Abstract
Objective
Sulfodiicoccus acidiphilus HS-1T is the type species of the genus Sulfodiicoccus, a thermoacidophilic archaeon belonging to the order Sulfolobales (class Thermoprotei; phylum Crenarchaeota). While S. acidiphilus HS-1T shares many common physiological and phenotypic features with other Sulfolobales species, the similarities in their 16S rRNA gene sequences are less than 89%. In order to know the genomic features of S. acidiphilus HS-1T in the order Sulfolobales, we determined and characterized the genome of this strain.
Results
The circular genome of S. acidiphilus HS-1T is comprised of 2353,189 bp with a G+C content of 51.15 mol%. A total of 2459 genes were predicted, including 2411 protein coding and 48 RNA genes. The notable genomic features of S. acidiphilus HS-1T in Sulfolobales species are the absence of genes for polB3 and the autotrophic carbon fixation pathway, and the distribution pattern of essential genes and sequences related to genomic replication initiation. These insights contribute to an understanding of archaeal genomic diversity and evolution.
Introduction
Sulfodiicoccus acidiphilus HS-1T, represented a novel genus, was recently isolated in our laboratory and validly described [1]. The genus belongs to the order Sulfolobales, a well-known taxon of the phylum Crenarchaeota, widely inhabits hot acidic environments all over the world [2,3,4,5]. The 16S rRNA gene sequence similarities between S. acidiphilus and other species in the order Sulfolobales were less than 89%. Given the low 16S rRNA gene similarities with other Sulfolobales species, we hypothesized that the strain also harbored distinct genomic features in Sulfolobales species. Therefore, we determined the complete genome of S. acidiphilus HS-1T and compared it with other genomes in Sulfolobales species. Genomic analysis revealed that S. acidiphilus HS-1T has several distinguishing genomic features.
Main text
Methods
Organism information
The isolation and characterization of S. acidophilus HS-1T representing a novel genus Sulfodiicoccus was reported previously [1, 6]. The phylogenetic position of S. acidiphilus based on 16S rRNA gene sequences is shown in Additional file 1: Figure S1. The general features of S. acidiphilus HS-1T are shown in Additional file 1: Table S1. HS-1T is an irregular cocci, non-motile, thermoacidophilic archaeon. Optimal growth occurs at 65–70 °C and pH 3–3.5. The strain is obligately aerobic and can utilize the following organics as a sole carbon source: yeast extract, beef extract, casamino acids, peptone, tryptone, xylose, galactose, glucose, maltose, sucrose, raffinose, lactose, aspartic acid and glutamic acid. Chemolithotrophic growth does not occur when S0, FeS2, K2S4O6, Na2S2O3 or FeSO4 acts as an electron donor under aerobic conditions (O2 as an electron acceptor). The cells are regular to irregular cocci with a diameter of 0.8–1.5 μm (Additional file 1: Figure S2).
Genomic DNA preparation, genome sequencing and assembly
HS-1T was cultivated in a 5 L glass bottle using ~ 4 L modified Brock’s basal salt (MBS) medium [7], supplemented with yeast extract (1 g/L) and glucose (1 g/L) under aerobic conditions (65 °C, pH 3). Approximately 1 L of the culture in early exponential phase was centrifuged (OD600 = ~ 0.1, 8000×g, 4 °C, 10 min), and the supernatant was removed. DNA was extracted from the resulting cell pellets using the Genomic DNA Buffer Set (QIAGEN) and the Genomic-Tip 500/G (QIAGEN), according to the manufacturer’s protocols. The quantity and purity of the extracted DNA was checked spectrophotometrically and through agarose gel electrophoresis. The genome sequencing of the S. acidiphilus strain HS-1T was performed by Macrogen Inc. (South Korea) using a PacBio RS II sequencer (Pacific Biosciences, Menlo Park, CA, US). De novo assembly was conducted using the Hierarchical Genome Assembly Process v.3.0 (https://github.com/PacificBiosciences/Bioinformatics-Training/wiki/HGAP).
