Background

Liver fibrosis is a dynamic wound-healing response to the continuous action of various injury factors, including non-alcoholic steatohepatitis, alcohol abuse, biliary obstruction, hepatitis B and C, and several other etiologies [1, 2]. It is characterized by excessive accumulation of extracellular matrix components and can eventually lead to cirrhosis and even hepatocellular carcinoma (HCC) [2, 3]. Thus, it is clear that there is an urgent need to develop novel diagnostic and therapeutic strategies for early stage of liver fibrosis.

LSEC are highly specialized endothelial cells located between blood cells and hepatocyte, facilitating the steric transport of cargo from the sinusoidal space to the space of Disse and into the parenchyma [4, 5]. Under physiological conditions, the vital characterizations of LSEC are fenestrated, absence of diaphragm, and lack of basement membrane. Meanwhile, it can serve to maintain HSC quiescence [6] and have the potential to promote HC regeneration [7]. Under fibrotic conditions, LSEC lose fenestrations and form a continuous basement membrane. This phenomenon is called “capillarization,” which precedes the activation of HSC and the onset of liver fibrosis, suggesting that it could be a preliminary step necessary for fibrogenesis [8]. Therefore, targeting LSEC might be a therapeutic approach to reverse liver fibrosis. Noteworthy, the fenestrated LSECs is maintained by two pathways: the eNOS-sGC pathway and NO-independent pathway [8]. It has been reported that the eNOS activity is impaired in LSEC of fibrotic liver, while sGC activator can rescue the eNOS activity and restore LSEC fenestration [9]. Additionally, KLF2, a transcriptional factor, upregulates eNOS expression and is essential to maintain functional endothelial phenotype [10, 11]. Furthermore, increasing KLF2 in cirrhotic animals improves LSEC phenotype, ameliorates the dysfunctional endothelium, reduces oxidative stress, and deactivates HSC, thereby turning into regression of cirrhosis [11]. Hence, further understanding of the cellular and molecular mechanism of LSEC may contribute to the development of more effective treatments.

LncRNAs are transcripts longer than 200 nucleotides but without protein coding potential [12]. Thus far, accumulating evidences demonstrated that lncRNAs participate in diverse physiological and pathological processes and play critical regulatory roles in human diseases [13, 14]. LncRNA Airn (Antisense Igf2r RNA) is an imprinted and paternal expressed gene, which is nuclear localized and highly unstable in the form of non-splicing 108 kb ncRNA, whereas the spliced Airn isoforms are as stable as other RNAs and are exported into the cytoplasm [15]. Furthermore, Hosen et al. demonstrated that Airn silencing reduced translation of IGF2BP2 protein and caused less binding of IGF2BP2 to target genes involved in cell survival, thereby augmenting cell death and reducing cell migration in cardiomyocytic HL-1 cells [16]. However, the role and the underlying mechanism of Airn in the development of liver fibrosis remain largely unclear.

In the present study, we aimed to elucidate the role of Airn in liver fibrosis. The results showed that Airn was significantly upregulated in liver tissues and LSEC of CCl4-induced liver fibrosis mouse model. Moreover, the expression of AIRN in livers and serums of live fibrosis patients was remarkably increased compared with healthy controls. In vivo studies revealed that Airn over-expression alleviated liver fibrosis. Additionally, it demonstrated that Airn maintained LSEC differentiation in vivo and in vitro through the KLF2-eNOS-sGC pathway, thereby suppressing HSC activation and promoting HC proliferation. Altogether, our results indicated that Airn was a critical and novel regulator of LSEC in liver fibrosis.

Methods

Study population

Study population analysis was performed as described in the previous study [17]. Briefly, 28 human fibrotic livers and 6 human healthy livers from patients with hepatic hemangioma were obtained from surgical resections without preoperative treatment at Tianjin Third Central Hospital (Tianjin, China). Hepatic fibrosis was scored (stages F0–F4) according to the METAVIR fibrosis staging system by three hepatopathologists blinded to the study protocol and stratified as normal liver (F0), mild fibrosis (F1–F2), and advanced fibrosis (F3–F4). In addition, we collected 47 serum samples from patients diagnosed as cirrhosis at Tianjin Third Central Hospital (Tianjin, China), and 30 matched blood donor volunteers recruited from the same hospital with no medical history. All subjects were of the same ethnicity. Clinical and pathological characteristics including age, gender, ALT, AST, ALB, GTT, and etiologies were recorded and summarized in Additional file 1: Table S1. The study has been approved by the local Ethical Committee of Tianjin Third Central Hospital (Tianjin, China). Written informed consent was obtained from each patient according to the policies of the committee. The study methodologies were conformed to the standards set by the Declaration of Helsinki.

Animal in vivo study

All the animal protocols were in accordance with the Guidelines for Animal Experiments of Tianjin Medical University Animal Care and Use Committee. Airn knockout (Airn-KO) C57BL/6N mice were generated by CRISPR/Cas9 system (Cyagen, Suzhou China). In brief, genomic DNA was extracted from the Airn-KO mice and was PCR amplified using the primers (F: 5′-AGACACATTTAGTTGGTGGTTGGTCG-3′, R: 5′-TCTTCCACACCCAGGTGGCTTT-3′, R: 5′-AGGAAGTAGGCTCATGGGAGGAG-3′). The product of 800 bp was used for the amplicon and the sequence was confirmed by Sanger sequencing. All wild type (WT) and Airn-KO mice were generated from Airn heterozygous mice, they were kept in a standard 12-h light–dark cycle under the specific pathogen-free conditions with free access to water and food. All liver fibrosis models were performed in male mice unless indicated. For CCl4-induced liver fibrosis model, twenty WT mice and twenty Airn-KO mice were randomly divided into four groups: WT mice intraperitoneally injected oil (WT, n = 10), WT mice intraperitoneally injected CCl4 (WT + CCl4, n = 10), Airn-KO mice intraperitoneally injected oil (Airn-KO, n = 10), and Airn-KO mice intraperitoneally injected CCl4 (Airn-KO + CCl4, n = 10). They were administered 5% CCl4 (v/v) (Sigma-Aldrich, St. Louis, MO, USA) dissolved in oil (0.3 ml/kg body weight) thrice per week for 6 weeks via intraperitoneal injection. For BDL-induced liver fibrosis model, forty WT mice and forty Airn-KO mice were randomly divided into four groups. WT mice were treated with sham operation (WT, n = 20), WT mice were treated with BDL (WT + BDL, n = 20), Airn-KO mice were treated with sham operation (Airn-KO, n = 20) and Airn-KO mice were treated with BDL (Airn-KO + BDL, n = 20). Eighteen days later, all mice were sacrificed under anesthesia with 3% sodium pentobarbital (45 mg/kg, ip). For over-expressed Airn model, adeno-associated virus (AAV8) vectors were used to over-express Airn in mice, and AAV8-GFP was used as a control. Thus, forty Balb/c mice were divided into four groups randomly: Mice were treated with oil in combination with injection of AAV8-GFP (AAV8-GFP, n = 10), CCl4 in combination with injection of AAV8-GFP (AAV8-GFP + CCl4, n = 10), oil in combination with injection of AAV8-Airn (AAV8-Airn, n = 10), and CCl4 in combination with injection of AAV8-Airn (AAV8-Airn + CCl4, n = 10). Mice in AAV8-GFP + CCl4 group and AAV8-Airn + CCl4 group were injected with AAV8-GFP and AAV8-Airn respectively via the tail vein 2 weeks after the first injection of CCl4, and administered 5% CCl4 (v/v) dissolved in oil (0.2 ml/kg body weight) thrice per week via intraperitoneal injection. AAV8-GFP and AAV8-Airn group animals were injected with an equivalent volume of oil. After treatment with CCl4 for 8 weeks, all mice were sacrificed under anesthesia with 3% sodium pentobarbital (45 mg/kg, ip).

