Background

Despite several interventions to prevent, control, and eliminate malaria, 219 million cases and 435,000 deaths occurred worldwide in 2018, mainly in children under 5 years and pregnant women in Africa [1]. Plasmodium falciparum remains the most dominant species in Africa and responsible for the most severe clinical forms; it is associated with 95% of malaria-associated deaths [2, 3]. Many factors contribute to the severity of P. falciparum infections, such as the level of acquired immunity of the individual and genetic characteristics of the parasite [4].

The genetic diversity of P. falciparum remains an obstacle to achieve malaria elimination. Previous vaccine trials have shown limited efficacy of interventions in time and different geographic regions due to genetic polymorphisms [5, 6]. The genes coding for merozoite surface protein-1 (MSP1) and merozoite surface protein-2 (MSP2) have been widely used as genetic markers to determine allelic polymorphisms of P. falciparum [7,8,9]. The genome of P. falciparum is characterized by substitutions of single nucleotides occurring at specific positions in the genome, referred to as single nucleotide polymorphisms (SNPs). Approximately 112,000 SNPs have been described in the genome of P. falciparum and are considered useful molecular markers for barcoding to identify and characterize genetic diversity of P. falciparum [10,11,12].

In the Comoros archipelago, which is composed of four islands in the Indian Ocean between Madagascar and the African coast, malaria remains a major public health problem with high transmission and mortality rate among children under five years old [2]. Since 2004, Comoros has dramatically increased deployment of intervention strategies, including insecticide-treated bed nets, the treatment of patients with artemisinin-based combination therapy and the introduction of intermittent preventive treatment (IPT) in pregnant women. These strategies have resulted in a significant decrease in malaria infection, from 54,078 cases in 2004 to 1,072 in 2015 [13]. However, extensive interventions against malaria might as well result in changes in the population structure of Plasmodium species. First, because high genetic diversity has been associated with high levels of malaria transmission [14], a measure of genetic diversity can provide an indirect assessment of the effectiveness of an intervention [15]. Second, a high genetic structure of parasite populations, observable when gene flows between populations remain limited, allows for localized interventions. Conversely, the absence of population structure imposes the need for larger-scale strategies to be effective in the long term. Consequently, an estimation of genetic diversity in local P. falciparum isolates can provide important information on how to improve strategies to reach malaria elimination.

A 2010 study revealed a significant diversity of P. falciparum strains in the Union of Comoros where the mean expected heterozygosity (He) was 0.63 in Grande Comore and the multiplicity of infection (MOI) was 1.39 from microsatellite data [16]. Since this study, only one study has been conducted to investigate genetic diversity of the parasite in Comoros [17]. The results of this latter study showed a decrease in genetic diversity and in MOI based on msp genes correlated with a decrease in malaria transmission in Grande Comore.

As a follow-up of that study, the aim of the present study was to characterize P. falciparum populations in other sites in Grande Comore using msp1, msp2 and SNPs to determine the genetic diversity and MOI.

Methods

Study site

A total of 162 rapid diagnostic tests (RDTs) were collected in 2012 and 2013 in three sites of Grande Comore (Moroni n = 26, Mitsamiouli n = 59, and Mbeni n = 77). Malaria transmission varies in these three sites: hypoendemic in Moroni, mesoendemic in Mitsamiouli, and hyperendemic in Mbeni [16] (Fig. 1). The following RDTs were used in Grande Comore at the time of the present study: CareStart™ Malaria HRP2/pLDH Combo RDT (Access Bio, Inc., Somerset, NJ) and Standard Diagnostics Bioline Malaria Ag Pf/Pan test (SD Bioline/Abbott, Yongin-si, Gyeonggi-do, Republic of Korea). RDTs that were positive for P. falciparum were collected from health centres. RDTs that were negative or invalid were excluded from this study. All RDTs were stored at room temperature until they were used for DNA extraction.

Fig. 1
figure 1

Map of Grande Comore Island showing the study sites

Full size image

DNA extraction

Parasite DNA stored on the nitrocellulose membrane of RDTs was extracted according to the protocol developed by Cnops et al. [18]. DNA extraction was performed using QIAmp DNA or Blood Mini kit (Qiagen, Germantown, MD) following the manufacturer’s instructions.