Genome annotation
Annotation of the protein coding genes and the COG (cluster of orthologous groups) assignments were performed using the on-line annotation server DFAST [8]. The tRNA and rRNA genes were identified using tRNAscan-SE [9, 10] and DFAST, respectively. Pseudogenes were identified using LAST [11] implemented in DFAST. Protein coding genes with Pfam domains [12] were searched using a CD-search program [13] with an e-value threshold of less than 1e−2 (database: Pfam v.30.0). Signal peptides were predicted using PRED-SIGNAL [14]. Transmembrane helices were predicted using TMHMM [15]. CRISPR repeats were detected using the CRISPR recognition tool CRT [16]. Genes in internal clusters were predicted using the CD-HIT Suite (sequence identity cut-off: 0.3, minimal alignment coverage for longer and shorter sequences: 0.7, other parameters: default) [17].
Search of replication origin
The replication origin (oriC) and origin recognition box (ORB) in the chromosome were predicted by Ori-finder 2 [18]. Another replication origin in the chromosome was manually searched. Repeat sequences in the predicted oriC region were searched by the REPuter program [19].
Reexamination of chemolithotrophic growth on hydrogen
The autotrophic growth of HS-1T on hydrogen was reexamined. MBS medium (10 mL, pH 3) was added to a glass test tube and the headspace was filled with H2/CO2/air (80:20:10, 120 kPa). A 50 μL of active culture was inoculated into the test tube and incubation occurred at 65 °C for 2 weeks.
Genome project history
The complete genome sequence of HS-1T (= JCM 31740T = InaCC Ar79T) was deposited in GenBank under accession number AP018553. The raw data (PacBio reads) used for the assembly was deposited in the DNA Data Bank of Japan under accession number DRA008516. The Bioproject accession number is PRJDB6753. A summary of the genome project is provided in Additional file 1: Table S2.
Results and discussion
Genome properties
A complete circular genome sequence (2,353,189 bp) was successfully obtained from a total of 225,345 subreads (a total of 1,538,043,255 bp), and a plasmid was absent. The G+C content is 51.15 mol%, which is identical to the reported value of 52.0 mol% estimated by HPLC method [1]. The genome was predicted to contain a total of 2459 genes, of which 2411 code for proteins and 48 code for RNAs (rRNA: 3, tRNA: 45). The genome harbors each one copy of 5S, 16S and 23S rRNA genes. Genes of 16S and 23S rRNA are encoded in a gene cluster with a 191 bp spacer region, while 5S rRNA gene is found in different location. Among the 2411 protein coding genes, 1219 were assigned putative functions. A total of 837 and 244 genes could be assigned COG functional categories and pseudogenes, respectively (Additional file 1: Tables S3, S4, Figure S3). Three CRISPR repeat regions were detected (positions: 1664810–1679609, 1679646–1680862, and 1688612–1701897). No plasmids were detected. Other genomic statistics such as predicted Pfam domains, signal peptides, and transmembrane helices are summarized in Additional file 1: Table S3.
Insights from the genome sequence
Replication initiation genes and oriC
All previously identified species of the order Sulfolobales (whose complete genomic sequences are available) have three copies of the cdc6 gene (a cell division control gene, Additional file 1: Table S5). In contrast, only one copy of the cdc6 gene (HS1genome0091) was found in the HS-1T genome (Fig. 1a). One replication origin (named oriC-1, position: 87,046–87,335) located directly upstream of the cdc6 gene was predicted by the Ori-finder 2. The oriC-1 had a relatively high content of adenine and thymine residues (A/T rich) (56.55%) and contained three ORBs as typical archaeal genomes with the following sequence: ACCCCTCTGTTTCCACTGGA [18, 20,21,22] (Fig. 1b).A previously reported uncharacterized motif (UCM) that exists in the oriC regions of several Crenarchaea [23] has also been located in HS-1T oriC-1. These facts indicate that oriC-1 is a DNA replication origin. Another replication initiation-related gene, whiP (HS1genome1070) [23], was found on the opposite side of the cdc6 (Fig. 1a), however, neither oriC nor ORB sequences were found around whiP by Ori-finder 2. We then manually searched for putative oriC regions, and an A/T rich intergenic region (64.91%, position: 1,016,172–1,016,607, named as oriC-2) was found directly upstream of whiP. Further attempts to search for repeat sequences in oriC-2 using the REPuter program [19] confirmed the presence of 12 direct repeats (8–11 bp, Fig. 1b). The role of the direct repeats is unclear, although they may be involved in the recognition of the replication origin for the DNA initiation protein WhiP. Perhaps the direct repeats alternatively function as an ORB. Further experiments such as DNaseI footprint analyses [23, 24] are required to know the function.