Histology and immunohistochemistry

The immunohistochemistry was performed essentially as described previously [18]. The slides were treated with primary antibody α-SMA (1:200, rabbit polyclonal, Abcam, ab5694), COL1α1 (1:200, rabbit polyclonal, Abcam, ab34710), CD31 (1:25, mouse monoclonal, ab9498), LAMININ (1:200, rabbit polyclonal, Abcam, ab11575), and PCNA (1:800, rabbit monoclonal, Cell Signaling Technology, #13110), overnight at 4 °C. The slides were incubated with secondary antibody (1:500) (HRP-conjugated anti-rabbit IgG), and the reaction products were visualized using diaminobenzidine (DAB) and monitored by microscopy.

Scanning electron microscopy

Briefly, livers were fixed with glutaraldehyde, postfixed with OsO4, dehydrated with graded alcohols, dried with hexamethyldisilazane, sputter-coated with gold, and examined using a Gemini 300 scanning electron microscope (Zeiss, Germany). Porosity (percentage of LSEC surface occupied by fenestrae) was measured in scanning electron microscopy (SEM) micrographs of cells.

Isolation and culture of primary HCs, HSCs, KCs, and LSECs

Primary mouse HSC and HC were isolated by pronase/collagenase perfusion digestion followed by density gradient centrifugation, as previously described [17]. In brief, primary LSEC were isolated from the 8-week-old Balb/c mice by in situ perfusion with 30 ml SC1 solution and 30 ml 0.05% Collagenase IV solution sequentially. The cell suspension was centrifuged at 50g for 4 min and then the supernatant was centrifuged at 500g for 8 min at 4 °C. Pelleted cells were resuspended in 10 ml of 18% Nycodenz solution (Sigma-Aldrich, St. Louis, MO, USA); 6 ml of 12% Nycodenz solution, 6 ml of 8% Nycodenz, and 4 ml of DMEM were orderly loaded on the top of the cell suspension. The added gradient centrifugal liquid was centrifuged at 1450g and 4 °C for 22 min without brake. LSECs were recovered from the interface between the 8 and 12% Nycodenz solutions, mixed with an equal volume of DMEM and centrifuged at 600g for 6 min at 4 °C. Cells were resuspended and incubated with anti-CD146 magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany). Finally, LSEC were cultured in collagen IV-coated plates with LSEC medium, and cell viability was determined by the trypan blue exclusion method.

RNA pull-down

Airn was transcribed in vitro with T7 RNA polymerase (Thermo Scientific #K0441, MA, USA), and it was further treated with RNase-free DNase I to remove excess DNA. Next, the RNA was purified, biotin labeled (Thermo Scientific 20163, MA, USA), and attached with streptavidin agarose bead (Thermo Scientific 20164, MA, USA). Whole-cell lysates from freshly liver cell suspension were added to the labeled RNA according to the manuscript. The recruited proteins were subjected to western blot analysis.

Chromatin immunoprecipitation (ChIP)

ChIP assays were performed essentially as described previously [18, 19]. Anti-EZH2 (rabbit polyclonal, Abcam, ab186006) and IgG were used to immunoprecipitated chromatin fragments. Finally, qRT-PCR assays were performed to analyze the precipitated chromatin DNA. The immunoprecipitated DNA was quantitated by qRT-PCR. The ChIP primer sequences were as follows: Klf2-pro 1(-272--120) (Forward) 5′-GCGCGCTAACTATGCTGTTG-3′ and Klf2- pro 1 (Reverse) 5′-CGGTATATAAGCCTGGCGGT-3′, Klf2-pro2 (-916--804) (Forward) 5′- GCTCCTTGGATGAGGC-TT-GT-3′ and Klf2-pro2 (Reverse) 5′-AGCATTAGGTTCAAGGCCCC-3′, Klf2- pro3 (-1299--1155) (Forward) 5′-TGTTTGCCTCCGGGGTTAAG-3′ and Klf2- pro3 (Reverse) 5′-GGGGGATGGGCACATCAAAT-3′, Gapdh intron (Forward) 5′-ATCCTGTAGGCCAGGTGATG-3′ and (Reverse) 5′-AGGCTCAAGGGCTTTTAAGG-3′. The data of ChIP was shown as a percentage relative to input DNA.

Plasmid constructs

The cDNA of full-length Airn was sequentially amplified by PCR and ligated into the lentiviral shuttle pCCL.PPT.hPGK.IRES.eGFP/pre [18] to generate the over-expression plasmid (LV-Airn and the empty plasmid as the LV-Control). The cloning primer sequences were as follows: LV-Airn BamHI Forward 5′- CGCGGATCCAATAATCTCCACCCCCTG-3′, LV-Airn BamHI Reverse 5′- CGCGGATCCTTAAGACCCTGTTGAAATTT-3′. These plasmids were used to produce lentivirus in HEK-293T cells with the packaging plasmids. Infectious lentiviruses were harvested at 36 and 60 h after transfection and filtered through 0.45 μm PVDF filters for in vitro experiments. AAV8 vectors for capsid screening were produced by transfecting AAV-293 cells using polyethylenimine (PEI) with an AAV vector plasmid (pAAV.CMV.PI.EGFP.WPRE.Bg-h, addgene, #105530) and helper plasmid including pAAV2/8 (addgene, #112864) and pAdDeltaF6 (addgene, #112867). For in vivo experiments, AAV vectors were produced in large scale and purified through iodixanol gradient density centrifugation, and full AAV particles were collected from the 40–60% interface of iodixanol phase for in vivo experiments. Male mice at 6–8-week-old were injected by tail vein with 1×1012 pfu/mouse genome copies of AAV8-GFP or AAV8-Airn. The cloning primer sequences were as follows: AAV8-Airn HindIII Forward 5′- CCCAAGCTTAATAATCTCCACCCCCTG-3′, AAV8-Airn BamHI Reverse 5′- CGCGGATCCTTAAGACCCTGTTGAAATTT-3′.

Cell culture

The non-tumorigenic mouse hepatocyte cell line AML12 was cultured in DMEM with 10% fetal bovine serum (FBS, Gibco, Gaithersburg, MD, USA), 1 × insulin-transferrin-sodium selenite media supplement (ITS, Sigma-Aldrich), 40 ng/ml dexamethasone, 100 U/ml penicillin, and 100 μg/ml streptomycin. The cell line HEK293T or AAV293 were maintained in DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin, both cells were cultured in humidified air at 37 °C and 5% CO2.