Genotyping of msp1 and msp2

Msp1 and msp2 genes were amplified by nested PCR as described in earlier studies [19, 20]. All PCR amplifications were carried out in a total volume of 20 μl containing 6 μl Gotaq® DNA polymerase-reaction buffer (Promega Corporation; Madison, WI), 0.5 μM of each primer, and 11 μl reagent grade water. The cycling conditions for the primary PCR were as follows: initial denaturation at 95 °C for 5 min, followed by 35 cycles of 94 °C for 1 min, 58 °C for 2 min, 72 °C for 2 min, with a final extension cycle of 72 °C for 3 min. The cycling conditions for the nested PCR were as follows: initial denaturation at 95 °C for 5 min, followed by 35 cycles of 94 °C for 1 min, 61 °C for 2 min, 72 °C for 2 min, with a final extension cycle of 72 °C for 3 min. Positive controls and negative control were run in each PCR. PCR products were analysed by gel electrophoresis on 2% agarose gels and visualized under ultraviolet trans-illumination (Biorad Gel Doc™ XR + System with Image Lab). A 100 bp DNA ladder (Quick-Load) was used to determine the size of PCR products.

The expected sizes of PCR products for the msp1 gene were between 150–300 bp, 130–230 bp, and 150–200 bp for K1, MAD, and RO33, respectively. For the msp2 gene, the expected sizes were between 290–450 bp for FC27 and between 450–700 bp for IC3D7.

Genotyping of SNPs

Twenty-four SNPs of P. falciparum were genotyped by using high-resolution melting (HRM), as previously described [21]. PCR amplifications were performed using 2.5 × Light Scanner master mix (Biofire Diagnostics, Inc., Salt Lake City, UT), with forward primers at a final concentration of 0.05 μM, reverse primers at a final concentration of 0.2 μM, and allele-specific probes at a final concentration of 0.2 μM, and 1 μl of genomic DNA. SNPs were identified with a high minor allele frequency. The cycling and melting conditions for SNPs were as follows: 95 °C denaturation for 2 min followed by 55 cycles of 95 °C for 5 s and 56 °C for 30 s, then a pre-fusion cycle of 5 s each at 95 °C and 37 °C, followed by a melt from 35 °C to 90 °C at 0.30 °C/s.

Statistical analysis

Genetic diversity of msp1 and msp2 genes of the 3 populations (Moroni, Mitsamiouli, and Mbeni) was determined by the number of alleles per locus and by Nei [22] unbiased expected heterozygosity index (He) using GENETIX software version 4.05 [23].

$$He=\left(\frac{2n-1}{2n}\right)\left(1-\sum_{i}{x}_{i}^{2}\right)$$

where n is the sample size and \({x}_{i}\) is the frequency of i allele.

Genetic diversity index based on SNPs, equivalent to the expected heterozygosity index (He), was estimated by \(\pi\) diversity index [24], implemented with MEGA X version 10.1 [25]. Phylogenetic tree, based on SNPs data, was constructed using MEGA X unweighted pair group method with arithmetic mean (UPGMA) algorithm [26].

Fisher’s exact test was used to compare the allelic frequencies of msp1 and msp2 genes in three regions of the Grande Comore and He. The MOI is the mean number of fragments detected for each msp gene and each allelic family. A sample with one clone for the msp genes was considered monoclonal, while a sample with at least 2 clones was considered polyclonal. Mann–Whitney U test was used to compare mean MOI. The significance threshold was fixed at α = 0.05.

Results

Genotyping of msp1 and msp2

Of 162 samples, 151 were successfully genotyped: 25 from Moroni, 49 from Mitsamiouli, and 77 from Mbeni. Among them, 21 individual alleles were found, including 12 alleles for msp1 gene and 9 alleles for msp2 gene.

For msp1, 7 K1 type alleles (150–300 bp), 3 MAD20 type alleles (190–230 bp), and 2 RO33 type alleles (150 and 200 bp) were observed (Fig. 2). The most frequent K1, RO33, and MAD20 type alleles were 200 bp (60/132), 150 bp (17/18), and 200 bp (34/64) fragments, respectively. For msp2, 3 FC27 type alleles (350–450 bp) and 6 IC3D7 type alleles (450–700 bp) were obtained. For FC27, the most frequent type allele was 400 bp fragment, and the most frequent type allele for IC3D7 was 500 bp fragment (Fig. 3).