Pathways involved in autotrophic growth
Two CO2 fixation pathways have been reported in the thermophilic autotroph Crenarchaeota, namely the 3-hydroxypropionate/4-hydroxybutyrate (HP/HB) cycle and the dicarboxylate/4-hydroxybutyrate (DC/HB) cycle [25]. Most species in the order Sulfolobales are thought to possess the HP/HB cycle but not the DC/HB cycle [25,26,27]. Both cycles are absent in HS-1T (Fig. 2). The other known autotrophic pathways (Calvin–Bassham–Benson cycle, reductive citric acid cycle (Amon–Buchanan cycle), reductive acetyl-CoA pathway (Wood–Ljungdahl pathway) and 3-hydroxypropionate cycle) [28] have not been identified in HS-1T. These observations are consistent with the incapability of chemolithoautotrophic growth of HS-1T [1]. In the previous paper, we mentioned the capability of chemolithoautotrophic growth of HS-1T using hydrogen as an electron donor. Based on the genomic information, we carefully reexamined the capability of chemolithoautotrophic growth with serial inoculation using the chemolithoautotrophic medium, and no growth occurred after 2nd inoculation. Thus, we revise our previous description regarding the autotrophic growth of HS-1T on hydrogen, to “HS-1T does not grow on hydrogen autotrophically.”
Lack of polB3 in the genome of HS-1T
Three groups of family B DNA polymerases (PolB1, PolB2, and PolB3) have been associated with archaea: PolB1 is only distributed in the superphylum that includes Thaumarchaeota, Aigarchaeota, Crenarchaeota and Korarchaeota (also known as TACK superphylum); PolB2 is patchily distributed in most of the archaeal lineages; and PolB3 is distributed in all archaea except for Thaumarchaeota [29]. Surprisingly, the HS-1T genome lacks polB3, although all the crenarchaeal genomes reported before harbor the gene. In the order Sulfolobales, polB3 is located on the downstream region of dnaG, with a high genomic synteny around the dnaG sequence among Sulfolobales species, while the genome structure of the downstream region of dnaG of HS-1T is different from those in the genomes of other Sulfolobales species (Fig. 3). Since all the other species in the order Sulfolobales have a polB3 downstream of a dnaG, HS-1T may have lost polB3 and the downstream region of dnaG during the course of its evolution. The roles of PolB1, PolB2 and PolB3 in Saccharolobus solfataricus (synonym: Sulfolobus solfataricus), a model organism of the order Sulfolobales, were previously investigated in vivo by Choi et al. [30]. The authors showed that PolB1 was catalytically much more efficient and processive than PolB2 and PolB3, suggesting that PolB1 plays a catalytic role as the main replicative DNA polymerase. They also suggested that PolB2 and PolB3 have limited catalytic roles in translesion DNA synthesis and may not be involved in chromosomal DNA replication [30]. The lack of a polB3 gene in S. acidiphilus HS-1T indicates that PolB3 is not essential for either DNA replication or translesion DNA synthesis in Sulfolobales or the phylum Crenarchaeota.
Organization of genes around dnaG and polB3 in the genomes of the Sulfolobales species. The downstream dnaG region, containing polB3 and several other genes, is not present in the HS-1T genome. Each color represents similar genes except for white, which indicates genes detected only in this region of HS-1T
Limitations
This study focused on noteworthy genomic features of S. acidiphilus HS-1T that are distinct from other Sulfolobales species. Although our genomic analyses revealed some exceptions of genomic features in Sulfolobales, further molecular biology assessment and biochemical analyses are needed to resolve the issues raised in this manuscript.
