Background

Myasthenia gravis (MG) is an autoimmune disorder in which autoantibodies against nicotinic acetylcholine receptors (AChR) trigger the destruction of the neuromuscular junction (NMJ). Three distinct mechanisms are proposed to explain neuromuscular transmission failure[1]. The AChR breakdown can be caused by a direct block of receptor function which is primarily due to antibodies that recognize the binding site for the cholinergic ligand. The other pathological mechanisms are pointed to enhanced endocytosis and degradation of the AChR triggered by antibody crosslinking, and complement mediated lysis of the NMJ.

The leading role for complement involvement in MG pathogenesis is supported by multiple studies[2–4]. MG patients show increased deposits of C3 and membrane attack complex (C5b-9; MAC) at the NMJ[5–7] and amplified complement consumption in vivo has also been observed[8]. The simplified NMJ structure in MG is a more likely consequence of complement mediated injury[9].

The complement system plays an important role in innate immunity and mediates crosstalk between innate and adaptive immunity[10]. There is a delicate balance in vivo between complement activation and its inhibition. If this equilibrium is altered, the complement system causes tissue injury and contributes to the pathogenesis of various diseases[11], including neurodegenerative disorders and other neuropathies[12]. Therefore, complement activation is strictly controlled by the regulators of complement activity (RCA). Both membrane bound and soluble RCA have the capacity to prevent the exaggerated complement activation[13].

Limited knowledge is available regarding how specific RCA affect the outcome of experimental autoimmune myasthenia gravis (EAMG). In this study, we examined the effect of complement receptor 1-related gene/protein y deficiency (Crry −/−) on EAMG pathogenesis. Rodent specific Crry has similar regulatory functions as human decay accelerating factor (CD55/DAF) and membrane cofactor protein (CD46/MCP)[14, 15]. Crry is the only ubiquitously expressed transmembrane protein with cofactor activity which is essential to control activation of C3 complement component and protect self-tissues from complement mediated lysis[16]. Crry −/− mice experience uncontrollable alternative pathway (AP) turnover in their plasma leading to an approximately 60% reduction of serum C3 and factor B (fB). However, the magnitude of AP mediated-complement consumption in Crry −/− is less severe than those in fH−/− mice in which over 90% of serum C3 was consumed in mice missing this fluid phase complement regulator[17]. In contrast to the spontaneous development of dense deposit glomerulonephritis in fH−/− mice, no renal pathology is documented in Crry −/− mice[14, 18]. In addition, Crry also has been shown to protect cells from complement attack and is involved in T cell co-stimulation[19].

Based on previously described Crry regulatory properties, we hypothesized that lack of Crry in mice with EAMG would lead to a more severe disease outcome. The rationale was to examine the importance of the Crry deficiency on EAMG pathology by comparing the clinical and immunological aspects of the disease in RCA sufficient WT control (C57BL/6) and RCA deficient Crry mice (Crry −/−). Our data show that Crry deficiency had a direct impact on humoral and adaptive immune responses. However, lack of Crry did not augment significantly disease severity in vivo.

Materials and methods

Mice

Crry +/− mice were generated by a standard gene targeting approach and were backcrossed into C57BL/6 background for over eight generations. Initial observations showed that survival of Crry null embryos is compromised due to the uncontrollable complement activation and concomitant placenta inflammation[20]. In order to obtain viable Crry −/− mice (also called Crry single knockout mice, Crry SKO), we utilized strategic breeding using female breeding partners with impaired complement (AP) capacity[14]. Crry −/− genotyping was performed by PCR with primers of mCrry 16 TTGAGTTCAATGCACTGAGGAGG, Eco RI 16 F CGCAGAATTCAATCTCTTTTCT TTGCC and S46Neo GCTACCCGTGATATTGCTGAAGAG. Wild-type (WT, C57BL/6) mice were purchased from the Jackson Laboratory (Bar Harbor, ME). Mice were housed and maintained in a pathogen-free condition at the Saint Louis University Department of Comparative Medicine. All experiments were performed according to the protocols approved by SLU IACUC.