Fig. 2
figure 2

The numbers of occurrence of alleles for each msp1 allelic family K1 (blue), MAD20 (red), and RO33 (black) are shown in the figure. The total numbers of K1, MAD20, and RO33 alleles are 134, 64 and 18, respectively

Full size image
Fig. 3
figure 3

The numbers of occurrence of alleles for each msp2 allelic family FC27 (red) and IC3D7 (gray) are shown in the figure. The total numbers of FC27 and IC3D7 alleles are 84 and 73, respectively

Full size image

In all three sites, the K1 family was predominant (55%) for msp1 gene (Table 1). It was more frequent in Mbeni (71.1%) compared to Moroni (50%; p = 0.059) and Mitsamiouli (30.6%; p < 0.01) (Fig. 4). There was no significant difference of K1 frequency between Moroni and Mitsamiouli (p > 0.05). However, MAD20 msp1 allelic family was more frequently observed in Mitsamiouli (22.4%) than in Moroni (19.2%; p = 1) or Mbeni (9.6%; p = 0.29). RO33 msp1 allelic family was poorly represented (2.4–4.0%) in all three sites.

Table 1 Genetic diversity of P. falciparum msp genes in Grande Comore
Full size table
Fig. 4
figure 4

Allelic frequencies of msp1 and msp2 genes in 3 sites of Grande Comore

Full size image

For msp2 gene, IC3D7 allelic family was predominant in Moroni (65%). Its frequency was lower in both Mitsamiouli (39%; p = 0.80) and Mbeni (31.6%; p = 0.36). The FC27 family was found to be predominant in Mbeni (60.5%), in comparison to Moroni (20%; p < 0.01) and Mitsamiouli (36%; p = 0.019).

In Moroni, a total of 10 (40%) samples showed polyclonal infection with at least two clones, resulting in mean MOI of 1.40 (Table 2). In Mitsamiouli, 26 (53%) samples showed polyclonal infections with at least two clones (MOI = 1.57) and in Mbeni 26 (33.8%) samples were polyclonal (MOI = 1.35). There was no significant difference in MOI between Moroni and Mitsamiouli (p = 0.30). In Mbeni, 26 (33.8%) samples were polyclonal, and mean MOI was 1.35. The difference in MOI was not statistically significant between Mbeni and Mitsamiouli (p = 0.06) and between Moroni and Mbeni (p = 0.67).

Table 2 Multiplicity of infection (MOI) based on msp1 and msp2 genes in P. falciparum isolates from Moroni, Mitsamiouli, and Mbeni
Full size table

Genotyping of SNPs

In this study, 50 of 151 (33%) samples were genotyped for 24 SNP markers. Among these, 42 samples (1 from Moroni, 17 from Mitsamiouli, and 24 from Mbeni) and 21 SNPs yielded interpretable results (Additional file 1: Table S1). These 42 samples were used for analysis by SNPs. Considering the similar level of genetic diversity included in this sub-sample (He = 0.82) and in all 151 samples (He = 0.83) based on msp genes, the representativeness of our sub-sample was confirmed.

Overall, 36 of 42 (85.7%) different genotypes were obtained from 42 samples. Six of 42 (14.3%) isolates grouped into two clusters, defined as a group of parasites with identical SNP barcode: one cluster consisting of 2/42 (4.8%) parasite populations from Mitsamiouli (defined by the barcode TACCXCGACXTAATAAGAXGG; “X” denotes an absence of amplification) and another cluster consisting of 4/42 (9.5%) samples from Mbeni (defined by the barcode TATTCCGTTGCCACTCGATTG). Moreover, among 36 genetically unique isolates, several had a strong linkage since they only differed from each other by a few nucleotides (Additional file 2: Figure S1).

To investigate whether there is an association between barcode and msp1 and/or msp2 (clonality), SNPs (clusters and unique barcodes) were classified as monoclonal or polyclonal. Analysis showed that all clusters were polyclonal. Among the parasites with unique barcodes, 7 of 36 (19.4%) were monoclonal, and 29 of 36 (80.6%) were polyclonal.

Allelic frequency

Data on allelic frequency showed that several nucleotides predominated at the study sites. At P2 position, adenine (A) number predominated at all sites. At P5 position, cytosine (C) number predominated. At positions P21 and P24, adenine (A) and guanine (G) numbers were seen in the majority of isolates collected in Mitsamiouli and Moroni, respectively. The lowest minority allelic frequency (MAF) was found in position 20 in 5 of 42 (11.9%) isolates calculated from guanine number (Additional file 1: Table S1).

Genetic diversity

Genetic diversity (He) was estimated from msp and SNPs. For msp genes, the highest mean diversity was observed in Moroni and Mitsamiouli (He = 0.84 in both sites) (Table 3). There was no significant difference between Moroni and Mbeni (p = 0.48). The mean genetic diversity for all sites was 0.83 (Table 3). For SNPs, He was determined at Mitsamiouli and Mbeni. The highest genetic diversity was found at Mitsamiouli (He = 1) and the lowest at Mbeni (He = 0.41).