Availability of data and materials
The complete genome sequence of HS-1T is available in GenBank repository, https://www.ncbi.nlm.nih.gov/genbank/, under accession number AP018553 (the Bioproject accession number is PRJDB6753). The raw data (PacBio reads) used for the assembly is available in the DNA Data Bank of Japan repository, https://www.ddbj.nig.ac.jp/, under accession number DRA008516.
Abbreviations
- HPLC:
-
high performance liquid chromatography
- HP/HB:
-
3-hydroxypropionate/4-hydroxybutyrate
- DC/HB:
-
dicarboxylate/4-hydroxybutyrate
- ORB:
-
origin recognition box
- UCM:
-
uncharacterized motif
References
Sakai HD, Kurosawa N. Sulfodiicoccus acidiphilus gen. nov., sp. nov., a sulfur-inhibited thermoacidophilic archaeon belonging to the order Sulfolobales isolated from a terrestrial acidic hot spring. Int J Syst Evol Microbiol. 2017;67:1880–6.
Satoh T, Watanabe K, Yamamoto H, Yamamoto S, Kurosawa N. Archaeal community structures in the solfataric acidic hot springs with different temperatures and elemental compositions. Archaea. 2013. https://doi.org/10.1155/2013/723871.
Kato S, Itoh T, Yamagishi A. Archaeal diversity in a terrestrial acidic spring field revealed by a novel PCR primer targeting archaeal 16S rRNA genes. FEMS Microbiol Lett. 2011;319:34–43.
Perevalova AA, Kolganova TV, Birkeland NK, Schleper C, Bonch-Osmolovskaya EA, Lebedinsky AV. Distribution of Crenarchaeota representatives in terrestrial hot springs of Russia and Iceland. Appl Environ Microbiol. 2008;74:7620–8.
Urbieta MS, Toril EG, Giaveno MA, Bazán ÁA, Donati ER. Archaeal and bacterial diversity in five different hydrothermal ponds in the Copahue region in Argentina. Syst Appl Microbiol. 2014;37:429–41.
Sakai HD, Kurosawa N. Exploration and isolation of novel thermophiles in frozen enrichment cultures derived from a terrestrial acidic hot spring. Extremophiles. 2016;20:207–14.
Kurosawa N, Itoh YH, Iwai T, Sugai A, Uda I, Kimura N, et al. Sulfurisphaera ohwakuensis gen. nov., sp. nov., a novel extremely thermophilic acidophile of the order Sulfolobales. Int J Syst Bacteriol. 1998;48:451–6.
Tanizawa Y, Fujisawa T, Nakamura Y. DFAST: a flexible prokaryotic genome annotation pipeline for faster genome publication. Bioinformatics. 2017;34:1037–9.
Lowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997;25:955–64.
Cros MJ, Monte AD, Mariette J, Bardou P, Grenier-Boley B, Gautheret D, et al. RNAspace.org: an integrated environment for the prediction, annotation, and analysis of ncRNA. RNA. 2011;17:1947–56.
Kielbasa SM, Wan R, Sato K, Horton P, Frith MC. Adaptive seeds tame genomic sequence comparison. Genome Res. 2011;21:487–93.
Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL, et al. The Pfam protein families database: towards a more sustainable future. Nucleic Acids Res. 2016;44:D279–85.
Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, et al. CDD: a Conserved domain database for the functional annotation of proteins. Nucleic Acids Res. 2011;39:225–9.
Bagos PG, Tsirigos KD, Plessas SK, Liakopoulos TD, Hamodrakas SJ. Prediction of signal peptides in archaea. Protein Eng Des Sel. 2009;22:27–35.
Krogh A, Rn Larsson BÈ, Von Heijne G, Sonnhammer ELL. Predicting transmembrane protein topology with a hidden markov model: application to complete genomes. J Mol Biol. 2001;305:567–80.
Bland C, Ramsey TL, Sabree F, Lowe M, Brown K, Kyrpides NC, et al. CRISPR recognition tool (CRT): a tool for automatic detection of clustered regularly interspaced palindromic repeats. BMC Bioinform. 2007;8:1–8.
Huang Y, Niu B, Gao Y, Fu L, Li W. CD-HIT Suite: a web server for clustering and comparing biological sequences. Bioinformatics. 2010;26:680–2.