Induction and clinical evaluation of experimental autoimmune myasthenia gravis (EAMG)

The acetylcholine receptor was purified from the electric organs of Torpedo californica (tAChR) by affinity chromatography[21]. Eight to ten weeks old WT and Crry −/− male mice were used for experiments. EAMG was induced by four subcutaneous injections of 20 μg tAChR emulsified in complete Freund’s adjuvant (CFA) (Difco, Voigt Global Distributions, KS) in a total volume of 200 μl. Mice were immunized along the back subcutaneously, at the base of the tail and boosted twice with 20 μg of tAChR in incomplete Freund’s adjuvant 4 and 8 weeks after primary immunization. Control mock immunized mice received an equal volume of PBS in CFA or IFA.

To validate disease induction in WT and Crry −/− mice were bled ten days after primary and secondary immunization. Sera were collected and screened by ELISA for the production of AChR specific antibodies. EAMG outcome was assessed on a weekly basis. All mice were clinically scored[22], weighed and examined for muscle weakness. Measurements were performed with a grip strength meter (Columbus Instruments, Columbus, OH) and DFE digital force gauge (Ametek, Largo, FL) was used to detect the peak force when animals grasp a grid pull bar. Prior to the measurement, each mouse was exercised with 10–20 paw grips and then the final 5 grips were recorded and analyzed.

Complement activity

Complement activity in WT EAMG, Crry −/− EAMG and mock immunized WT Ctrl, Crry −/− Ctrl mice were analyzed one week after the primary or secondary immunization (Day 8, 35) and at the end of experiment (Day 63). Serum diluted 1:10, 1:20, 1:40 and 1:80 in Veronal buffer was analyzed by a CH50 hemolytic assay according to the manufacturer’s protocol (Sigma, St. Louis, MO). Briefly, 100 μl of 2 × 108 sensitized sheep erythrocytes were mixed with pre-diluted serum and then incubated for 60 minutes at 37°C. At the end of the incubation time, un-lysed cells were removed by centrifugation (Sorvall Legend RT+ benchtop centrifuge: 1500 RPM for 5 minutes) and the intensity of complement mediated hemolysis was measured at 412 nm on Tecan Infinity M200 reader (Tecan Group Ltd., Durham NC).

ELISA for AChR specific IgG subclasses

Conventional ELISA was used for the detection of anti-AChR specific complement fixing antibodies. Serum levels of AChR antibodies were examined at Days 10, 35 and 63 post primary immunization (p.i.). A 96 well Nunc plates (Fisher Scientific, Pittsburgh, PA) were coated overnight at 4°C with 10 μg/ml of purified AChR (100 μl/well). After three washes with PBS-Tween, the plates were blocked for 2 hrs at room temperature (RT) with 200 μl PBS Tween 20 (Sigma, Saint Louis, MO). Mouse serum samples in triplicates at dilution of 1:500 were added (100 μl/well) and incubated at RT for 90 minutes. After washes with PBS-Tween, the plates were incubated for another 90 min with HRP conjugated goat anti-mouse Abs (IgG, IgG1, IgG2b, IgG2c; 1:2000; Alpha Diagnostics, San Antonio, TX). The color reaction was developed with SureBlue TMB substrate and stopped with TMB stop solution (KPL Inc., Gaithersburg, MA). Stopped reactions were read on a Tecan Infinity M200 reader (Tecan Group Ltd., Durham NC). Absorbances were measured at 450 nm and the results were expressed in O.D. values.

Immunofluorescence detection of C3, C3b/iC3b and C5b-9 (MAC) complement components