Small interfering RNA (siRNA) transfection

Primary LSECs (1×106/well) were seeded in collagen-coated 6-well plates and transfected with siAirns and siRNA-Control for 48 h; RNA and protein of cells were harvested and isolated. siAirns and siRNA-Control were gained from GenePharma, and the sequences are as follows: siAirn-1 (mouse), sense 5′-CCAGUUACCACGCAGACAUTT-3′ and antisense 5′-AUGUCUGCGUGGUAACUGGTT-3′, siAirn-2 (mouse), sense 5′- CCGUCACCAUGUGUCCUUUTT-3′ and antisense 5′- AAAGGACACAUGGUGACGGTT-3′, siAirn-3 (mouse), GCAGCUCUCAUCUGUGUUATT-3′ sense 5′- and antisense 5′- UAACACAGAUGAGAGCUGCTT-3′, NC (mouse), sense 5′-UUCUCCGAACGUGUCACGUTT-3′, and anti-sense 5′-ACGUGACACGUUCGGAGAATT-3′.

Nuclear-cytoplasmic fractionation

Cytoplasmic and nuclear RNA and protein isolation were performed with PARIS™ Kit (Invitrogen, Grand Island, NY, USA), following the manufacturer’s instruction and were performed essentially, as described previously [18].

RNA-seq and computational analysis

Briefly, primary LSECs infected with two separated siAirn were lysed with Trizol reagent. Total RNA was qualified and quantified using a Nano Drop and Agilent 2100 bioanalyzer (Thermo Fisher Scientific, MA, USA). The library was amplified with phi29 to make DNA nanoball (DNB) which had more than 300 copies of one molecule, DNBs were loaded into the patterned nanoarray, and single-end 50 bases reads were generated on BGIseq500 platform (BGI-Shenzhen, China). The threshold we used to screen up- or downregulated mRNAs was fold change >1.4 and p<0.05. The transcriptome sequencing data have been deposited in NCBI Gene Expression Omnibus (GEO) under the following accession number: GSE174175.

Fluorescence in situ hybridization (FISH)

Airn probes were synthesized by GenePharma Technology (Shanghai, China). FISH was performed using a FISH Kit (GenePharma) according to the manufacturer’s instructions. Nuclei were stained with DAPI. Images were acquired on a Zeiss confocal microscope LSM700. The sequences of FISH probe were as follows: probe1: 5′- TATAATGTTGAAGCCTCGGC-3′, probe 2: 5′-CAGGATGTCTGCGTGGTAAC-3′, probe 3: 5′-ATTTCTAAGGTGGTTTCCGA -3′, probe 4: 5′-TCTGTAGTTTTCTAATGGCC-3′, probe 5: 5′-CTGGGGAAAGAAGTGTGTCT-3′, probe 6: 5′-TTTTTTTAAGACCCTGTTGA-3′.

Western blot analysis

Cells were lysed with cell lysis buffer (Cell Signaling Technology) supplemented with protease inhibitor cocktail, 1% PMSF, and 1% phosphatase inhibitor. Protein concentrations were measured by the BCATM Protein Assay Kit (Bio-Rad Laboratories, Hercules, CA, USA) using BSA as standard. Appropriate amount of protein samples (40 μg for liver tissues; 25–50 μg for cells) along with 4× loading buffer and ddH2O were boiled for 4 min and then subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis. Following by electrophoresis, the separated proteins were blotted onto polyvinylidene fluoride (PVDF) membranes in transfer buffer with constant current of 300 mA for 3 h at 4 °C. Then the PVDF membranes were sequentially washed with TBST containing 0.2% Tween-20, blocked with 5% nonfat milk in TBST and incubated with the interested primary antibodies diluted in TBST containing 0.2% Tween-20 overnight at 4 °C. Antibodies used for immunoblotting included VEGFR2 (1:1000, rabbit monoclonal, Cell Signaling Technology, #9698), eNOS (1:1000, mouse monoclonal, Abcam, ab76198), VE-Cadherin (1:1000, rabbit polyclonal, Abcam, ab33168), PCNA (1:1000, rabbit monoclonal, Cell Signaling Technology, #13110), α-SMA (1:1000, rabbit polyclonal, Abcam, ab5694), COL1α1 (1:1000, rabbit polyclonal, Abcam, ab34710), MMP2 (1:1000, rabbit monoclonal, Abcam, ab92536), TIMP1 (1:1000, mouse monoclonal, Santa Cruz, sc-21734), KLF2 (1:1000, mouse polyclonal, Santa Cruz, sc-166238). GAPDH were severed as control for total protein amount. Then, all of membranes were incubated with the HRP-conjugated secondary antibody for 1 h at room temperature. Every experiment was repeated at least three times independently.

Confocal microscopy

Immunofluorescence analysis was performed as described previously [20]. Antibodies used for confocal microscopy included VEGFR2 (1:200, rabbit monoclonal, Cell Signaling Technology, #9698), VE-Cadherin (1:200, rabbit polyclonal, Abcam, ab33168), F4/80 (1:50, rabbit monoclonal, Abcam, ab16911), α-SMA (1:200, rabbit polyclonal, Abcam, ab5694), COL1α1 (1:200, rabbit polyclonal, Abcam, ab34710), Ki67 (1:200, rabbit monoclonal, Abcam, ab16667), PCNA (1:800, rabbit monoclonal, Cell Signaling Technology, #13110), and KLF2 (1:50, mouse polyclonal, Santa Cruz, sc-166238). Cells were incubated with FITC-conjugated secondary antibodies (Thermo Fisher Scientific, HRP-conjugated anti-rabbit IgG or anti-mouse IgG, Alexa Fluor 594) in a dark environment at room temperature for 1 h. Next, cells away from light were stained with DAPI (Sigma, USA) for 20 min. Finally, the slides were mounted with an anti-fade mounting medium and were observed with a Zeiss confocal microscope LSM700.

Quantitative real-time polymerase chain reaction

qRT-PCR analysis was performed as described previously [17]. The sequences of primers are listed as follows.

Gene symbol

Forward 5′–3′

Reverse 5′–3′

Gapdh (mouse)

GGCATGGACTGTGGTCATGAG

TGCACCACCAACTGCTTAGC

β-Actin (mouse)

ATGCCACAGGATTCCATACCCAA

CTCTAGACTTCGAGCAGGAGATGG

Airn NR_002853.2

AAGCACAGCACCGCCAGT

CCATGTCCTTTCTTTTCCACTACC

Airn NR_027772.1

AAGCACAGCACCGCCAGT

CAAAGGTGCTTGCCTCCAA

Airn NR_027773.1

AAGCACAGCACCGCCAGT

CAGGACCTCAAGTCAGGAACCT

Airn NR_027784.1

AAGCACAGCACCGCCAGT

AGGCCTTTGTTCACATCTCTTCA

eNos (mouse)

GGCAACTTGAAGAGTGTGGG

CTGAGGGTGTCGTAGGTGATG

Vegfr2 (mouse)

TTTGGCAAATACAACCCTTCAG

GCAGAAGATACTGTCACCACC

VE-cadherin (mouse)

CAGCACACTAGCCTGGTGTTA

CGCCCATGATTCTGCATGTAGA

Lyve-1 (mouse)

CAGCACACTAGCCTGGTGTTA

CGCCCATGATTCTGCATGTAGA

Cd31 (mouse)

ACCGGGTGCTGTTCTATAAGG

TCACCTCGTACTCAATCGTGG

Et-1 (mouse)