Luo H, Zhang CT, Gao F. Ori-Finder 2, an integrated tool to predict replication origins in the archaeal genomes. Front Microbiol. 2014;5:1–6.
Kurtz S, Choudhuri JV, Ohlebusch E, Schleiermacher C, Stoye J, Giegerich R. REPuter: the manifold applications of repeat analysis on a genomic scale. Nucleic Acids Res. 2001;29:4633–42.
Ausiannikava D, Allers T. Diversity of DNA replication in the archaea. Genes. 2017;8:56.
Manzella MP, Holmes DE, Rocheleau JM, Chung A, Reguera G, Kashefi K. The complete genome sequence and emendation of the hyperthermophilic, obligate iron-reducing archaeon “Geoglobus ahangari” strain 234T. Std Genomic Sci. 2015;10:1–19.
Wu Z, Liu J, Yang H, Xiang H. DNA replication origins in archaea. Front Microbiol. 2014;5:1–7.
Robinson NP, Bell SD. Extrachromosomal element capture and the evolution of multiple replication origins in archaeal chromosomes. Proc Natl Acad Sci. 2007;104:5806–11.
Robinson NP, Dionne I, Lundgren M, Marsh VL, Bernander R, Bell SD. Identification of two origins of replication in the single chromosome of the archaeon Sulfolobus solfataricus. Cell. 2004;116:25–38.
Berg IA, Ramos-Vera WH, Petri A, Huber H, Fuchs G. Study of the distribution of autotrophic CO2 fixation cycles in Crenarchaeota. Microbiology. 2010;156:256–69.
Dai X, Wang H, Zhang Z, Li K, Zhang X, Mora-López M, et al. Genome sequencing of Sulfolobus sp. A20 from costa rica and comparative analyses of the putative pathways of carbon, nitrogen, and sulfur metabolism in various sulfolobus strains. Front Microbiol. 2016;7:1902.
Urbieta MS, Rascovan N, Vázquez MP, Donati E. Genome analysis of the thermoacidophilic archaeon Acidianus copahuensis focusing on the metabolisms associated to biomining activities. BMC Genomics. 2017;18:1–14.
Berg IA, Kockelkorn D, Buckel W, Fuchs G. A 3-hydroxypropionate/4-hydroxybutyrate autotrophic carbon dioxide assimilation pathway in Archaea. Science. 2007;318:1782–7.
Makarova KS, Krupovic M, Koonin EV. Evolution of replicative DNA polymerases in archaea and their contributions to the eukaryotic replication machinery. Front Microbiol. 2014;5:1–10.
Choi JY, Eoff RL, Pence MG, Wang J, Martin MV, Kim EJ, et al. Roles of the four DNA polymerases of the crenarchaeon Sulfolobus solfataricus and accessory proteins in DNA replication. J Biol Chem. 2011;286:31180–93.
Acknowledgements
Not applicable.
Funding
Not applicable.
Author information
Authors and Affiliations
Contributions
HDS and NK conceived and designed this project, also wrote the manuscript. HDS conducted wet-lab work, electron microscopy, and bioinformatics analysis. Both authors read and approved the final manuscript.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Additional file
Additional file 1: Table S1.
Classification and general features of Sulfodiicoccus acidiphilus strain HS-1T. Table S2. Project information. Table S3. Genome statistics. Table S4. Number of genes associated with general COG functional categories. Table S5. Number of cdc6 and whiP genes in the order Sulfolobales. Figure S1. The maximum likelihood phylogenetic tree of the order Sulfolobales based on the 16S rRNA gene. Figure S2. Scanning electron micrographs of Sulfodiicoccus acidiphilus HS-1T. Figure S3. A circular map of the S. acidiphilus strain HS-1T genome.
Rights and permissions
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
About this article
Cite this article
Sakai, H.D., Kurosawa, N. Complete genome sequence of the Sulfodiicoccus acidiphilus strain HS-1T, the first crenarchaeon that lacks polB3, isolated from an acidic hot spring in Ohwaku-dani, Hakone, Japan. BMC Res Notes 12, 444 (2019). https://doi.org/10.1186/s13104-019-4488-5
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s13104-019-4488-5