Mouse diaphragms were embedded in OCT Compound Tissue-Tek (Fisher Scientific, Pittsburgh, PA) and were frozen in liquid N2-cooled 2-methybutane. Tissue samples were stored at −80°C until usage. For IHC analysis of C3, C3 fragments (C3b/iC3b/C3c) and C5b-9 deposition at the NMJ, 10 μm cryosections of mouse diaphragms were mounted on SuperfrostPlus slides. Slides were allowed to air dry and tissues were fixed in cold acetone for 5 minutes. After three washes with PBS, sections were blocked with 3% BSA in PBS for at least 1 hour. Tissues were further stained with FITC conjugated anti-mouse C3 antibody (MP Biomedicals, Solon, OH). For recognition of C3b/iC3b/C3c rat anti-mouse monoclonal antibody (clone 3/26; Hycult Biotech, Plymouth Meeting, PA) and rabbit anti-mouse C5b-9 (EMD Biosciences, San Diego, CA) polyclonal antibodies were used. Although antibody 3/26 recognizes C3b/iC3b/C3c, soluble C3c is not present on the cell surfaces[23]. All these primary antibodies were diluted at 1:200 and 1:300, respectively. For C3b/iC3b and C5b-9 (MAC) staining, sections were labeled with Alexa488 conjugated goat anti-rat and goat anti-rabbit secondary antibodies (1:500; Invitrogen, Carlsbad, CA), respectively. Finally, Alexa Fluor596 labeled bungarotoxin (1:1000; BTX, Invitrogen, Carlsbad, CA) was used to visualize the NMJ. After washes, sections were viewed by an Olympus fluorescence microscope (Olympus Inc, USA). Captured microphotographs were analyzed with Image Pro software (Media Cybernetics, Silver Springs, MD). Results were expressed as percentage of C3 fragments and C5b-9 deposits present at the BTX labeled NMJs.

ELISPOT

Plates coated with primary capture antibodies specific for IFN-γ and IL- 4 from BDTM Elispot Kits (1:200; BD Biosciences, San Jose, CA) were used for detection of cytokine secreting cells. Single cell suspensions (5 × 105/well) of splenocytes in 100 μl of complete RPMI-1640 medium were added in triplicate and incubated for 24 hours, with or without recall antigen of tAChR (at the concentrations of 10; 1.0; 0.1 and 0.01 μg/well). After washes with PBS-Tween buffer, cells were stained overnight with secondary biotin labeled anti-IFN-γ and IL-4 antibodies. After three washes with PBS-Tween buffer, streptavidin-HRP was added and plates were incubated for 60 minutes. ELISPOT plates were developed with BDTM ELISPOT AEC substrate sets (BD Biosciences, San Jose, CA). Spots were counted on Immunospot Image Analyzer using Beta 4.0 version software (ELISPOT Image Analyzer, Cellular Technology Ltd., Cleveland, OH).

FACS analysis

Distribution of T and B cells subsets was analyzed by Becton Dickinson FACSCalibur flow cytometer or FACSArray Bioanalyzer according to the manufacturer’s protocol (BD Biosciences, San Jose, CA). Splenic cell suspensions were harvested at Day 63 post primary immunization and stained with antibodies specific for T (CD3ε PE-Cy7, CD4 PE, CD8 APC) and B (CD45R/B220 PE-Cy7, CD23 PE, sIgM APC) cell subsets markers (BD Biosciences, San Jose, CA). Data were analyzed with WinlistTM software (Verity Inc., Sunnyvale, CA).

Cytometric beads array (CBA)

The BDTM CBA Mouse Th1/Th2/Th17 Cytokine Kit (BD Biosciences, San Jose) was used to measure IL-2; IL-4, IL-6, IFN-γ, TNF and IL-17 protein levels. The procedure was carried out according to the manufacturer's protocol (CBATM, BD Biosciences, San Jose, CA). Serum samples from individual mice were collected at Day 63 p.i. Total 25 μl of serum was mixed with 25 μl of assay diluent. Then, 50 μl of cytokines capture beads and 50 μl of PE-labeled detection antibody were added to each diluted serum and incubated for 2 hrs at RT. Cytokine standard solutions from the BDTM CBA Kits were diluted from concentrations of 0 to 5000 pg/ml. After incubation in the dark at RT for 2 hours, all cytokine standards and samples were washed twice with buffer. Finally, bead pellets with captured cytokines were resuspended in 300 μl of wash buffer and read on BD FACSArray Analyzer (BD Biosciences, San Jose, CA). Acquired data were further analyzed with FCAP ArrayTM software (Soft Flow Inc. Minneapolis, MN).