CACCGTCCTCTTCGTTTTGC

GGCTCTGCACTCCATTCTCA

Laminin (mouse)

GAAAGGAAGACCCGAAGAAAA

CCATAGGGCTAGGACACCAAA

Hgf (mouse)

GCGAATTGGTGTTCTGCCTG

GAGATGCCGGGCTGAAAGAA

Wnt2a (mouse)

CTCGGTGGAATCTGGCTCTG

CACATTGTCACACATCACCCT

Angpt2 (mouse)

AGAAGAGCAAACCACCTTCAG

GTCACAGTAGGCCTTGATCTCC

Col1α1 (mouse)

ATCGGTCATGCTCTCTCCAAACA

ACTGCAACATGGAGACAGGTCAGA

α-SMA (mouse)

TCGGATACTTCAGCGTCAGGA

GTCCCAGACATCAGGGAGTAA

Mmp2 (mouse)

GTGTTCTTCGCAGGGAATGAG

GATGCTTCCAAACTTCACGCT

Pcna (mouse)

TTTGAGGCACGCCTGATCC

GGAGACGTGAGACGAGTCCAT

Ki67 (mouse)

CATCCATCAGCCGGAGTCA

TGTTTCGCAACTTTCGTTTGTG

F4/80 (mouse)

TGACTCACCTTGTGGTCCTAA

CTTCCCAGAATCCAGTCTTT CC

Cd11b (mouse)

TCCTGTACCACTCATTGTGG

GGGCAGCTTCATTCATCATG

GAPDH (human)

ACCCAGAAGACTGTGGATGG

TTCAGCTCAGGGATGACCTT

β-ACTIN (human)

GCCGGGACCTGACTGACTAC

TTCTCCTTAATGTCACGCACGAT

AIRN NR_047514.1

GGAAAAGGGATGCGGTGTTT

CCTTTTCAGGACGTGACCCG

AIRN NR_047511.1

AACTTTTGCCCAGTCGGCTC

CCATGGCAGCTTGGTTTCAG

Cell Counting Kit-8 (CCK-8) assay

Cell Counting Kit-8 (CCK-8) assay CCK-8 assay was carried out for detection of cell proliferation in AML12 cells. AML12 cells were inoculated in 96-well plates with 2×103 cells per well. Absorbance at 450 nm was recorded at specified time points using the CCK-8 kit, based on which the viability curve was plotted.

5-Ethynyl-2’- deoxyuridine (EdU) assay

Cells were inoculated in 24-well plates (104 cells/ well) and labeled with 10 μmol/L EdU at 37 °C for 2 h. After 15 min fixation in 4% paraformaldehyde, cells were incubated with phosphate buffered saline (PBS) containing 0.3% Triton-100 for 15 min. After washing with PBS, 125 μL of dying solution was applied per well and incubated in dark for 30 min. The nucleus was stained with 1×Hoechst 33342 for 10 min. EdU-positive cells, Hoechst-labeled nucleus, and merged ones were captured under a microscope.

Statistical analysis

Data were expressed as mean ± SD. All the statistical analyses were performed with the SPSS 13.0 (IBM, Armonk, NY, USA). Statistical analyses were performed using either Student’s t test (two-group comparison) or one-way analysis of variance (more than two groups) followed by post hoc comparison, and differences with p<0.05 were considered significantly.

Results

Airn expression was upregulated in liver fibrosis

In our prior study, we found that Airn was significantly upregulated in liver fibrosis according to the microarray data. (The microarray data discussed in the previous article have been deposited in NCBI Gene Expression Omnibus and are accessible through GEO Series accession number GSE89147) [18]. As both mouse and human Airn have various isoforms, we first detected these Airn isoforms in liver tissues or hepatocytes. Of all the isoforms, NR_002853 (mouse Airn) and NR_047514 (human AIRN) showed high expression in liver tissues and remarkably upregulated in fibrotic liver, compared with other isoforms (Additional file 1: Fig. S1A, B). To explore the role of Airn in liver fibrosis, the expression of Airn was initially verified in mouse liver fibrosis model. The results showed that the expression of Airn was dramatically increased in mouse CCl4- and BDL-induced fibrotic liver tissues compared with normal liver tissues (Fig. 1A, B). Moreover, total RNAs were isolated from the serums of 47 patients with liver fibrosis and found that the level of AIRN was increased in these patients compared with 30 healthy volunteers (Fig. 1C). ROC curve analysis revealed the potential diagnostic performance of AIRN in discriminating patients with liver fibrosis from healthy subjects (AUC = 0.796; p<0.05) (Fig. 1D). In addition, the expression of human AIRN was also detected in 6 healthy liver tissues, 16 mild fibrotic liver tissues (F1–F2) and 12 advanced fibrotic liver tissues (F3-F4) [17]. As shown in Fig. 1E, the expression of AIRN was significantly upregulated in mild fibrotic livers but not in advanced fibrotic livers.

Fig. 1
figure 1

Airn expression was upregulated in liver fibrosis. A, B qRT-PCR analysis of Col1α1, α-SMA, and Airn in livers from mice treated with CCl4 or underwent BDL. C qRT-PCR analysis of AIRN in liver serum from healthy (n = 30) and cirrhosis serum (n = 47). D ROC curve analysis of Airn in the serums of liver fibrosis patients and healthy individuals. AUC = area under the curve. E qRT-PCR analysis of AIRN in liver samples from healthy (n = 6), mild fibrosis (n = 16), and advanced fibrosis (n = 12) patients. F Primary LSEC were isolated from livers of mice treated with CCl4 or oil for 0, 2, 4, and 8 weeks and the transcript of Vegfr2, eNos, Et-1, Laminin, and Airn were determined by qRT-PCR. G Primary HC were isolated from livers of mice treated with CCl4 or oil for 0, 2, 4, and 8 weeks. The expression of Ki67 and Airn was detected by qRT-PCR. The data are expressed as the mean ± SD for at least triplicate experiments, *p< 0.05

To assess the expression of Airn in different cell types of healthy and fibrotic livers, primary liver parenchymal cells and non-parenchymal cells, including HSC, LSEC, and KC, were isolated from livers of healthy and fibrotic mice respectively. The purity of primary liver non-parenchymal cells was examined by confocal microscopy detection of VE-Cadherin and VEGFR2 (LSEC marker) [21, 22], α-SMA (HSC marker), and F4/80 (KC marker) (Additional file 1: Fig. S1C). Meanwhile, qRT-PCR analysis was preformed to further detect the expression of Lyve1, VE-cadherin, Vegfr2, F4/80, Cd11b, and α-SMA (Additional file 1: Fig. S1D). Based on these observations, LSEC preparations appeared about 94% purity. Our data showed that the highest expression level of Airn was found in HSC and LSEC followed by HCs and KCs (Additional file 1: Fig. S2A). Moreover, the expression of Airn was upregulated in primary LSECs from fibrotic livers of mice treated with CCl4 for 2, 4, and 8 weeks (Fig. 1F), correlating with the reduction of expression of Vegfr2 and eNos, yet correlating also with the enhancement of the expression of endothelin-1(Et-1) and Laminin (Fig. 1F). Moreover, Airn was increased in injured primary HC and activated HSC, correlating with the enhancement of the expression of Ki67, Col1α1, and α-SMA (Fig. 1G and Additional file 1: Fig. S2B). However, Airn expression had no significant difference in primary KCs of mice treated with CCl4 for various time periods (Additional file 1: Fig. S2C). Overall, the data showed an obvious enhancement of Airn in primary LSEC, HC, and HSCs at 2 weeks after CCl4 treatment, indicating Airn is involved in the initiation of fibrosis. The increased Airn in these cells maintaining a high level until significant fibrosis could be observed at 8 weeks of CCl4 treatment, together with the finding that AIRN was increased in human mild fibrotic livers, suggested that Airn plays a role in the progression of liver fibrosis.

