this case, we explained the rare complication of PD catheter obstruction due to fallopian tube wrapping [20]. The patient requested HD as bridging therapy. A few reports have discussed the type of anticoagulant used during HD, with two cases avoiding heparin [8, 13] and one requiring biweekly platelet transfusion due to an incident of bleeding during HD [6]. Therefore, we selected nafamostat mesylate as it is less likely to cause bleeding [22].

Table 2 Selection of Renal Replacement Therapy, Platelet Counts, Perioperative management and bleeding complications in Patients with MYH9-RD
Full size table

Approximately 28% of patients with MYH9-RD exhibit spontaneous mucosal bleeding, including hypermenorrhea and nose/oral bleeding [23]. Therefore, maintaining optimal platelet targets is essential, particularly during the perioperative period. In general, for major elective non-neuraxial surgery, platelet transfusion targeting a level of 50 × 109/L is recommended [24]. For major surgical interventions, platelet counts of > 100 × 109/L are recommended [25]. In the largest review of MYH9-RD, severe bleeding complications requiring blood transfusion occurred in 16 of 183 patients (9%). The mean platelet count was 38 × 109/L [23]. A cohort study of patients with MYH9-RD in France also reported a higher incidence of bleeding with platelet counts < 50 × 109/L [26]. These reports indicated that maintaining a minimum of 50 × 109/L, particularly during the perioperative period, is important. Consistently, patients with platelet levels of at least 50 × 109/L underwent successful AVF creation without platelet transfusion [4]. According to previous reports regarding renal transplantation in patients with MYH9-RD, platelet counts of 50–115 × 109/L were maintained by transfusions [4, 7, 10, 14, 16, 19]. Importantly, a case report pointed out that achieving 50 × 109/L by transfusion for renal transplantation would not be sufficient to prevent bleeding complications such as intracranial hemorrhage and postoperative intra-abdominal hematoma [19]. These case reports led us to conclude that targeting a platelet count of 50 × 109/L for AVF formation and 100 × 109/L for renal transplantation might be reasonable. Ten units of platelets were transfused almost daily for 10 days postoperatively. In total, 120 units of platelets were transfused. We paid careful attention to frequent platelet transfusions that may produce anti-platelet and donor-specific antibodies. This complication could have led to platelet transfusion refractoriness and antibody-related rejection in renal transplantation [27, 28]. Fortunately, no anti-platelet antibodies or donor-specific antibodies were detected in this case.

Our patient was clinically diagnosed with Fechtner syndrome, with genetic testing revealing a heterozygous in-frame variant of 3195–3215 (p. A1065_A1072 del). To identify the association between MYH9 mutations and nephropathy, Pecci et al. evaluated gene-system-phenotype correlations in 255 cases from 121 families. They revealed that mutations in the head (motor) domain, essential for cell motility and maintenance of cell shape, were associated with a higher incidence of nephropathy compared with tail domain mutations [23]. Furthermore, the clinical phenotype varied according to mutation site. For instance, the Arg702 substitution in the head domain was associated with severe thrombocytopenia and nephropathy [23, 29]. Since the patient’s condition progressed to ESRD, a mutation in the head domain was expected. However, the result revealed a heterozygous in-frame mutation in the coiled-coil or tail domain, not the head domain. Patients with the same mutations as in our patient are summarized in Table 3 [1, 15, 23, 30,31,32,33]. Of note, although severe renal manifestation was reported in a 26-year-old Chinese man in whom ESRD developed [15], mild renal manifestations were mainly reported. Thus, this mutation has been recognized to cause mild nephropathy. However, our patient’s condition progressed into ESRD at a young age. We cannot exclude the possibility that a heterozygous in-frame mutation (p. A1065_A1072 del) at 3195–3215 on exon 25 causes severe nephropathy in combination with environmental factors or other genetic problems. Further research and an accumulation of cases are required to verify this possibility.

Table 3 Clinical presentation of cases with mutations that result in the removal or duplication of the one specific amino-acid sequence as in this case
Full size table

Our patient plans to use blastocyst freezing to have a baby in the future. Previous reports have shown a high risk of graft loss associated with pregnancy within 1–2 years after renal transplantation [34]. Following the KDIGO guidelines [35], the patient plans to resume this infertility treatment after waiting 1 year after transplantation, with the conditions that urinary protein remains negative and renal function remains stable. It has been reported that since humoral factor(s) could contribute to the recurrence of FSGS after renal transplantation, recurrence is 20–40% for initial transplantation and 80% for re-transplantation. Post-transplant recurrence for patients with inherited FSGS as in our case is 5–8%, significantly less than the overall rate [36]. However, we cannot exclude the possibility that our patient would experience the recurrence of FSGS, since a mutant podocyte cytoskeletal protein is detected in Fechtner syndrome and some podocyte mutant proteins could contribute to recurrence after transplantation [37]. We also will consider switching from MMF, and potentially everolimus, to other immunosuppressive drugs.

Although this patient was considered to be a de novo case, penetrance of MYH9-RD-related thrombocytopenia was complete, with a 50% chance of offspring inheriting it [29]. In a systematic review of pregnancies in patients with May–Hegglin anomaly (another form of MYH9-RD), 78 neonates survived and two intrauterine deaths occurred in 75 pregnancies. Of the 78 survivors, 34 were diagnosed with May–Hegglin anomaly, and three required prophylactic platelet transfusion [38]. A previous review reported that postpartum hemorrhage was observed in four pregnancies but did not require emergency hysterectomy for uncontrolled bleeding at postdelivery. Given that the review focused only on May–Hegglin anomaly without nephropathy, the risk of complications is expected to be higher in cases with chronic kidney disease. Although the penetrance of MYH9-RD is variable, with phenotypes varying within families, careful monitoring of both mother and newborn is critical [16].

In summary, we report a case of Fechtner syndrome in which the patient underwent successful HD and renal transplantation without severe bleeding by maintaining adequate platelet counts. Since there have been few reports focusing on the selection of renal replacement therapy and anticoagulants during dialysis for MYH9-RD, this report should advance our understanding of the management of renal replacement therapy in such patients. Since our patient hopes to have children, we need to carefully evaluate the association between in-frame mutations and renal prognoses. An accumulation of cases is warranted to decide on clinical management based on genetic information and predict prognosis in patients and their descendants.