Table 3 Genetic diversity of P. falciparum at 3 sites in Grande Comore
Full size table

In addition, He values based on msp and SNP were compared in both sites using Fisher's exact test. The He index based on msp gene was higher than the index based on SNP in Mbeni (p < 0.01), but an opposite but insignificant trend was observed in Mitsamouili (p = 0.08). Comparison in the whole populations did not show any difference (p = 0.9) (Table 4).

Table 4 Comparison of genetic diversity using msp and SNPs
Full size table

Discussion

The Union of Comoros has entered the phase of malaria elimination after the implementation of several strategies, such as the massive use of insecticide-impregnated bed nets (ITNs), artemisinin-based combination therapy (ACT) for confirmed malaria cases, intermittent preventive treatment in pregnant women (IPTp), and mass drug administration (MDA) with artesunate-mefloquine and primaquine. However, the impact of this intervention on genetic diversity in P. falciparum has so far received limited attention and needs to be further investigated. In Grande Comore, genotyping of msp1 and msp2 genes revealed a high allelic polymorphism (He = 0.83), comparable to areas of high malaria transmission in Africa [27,28,29]. For 12 alleles in the msp1 gene, the K1 family was dominant (55%). For 9 alleles in the msp2 gene, the FC27 family was most represented (47.4%). These results are similar to those obtained in Madagascar [30] and in Grande Comore in isolates collected in 2013–2016 [17]. Interestingly, the results of the present study differ from those observed in Grande Comore in isolates collected in 2006–2007, in which RO33 family was predominant [17].

Fragment analysis of msp1 and msp2 allelic families using agarose gel electrophoresis used in the present study has limitations due to difficulties in defining specific alleles with accuracy for each isolate. To circumvent this drawback, 24 SNPs were used to determine the genetic diversity of P. falciparum in Grande Comore for the first time. These 24 SNPs are able to identify different parasites with a high minor allelic frequency [21]. After SNP genotyping, it was found that 85% of isolates are genetically unique. These results suggest that there is a high level of genetic diversity of P. falciparum on the island (He = 0.61). The results of SNP genotyping confirm those of msp1 and msp2 markers (He = 0.82, p = 0.9).

The comparison of results from the studies concerning msp and barcode showed that all clusters were polyclonal. Similarly, among isolates with unique barcodes, the majority (78.9%) were polyclonal as well although data obtained in the present study suggested that the barcode of 21 SNPs cannot predict mixed infections. MOI based on msp remains the most powerful tool for determining the number of distinct P. falciparum populations in an infection. The average MOI found in this study for all sites was 1.36 for msp1 and 1.05 for msp2. These results are similar to those obtained in Grande Comore in isolates collected in 2013–2016, suggesting a decreasing malaria transmission intensity on this island [17]. Moreover, the present study confirmed the decrease in genetic diversity observed by Huang et al. (He = 0.95 before intervention; He = 0.84 after intervention against malaria) [17]. However, comparison of the results of this study with those of Rebaudet et al. (He = 0.63 calculated from microsatellite markers) [16] showed discordance in the level of genetic diversity of P. falciparum. This may be due to the choice of msp markers used, which are biased due to immune pressure.

Moreover, the considerable level of genetic diversity was found in this study despite trends in decreased malaria transmission in Comoros. Indeed, it has been established that a high genetic diversity of P. falciparum is more frequent in areas of high transmission [14]. This observation may provide an explanation for malaria persistence in Grand Comore compared to neighboring islands, despite application of strategies to eliminate malaria, such as MDA. This hypothesis is supported by the fact that Grande Comore alone, compared to three other islands in the Union of Comoros, accounted for 99.4% of malaria cases in 2014 [31]. Indeed, in Grande Comore, there are a large number of water cisterns and ablution basins which serve as mosquito breeding sites [2]. Therefore, local vector control interventions, including larval control, may be needed to improve malaria control.

Conclusion

Clinical isolates of P. falciparum showed high genetic diversity in Grande Comore. This might be one of the reasons for the high malaria transmission in this island, in comparison to neighbouring islands, despite the implementation of several malaria elimination strategies. Further studies on genetic diversity are essential to determine the impact of past interventions. Additionally, they may contribute to the adoption of future strategies for the achievement of malaria elimination in the Union of the Comoros.