Airn deficiency aggravated CCl4- and BDL-induced liver fibrosis and LSEC capillarization in vivo

In order to elucidate the function of Airn during liver fibrogenesis in vivo, we generated Airn knockout (Airn-KO) mice via CRISPR/Cas9 system (Additional file 1: Fig. S3A-D) and subsequently constructed the CCl4-induced liver fibrosis model. Airn-KO mice were normal in appearance and mating, and a detailed histological examination of major internal organs did not reveal any morphological abnormalities (Additional file 1: Fig. S4). The CCl4 group mice developed serious liver fibrosis and knockout of Airn further aggravated the CCl4-induced liver fibrosis as demonstrated by macroscopic examination, hematoxylin and eosin (H&E), sirius red staining, serum ALT, AST level, and liver hydroxyproline content (Fig. 2A and Additional file 1: Table S2). Moreover, knockout of Airn notably facilitated the upregulation of CCl4-induced α-SMA and COL1α1, whereas it significantly suppressed compensatory upregulation of CCl4-induced PCNA by IHC (Fig. 2A). In addition, western blot and qRT-PCR analysis showed that deficiency of Airn significantly promoted the upregulation of CCl4-induced α-SMA, COL1α1, MMP2, and TIMP1 (Fig. 2B, C), suggesting Airn deficiency aggravated CCl4-induced liver fibrosis. On the other hand, we investigated whether Airn regulated LSEC differentiation or capillarization in vivo. Scanning electron microscopy (SEM) results showed that the number of fenestrae were noticeably decreased in CCl4-induced mice and were further decreased in CCl4-induced Airn-KO mice (Fig. 2D). Furthermore, the expression of the genes related to LSEC capillarization including CD31 and LAMININ was observably enhanced in CCl4-induced Airn-KO mice when compared with CCl4-induced WT mice (Fig. 2C, D), suggesting that Airn deletion worsened CCl4-induced LSEC capillarization.

Fig. 2
figure 2

Airn deficiency aggravated CCl4-induced liver fibrosis and LSEC capillarization in vivo. C57BL/6 mice were divided into four groups: WT (n = 10), WT + CCl4 (n = 10), Airn-KO (n = 10), and Airn-KO +CCl4 (n = 10). A Liver fibrosis was evaluated by macroscopic examination, H&E staining, sirius red staining, and IHC for α-SMA, COL1α1, and PCNA; scale bar, 400 μm for 10× and 100 μm for 40×. Right, five images of each liver and five livers from different mice were quantified for each group. B The protein level of α-SMA, COL1α1, MMP2, and TIMP1 was determined by western blot and quantitatively compared with GAPDH as a reference control. C The mRNA level of the genes related to liver fibrosis including α-SMA, Col1α1, Mmp2, and Timp1, and LSEC capillarization markers Cd31 and Laminin was determined by qRT-PCR. D Liver sections from CCl4-induced fibrotic liver were analyzed using SEM and the protein level of CD31 and LAMININ staining was detected by IHC and quantitatively compared; scale bar, 400 μm for 10× and 100 μm for 40×. Data were quantified from 10 random fields per group for SEM, *p<0.05 stands for WT + CCl4 or Airn-KO vs WT. #p<0.05 stands for Airn-KO + CCl4 vs WT + CCl4

To exclude the possibility that Airn alters the metabolism or toxicity of CCl4 rather than by altering cell responses, the results was confirmed in a BDL-induced mouse liver fibrosis model. As shown in Additional file 1: Fig. S5A-C and Additional file 1: Table S3, the mice of BDL group developed serious liver fibrosis, and knockout of Airn further aggravated BDL-induced liver fibrosis as demonstrated by macroscopic examination, H&E staining, sirius red staining, IHC, serum ALT, AST level, liver hydroxyproline content, western blot, and qRT-PCR. As expected, knockout of Airn notably facilitated the upregulation of BDL-induced expression of LSEC capillarization marker genes CD31 and LAMININ assessed qRT-PCR and IHC (Additional file 1: Fig. S5C, D). Taken together, our data clearly revealed that Airn deficiency aggravated CCl4- and BDL-induced liver fibrosis and LSEC capillarization in vivo.

Over-expression of Airn alleviated CCl4-induced liver fibrosis in vivo

To test whether over-expression of Airn would alleviate liver fibrosis in vivo, AAV8-Airn or AAV8-GFP was intravenously injected into the CCl4-treated or oil-treated mice via the tail vein 2 weeks after the first injection of CCl4. After 8 weeks of CCl4 treatment, qRT-PCR analysis confirmed that Airn was over-expressed in the liver fibrosis model (Fig. 3A). Over-expression of Airn greatly alleviated CCl4-induced liver fibrosis as demonstrated by macroscopic examination, H&E staining, sirius red staining, serum ALT, AST level, and liver hydroxyproline content (Fig. 3B and Additional file 1: Table S4). Moreover, Airn over-expression markedly suppressed upregulation of CCl4-induced α-SMA and COL1α1, whereas obviously promoted compensatory upregulation of PCNA by IHC (Fig. 3B). In addition, qRT-PCR and western blot analysis showed that over-expression of Airn suppressed upregulation of CCl4-induced α-SMA, COL1α1, MMP2, and TIMP1 (Fig. 3C, D). On the other hand, SEM analysis indicated that the number of fenestrae was significantly decreased in CCl4-induced mice, while Airn over-expression rescued the reduction of fenestrae (Fig. 3E). Furthermore, Airn over-expression ameliorated CCl4-induced LSEC capillarization assessed by IHC and qRT-PCR for CD31 and LAMININ (Fig. 3C, E), demonstrating that Airn over-expression suppressed CCl4-induced LSEC capillarization. Taken together, these results confirmed that over-expression of Airn alleviated CCl4-induced liver fibrosis in vivo and was associated with LSEC capillarization.

Fig. 3
figure 3

Over-expression of Airn alleviated CCl4-induced liver fibrosis in vivo. Mice were divided into four groups: AAV8-GFP (n = 10), AAV8-GFP + CCl4 (n = 10), AAV8-Airn (n = 10), and AAV8-Airn + CCl4 (n = 10), and transduced with AAV8-GFP or AAV8-Airn virus via tail vein 2 weeks after the first injection of CCl4, after 8 weeks of CCl4 treatment. A The expression of Airn in livers of each group was examined by qRT-PCR. B Liver fibrosis was evaluated by macroscopic examination, H&E staining, sirius red staining, and IHC for α-SMA, COL1α1, and PCNA; scale bar, 400 μm for 10× and 100 μm for 40×. Right, five images of each liver and five livers from different mice were quantified for each group. C The protein level of α-SMA, COL1α1, MMP2, and TIMP1 was determined by western blot and quantitatively compared with GAPDH as a reference control. D The mRNA level of α-SMA, Col1α1, Mmp2, and Timp1, and Cd31 and Laminin was determined by qRT-PCR. E Liver sections from CCl4-induced fibrotic liver were analyzed using SEM and the protein level of CD31 and LAMININ was detected by IHC staining and quantitatively compared; scale bar, 400 μm for 10× and 100 μm for 40×. *p<0.05 stands for AAV8-GFP+CCl4 or AAV8-Airn vs AAV8-GFP. #p<0.05 stands for AAV8-Airn+CCl4 vs AAV8-GFP+CCl4

Airn maintained LSEC differentiation in vitro

The in vivo data showed that Airn alleviated CCl4-induced LSEC capillarization. Therefore, to investigate whether Airn was involved in LSEC capillarization and differentiation in vitro, we first synthesized three specific siRNAs against Airn (siAirn-1, siAirn-2, and siAirn-3). Among them, siAirn-1 and siAirn-2 showed an efficient knockdown effect and were applied in subsequent experiments. RNA-seq analysis showed that knockdown of Airn decreased LSEC differentiation-associated genes including Flt4 (Vegfr3), Lyve-1, and Stab1, but increased LSEC capillarization-associated genes including Gabre, Lama1, and Lama2 [23] (Additional file 1: Fig. S6A). qRT-PCR analysis further verified that knockdown of Airn significantly reduced Vegfr2, eNos, Lyve-1, and VE-cadherin expression, whereas markedly enhanced Laminin and Angpt2 expression (Fig. 4A). Moreover, the protein level of VEGFR2, eNOS, and VE-Cadherin was markedly decreased in Airn-silenced LSECs assessed by western blot and confocal microscopy (Fig. 4B, C), indicating that Airn silencing promoted LSEC capillarization. On the other hand, over-expression of Airn remarkably enhanced the expression of Vegfr2, eNos, Lyve-1, and VE-cadherin, while significantly suppressed the expression of Laminin and Angpt2 in primary LSEC (Fig. 4D). Consistently, the protein level of VEGFR2, eNOS, and VE-Cadherin was notably increased in Airn over-expressing LSEC (Fig. 4E, F). Additionally, the expression of Vegfr2 and eNos in the primary LSECs isolated from AAV8-Airn mice exhibited remarkable enhancement, but the expression of Laminin demonstrated a profound reduction, in comparison with the AAV8-GFP mice (Additional file 1: Fig. S6B). Taken together, our results demonstrated that Airn maintained LSEC differentiation in vitro.

Fig. 4
figure 4

Airn maintained LSEC differentiation in vitro. A Primary LSECs were transfected with siAirn-1, siAirn-2, , 20μm. D Primary LSECs were infected with LV-Airn and LV-Control for 72 h. The RNA level of Airn, Vefgr2, eNos, Lyve-1, VE-cadherin, Angpt-2, and Laminin was detected by qRT-PCR. E The protein level of VEGFR2 and eNOS was determined by western blot and quantitatively compared with GAPDH as a reference control. F The expression of VE-Cadherin and LAMININ was determined by confocal microscopy and quantitatively compared. DAPI-stained nuclei blue; scale bar, 20 μm. The data are expressed as the mean ± SD for at least triplicate experiments, *p<0.05 stands for vs siRNA-Control or LV-Control

Airn inhibited HSC activation indirectly through maintaining LSEC differentiation

HSC activation have been commonly recognized as the principal cellular players promoting synthesis and deposition of ECM. The expression of marker genes including collagens I and III, α-SMA, MMPs, and TIMPs are significantly increased in the activated HSC compared with that of quiescent HSCs. Additionally, it has been reported that isolated HSCs remains quiescent when cultured for 3 days in vitro, became partly activated at day 7 and fully activated at day 14 [24]. Since the results in vivo showed that Airn alleviated CCl4-induced liver fibrosis, the effect of Airn was investigated in HSCs. However, the expression of COL1α1, α-SMA and MMP2 was unchanged in Airn-silenced or -over-expressed primary HSC at day 2 assessed by qRT-PCR, western blot, and confocal microscopy (Fig. 5A–C and Additional file 1: Fig. S7A-B). Similarly, these results were confirmed in primary HSCs at day 12 (Additional file 1: Fig. S7C-F) suggesting that Airn was not directly involved in the regulation of HSC activation. Therefore, we hypothesized that Airn indirectly acted on HSC by maintaining LSEC differentiation. Subsequently, Airn-silenced or -over-expressed primary LSEC was used to co-culture with primary HSC (Fig. 5D). The expression of the fibrotic genes including α-SMA and COL1α1 was significantly upregulated in HSCs co-culturing with Airn-silenced primary LSECs compared with that treated with the control LSECs (Fig. 5E, G), while the expression of these genes was repressed in HSC co-culturing with Airn-over-expressed primary LSEC assessed by western blot and confocal microscopy (Fig. 5F, G). Taken together, these results suggested that Airn inhibited HSC activation indirectly through maintaining LSEC differentiation.

Fig. 5
figure 5

Airn inhibited HSC activation indirectly through maintaining LSEC differentiation. A Primary HSCs at day 2 were transfected with siAirn-1, siAirn-2, or siRNA-Control for 48 h. The RNA level of Airn, α-SMA, Col1α1, and Mmp2 was detected by qRT-PCR. B The protein level of α-SMA, COL1α1, and MMP2 was determined by western blot and quantitatively compared with GAPDH as a reference control. C The expression of α-SMA and COL1α1 was determined by confocal microscopy and quantitatively compared. DAPI-stained nuclei blue; scale bar, 20 μm. D Schematic diagram illustrating the design of the co-culture experiments. The primary HSCs derived from health mice were co-cultured with the Airn-silenced or -over-expressed of primary LSECs by transwell, or co-cultured with untreated LSEC. E, F The expression of α-SMA, COL1α1, and MMP2 in co-cultured with the Airn-silenced or -over-expressed LSECs was determined by western blot and quantitatively compared with GAPDH as a reference control. G The expression of α-SMA and COL1α1 in co-cultured with the Airn-silenced or -over-expressed LSECs was determined by confocal microscopy and quantitatively compared. DAPI-stained nuclei blue; scale bar, 20 μm. The data are expressed as the mean ± SD for at least triplicate experiments, *p<0.05 stands for vs siRNA-Control or LV-Control

Airn promoted HC proliferation directly and indirectly by paracrine secretion of Wnt2a and HGF from LSECs

To investigate whether Airn was required for the proliferation of HC in vitro, we knocked down the expression of Airn by siRNA in primary HC and AML12 cells. qRT-PCR, western blot, and confocal microscopy analysis showed that the expression of Ki67 and PCNA was significantly decreased in Airn-silenced primary HCs or AML12 cells (Fig. 6A–C and Additional file 1: Fig. S8A-C). CCK8 assay showed that Airn-silenced notably inhibited cell proliferation (Additional file 1: Fig. S8D). Moreover, over-expression of Airn remarkably increased the expression of Ki67 and PCNA in primary HCs and AML12 cells (Fig. 6D,E and Additional file 1: Fig. S8E-G). CCK8 and EdU assay showed that over-expression of Airn significantly improved cell proliferation (Additional file 1: Fig. S8H, I). Additionally, the expression of the pro-proliferation genes exhibited a profound reduction in the primary HCs isolated from CCl4-induced Airn-KO mice, in comparison with that of the CCl4-induced WT mice (Additional file 1: Fig. S9A, B), indicating that Airn promoted HC proliferation directly. While it has been reported that LSECs promoted HC proliferation by paracrine hepatic cytokines including Wnt2a and HGF [7, 21]. Therefore, we investigated whether Airn promoted HC proliferation by LSECs paracrine signal. The results showed that Airn silencing inhibited the mRNA of expression of Hgf and Wnt2a in primary LSEC (Fig. 6F). To further detect whether Airn regulated LSEC paracrine secretion, Airn was silenced by siRNA in primary LSECs and cultured in vitro for 48 h, and the level of HGF was detected in culture supernatants by ELISA. The data showed that Airn silencing downregulated the secretion of HGF in LSEC (Fig. 6G). Next, Airn-silenced primary LSEC were used to co-culture with primary HC (Fig. 6H). Compared with the control LSEC-treated HC, the expression of Ki67 was significantly reduced in HC when co-cultured with Airn-silenced primary LSECs by qRT-PCR and confocal microscopy (Fig. 6I, J). Taken together, Airn not only directly promoted the proliferation of HC, but also promoted the proliferation of HCs through LSEC paracrine secretion of Wnt2a and HGF.

Fig. 6
figure 6

Airn promoted HC proliferation directly and indirectly by paracrine secretion of Wnt2a and HGF from LSEC. A Primary HCs were transfected with siAirn-1, siAirn-2, or siRNA-Control for 48 h. The RNA level of Airn, Ki67, and Pcna was detected by qRT-PCR. B The protein level of PCNA was determined by western blot and quantitatively compared with GAPDH as a reference control. C The expression of Ki67 was determined by confocal microscopy and quantitatively compared. DAPI-stained nuclei blue; scale bar, 20μm. D Primary HC were infected with LV-Airn and LV-Control for 72 h. The RNA level of Airn, Ki67, and Pcna was detected by qRT-PCR. E The protein level of PCNA was determined by western blot and quantitatively compared with GAPDH as a reference control. F Primary LSEC were transfected with siAirn-1, siAirn-2, or siRNA-Control for 48 h. The RNA level of Wnt2a and HGF was detected by qRT-PCR. G Airn was silenced by siRNA in primary LSEC and cultured in vitro for 48 h, the expression of HGF was detected in culture supernatants by ELISA. H Schematic diagram illustrating the design of the co-culture experiments. The primary HC derived from health mice were co-cultured with the Airn-silenced or -over-expressed of primary LSEC by transwell, or co-cultured with untreated LSEC. I The expression of Ki67 was detected by qRT-PCR in co-cultured condition. J The expression of Ki67 was determined by confocal microscopy in co-cultured condition and quantitatively compared. DAPI-stained nuclei blue; scale bar, 20μm. The data are expressed as the mean ± SD for at least triplicate experiments, *p<0.05 stands for vs siRNA-Control or LV-Control

Airn maintained LSEC differentiation through the KLF2-eNOS-sGC pathway

We next explore the mechanism of Airn in maintaining LSEC differentiation. It has been reported that the LSEC phenotype maintained, at least partly, through eNOS-sGC signaling [21] and we have revealed that Airn promoted the expression of eNOS and regulated the expression of eNOS-sGC downstream target genes (Fig. 4A–E). Therefore, LSEC were treated with sGC agonist YC-1. qRT-PCR and confocal microscopy analysis confirmed that Airn silencing decreased the expression of LYVE-1 and increased the expression of LAMININ, which was abrogated by YC-1 (Fig. 7A, B). Moreover, YC-1 rescued Airn silencing-induced downregulation of Wnt2a, Hgf, and Wnt9b, indicating that the knockdown of Airn in LSEC suppressed HC proliferation via the eNOS-sGC pathway (Fig. 7A). Furthermore, primary LSEC was isolated from WT and Airn-KO mice, subsequently treated with YC-1. The expression of Lyve-1 was downregulated, while Laminin was upregulated in the primary LSEC isolated from Airn-KO mice compared with WT (Additional file 1: Fig. S10A, B). However, augmentation of Laminin induced by knockout of Airn was abolished by YC-1 (Additional file 1: Fig. S10A, B). In addition, the expression of KLF2, which has been reported to have positively regulated the transcription of eNOS [25, 26], was decreased in Airn-silenced primary LSEC (Fig. 7C, D and Additional file 1: Fig. S10C) and increased in Airn-over-expressed primary LSECs assessed by qRT-PCR, western blot, and confocal microscopy (Additional file 1: Fig. S10D-F). Thus, to investigate whether Airn regulated the eNOS-sGC pathway via KLF2, specific siRNA targeting KLF2 was transfected in Airn-over-expressed primary LSEC and the results showed that KLF2 silencing abrogated Airn over-expression-induced upregulation of eNos and downregulation of Laminin assessed by qRT-PCR (Fig. 7E). Taken together, our data demonstrated that Airn maintained LSEC differentiation through the KLF2-eNOS-sGC pathway, thereby inhibiting HSC activation and HC proliferation.

Fig. 7
figure 7

Airn maintained LSEC differentiation through KLF2-eNOS-sGC pathway. Primary LSEC were transfected with siAirn or siRNA-Control for 48 h and further treated with 30 μM YC-1 for additional 24 h. A The expression of Lyve-1, Laminin, Wnt9b, HGF, and Wnt2a was detected by qRT-PCR. B The expression of LAMININ was detected by confocal microscopy and quantitatively compared. DAPI-stained nuclei blue; scale bar, 20 μm. C–E Primary LSEC were transfected with siAirn or siRNA-Control for 48 h, the expression of KLF2 was detected by qRT-PCR (C), confocal microscopy (D) and quantitatively compared. DAPI-stained nuclei blue; scale bar, 20 μm. E Primary LSEC were transfected with LV-Airn or LV-Control for 48 h and further treated with siKLF2 for additional 48 h. The expression of eNos and Laminin was detected by qRT-PCR. All data are presented as means ± SD for at least triplicate experiments. F ChIP analyses were performed on indicated gene promoter regions using anti-EZH2 antibody in the single-cell suspensions of mouse liver. G AML12 cells were infected with LV-Airn or LV-Control, and ChIP analyses were performed on indicated genes promoter regions using anti-EZH2 antibody. *p < 0.05 stands for vs siRNA-Control or LV-Control + NC

Generally, lncRNAs regulate their target genes by interacting with RNA binding proteins or acting as endogenous competing RNAs for specific microRNAs. To understand the molecular mechanism underlying the effects of Airn on liver fibrosis and LSEC capillarization, we first investigated the cell distribution of Airn using FISH and qRT-PCR. The results showed that Airn was mainly located in the nucleus of primary LSECs and HCs (Additional file 1: Fig. S11A-C). Moreover, our data demonstrated that Airn promoted the expression of KLF2 at both protein and RNA level in primary LSEC. Thus, a bioinformatics tool was used to screen for Airn-interacting proteins. The data showed that the 58 proteins including EZH2, which has been reported to bind to the promoter regions of KLF2 [27, 28], possibly interact with both human and mouse Airn (Additional file 1: Fig. S11D-G). To investigate this interaction, RIP assay was performed and the results showed a significant enrichment of Airn with the EZH2 antibody (Additional file 1: Fig. S12A, B). In addition, to identify the exact region of the Airn responsible for EZH2 interaction, we constructed the full-length Airn, a series of truncated Airn and the indicated antisense probe (Additional file 1: Fig. S12C). The results of RNA pull-down indicated that nucleotides 532 to 869 of Airn could bind EZH2, consistent with the prediction (Additional file 1: Fig. S12D). Moreover, ChIP analysis demonstrated that EZH2 could bind to promoter regions of KLF2 and over-expression of Airn reduced their binding ability (Fig. 7F, G). Taken together, these data demonstrated that Airn interacts with EZH2 and may block the binding site of EZH2 to KLF2, thus releasing the inhibition of KLF2 and LSEC differentiation related genes.

Discussion

Liver fibrosis represents the consequence of a sustained healing response originating from chronic injury. It is characterized by excessive accumulation of extracellular matrix components and can eventually lead to cirrhosis [2, 29]. Angiogenesis with an abnormal angioarchitecture is a hallmark related to liver fibrogenesis, which implicates a potential target for therapeutic interventions [30]. However, the occurrence of angiogenesis in liver fibrosis remains controversial. For instance, Taura et al. demonstrated that CD31, a marker for endothelial cells, was increased as fibrosis developed [31]. Moreover, Lao et al. investigated the expression of VEGF was continuously increased during sustained damage for CCl4, suggesting that liver fibrosis is accompanied by increased vascular density [32]. However, Liu et al. suggested that angiogenesis increased sharply at the early stage of liver fibrosis, while gradually diminished along with the formation of insoluble scars in late-stage fibrotic livers [30]. In this study, we also found that the expression of angiogenesis markers CD34 and CD31 in human and mouse fibrotic livers were significantly increased in mild fibrosis and drastically reduced in advanced fibrosis (Additional file 1: Fig. S13A, B). Moreover, our study revealed that the role of Airn in LSEC is to repress capillarization and might be stimulated to over-express to inhibit CD34 and CD31, maintaining the differentiation. This could explain the result that Airn expression levels was significantly upregulated in mild fibrotic liver samples but not in advanced fibrotic liver tissues. All these data supported our conclusion that Airn played an important role in the angiogenesis in liver fibrosis.

LSEC are the most numerous non-parenchymal cells in the liver; therefore, they are destined to play an irreplaceable role in various liver diseases. Capillarized LSEC have been shown to precede fibrosis and promote HSC activation and hepatocyte damage [8]. Furthermore, LSEC are important for acting as autocrine and paracrine source for signals of liver fibrosis [33]. It has been reported that LSEC secrete Wnt2 and HGF and promote hepatocyte proliferation and liver regeneration [7]. Moreover, differentiated LSEC can maintain HSC quiescence by producing NO [6], HB-EGF [34], and SK1 [35], while capillarized LSEC lose their capacity to inactivate HSC by secreting EIIA-fibronectin [36], PDGF, TGF-β [37], TNF-α, and IL1 [32], thus promoting fibrogenesis. Therefore, targeting LSEC has great therapeutic prospect for liver fibrosis. In the current study, we confirmed that Airn deficiency aggravated CCl4- and BDL-induced LSEC capillarization, while over-expression of Airn alleviated CCl4-induced LSEC capillarization in vivo. Moreover, over-expression of Airn remarkably enhanced the expression of VEGFR2, eNOS, and LYVE-1; meanwhile, it significantly suppressed the expression of LAMININ and ANGPT2 in primary LSEC in vitro. Further study indicated that Airn inhibits HSC activation indirectly by regulating LSEC differentiation and promoting HC proliferation directly and indirectly by the increased paracrine secretion of Wnt2a and HGF from LSEC, providing the proof that Airn plays a vital role in the orchestration of LSEC/HSC/HC interaction during liver fibrosis and Airn repressed liver fibrosis mainly via inhibiting LSEC capillarization. In addition, VE-cadherin (CD144) is an endothelial specific adhesion molecule locating at endothelial cell junctions and plays a role for paracellular permeability and maintenance of cell polarity [38]. Cyrill et al. revealed that capillarization was characterized by ectopic basement membrane deposition, formation of a continuous EC layer, and increased expression of VE-cadherin [39]. However, Alessio et al. revealed VE-cadherin expression was reduced by inhibitors of NOS [40]. It has been also reported that VE-cadherin could inhibit proliferation in part by altering cytoskeletal structure and decreasing cell spreading [41]. Interestingly, in our study, the results demonstrated that knockdown of Airn significantly reduced VE-cadherin expression, and over-expression of Airn remarkably enhanced the expression of VE-cadherin. However, the mechanism by which Airn regulate VE-cadherin still needs further investigation.

Currently, a mechanism discovered to date is that lncRNA could serve as molecular scaffold and recruit proteins or RNAs to target genes, thereby exerting biological functions. It has been reported that about 20% of lncRNAs, such as HEIH, XIST, KCNQ1OT1, and HOTAIR, expressed in various cell types are bound by PRC2, suggesting that these lncRNAs may have a general role in recruiting PRC2 to their target genes [42]. Emerging evidence suggests lncRNAs could bind to PRC2 and directly regulate the expression of specific genes, for instance, LINC00673 repressed LATS2 expression by recruiting PRC2 to the promoter, subsequently promoting gastric cancer development and progression [27], and lncRNA GHET1 could epigenetically repress transcription of KLF2 by recruiting PRC2 to KLF2 promoter in hepatocellular carcinoma cells [28]. In addition, lncRNAs can also act as endogenous competing RNAs to regulate gene expression, for example, SCARNA10 interacted with PRC2 and blocked PRC2-mediated repression of pro-fibrogenic genes expression [19]. Lethe interacts with NF-κB subunit RelA to inhibit RelA DNA binding and target gene activation [43]. Airn may use the same mechanism as SCARNA10 and Lethe do to promote the expression of KLF2, functioning as a decoy lncRNA. In this article, the results showed that Airn physically interacts with EZH2, thus promoting the expression of LSEC differentiation and capillarization related genes. The mechanism could be that Airn bound to PRC2 competitively, thus blocking the PRC2 binding sites with the target genes and releasing PRC2 inhibition of KLF2 and LSEC differentiation related genes.

Conclusions

In conclusion, we identified that Airn was increased in human and mice fibrotic livers and revealed that Airn deficiency aggravated CCl4- and BDL-induced liver fibrosis in vivo. Over-expression of Airn suppressed CCl4-induced liver fibrosis in vivo. Additionally, Airn maintained LSEC differentiation in vivo and in vitro. Furthermore, Airn inhibited HSC activation indirectly and promoted HC proliferation by paracrine secretion of Wnt2a and HGF from LSEC. Mechanistically, the results demonstrated that Airn interacted with EZH2 to maintain LSEC differentiation through KLF2-eNOS-sGC pathway, thereby promoting HSC quiescence and HC proliferation (Additional file 1: Fig. S14). Our work identified that Airn was beneficial to liver fibrosis by maintaining LSEC differentiation and might be a serum biomarker for liver fibrogenesis.