Statistical analysis

To compare all groups of data, experimental groups were evaluated by a Two-way ANOVA followed by the Bonferroni post hoc test. Column analyses were performed by Mann - Whitney test. Data are presented as the mean ± SEM where P values < 0.05 are considered statistically significant. Data analysis was performed using GraphPad Prism version 5.04 for Windows (GraphPad Software, San Diego, California, USA).

Results

Development and progression of disease in WT EAMG and Crry −/− EAMG mice

To permit satisfactory statistical analysis, disease outcome in WT EAMG and Crry −/− mice was determined by three independent experiments with 5–9 mice in each experimental group. Mouse weight and grip strength in WT EAMG, Crry −/− EAMG (tAChR) and mock (PBS) immunized controls of WT, Crry −/− mice were assessed for the period of 9 weeks after the primary immunization. We did not detect significant changes in weight loss between WT EAMG and Crry −/− EAMG mice (Figure1a). Muscle grip strength varied between WT and Crry −/− mice. In general, Crry −/− EAMG mice (Figure1b) appeared to be weaker than their WT EAMG counterparts (Figure1c). Crry −/− mice showed signs of augmented muscle weakness in an EAMG but the differences, except for one time point (Day 42 p.i.), were not statistically significant (Figure1d). In addition, Crry −/− EAMG mice exhibited no acceleration in disease progression. Furhermore, clinical score analysis correlated with our muscle grip strength data in which no differences between RCA deficient (Crry −/− EAMG) and RCA sufficient (WT EAMG) mice (Table1) were observed.

Figure 1
figure 1

a, b, c, d. Deficiency of Crry−/−did not alter extensively the clinical outcome of EAMG. Mice were immunized with 20 μg of tAChR or PBS at the times indicated with arrows (↑). Weight loss (Figure1a) and muscle grip strength (Figure1b, c, d) measurements were used to assess the clinical outcome of EAMG. See Material and Methods for experimental details. Data shown are one of three independent experiments. Error bars indicate ± SEM values; n = 5–9 mice per group. Asterisks (*) on top of the time points indicate statistically significant differences between WT EAMG and Crry −/− EAMG mice (p < 0.05).

Full size image
Table 1 WT EAMG and Crry −/− EAMG mice show similar disease outcome
Full size table

Serum complement activity

Crry protein has been shown to regulate classical and alternative complement pathways[24] and Crry −/− mice have reduced C3 and fB concentrations due to complement consumption through uncontrolled complement alternative pathway (AP) turnover[14]. A standard hemolytic assay was employed to measure complement activation of WT EAMG and Crry −/− EAMG mice. Examining WT EAMG and Crry −/− EAMG serum at dilutions 1:10; 1:20; 1:40; 1:80, collected at different days after disease induction (Day 8, 35 and 63 p.i.), we observed that total complement activity in Crry −/− EAMG mice at dilution 1:10 was about 20-40% lower when compared to the complement regulator sufficient WT EAMG mice. Complement levels in Crry −/− EAMG mice remained low at Days 8 and 35 (Figure2a, b). At day 63 p.i. WT EAMG and Crry −/− EAMG mice showed reduced complement titers (Figure2c). Disease induction in Crry −/− EAMG mice did not augment complement activity in blood serum. This was possibly due to a complex issue where in Crry −/− mice an uncontrolled complement turnover and a major membrane complement regulator deficiency exists at the same time.

Figure 2
figure 2

a, b, c. Crry−/−mice have decreased complement activity during actively induced EAMG. Complement activity was measured at Day 8, 35 and 63 (Figure2a, b, c) by complement hemolytic assay. See Material and Methods for experimental details. Data is representative of three independent experiments. All error bars are ± SEM. Asterisks (*) on top of the time points indicate statistically significant differences between WT EAMG and Crry −/− EAMG mice (p < 0.05).

Full size image

Levels of AChR specific IgG antibodies

Next, we examined the effect of Crry deficiency on the production of anti-AChR antibodies where the levels of specific antibody subclasses (IgG, IgG1, IgG2b, IgG2c) were measured by ELISA at Day 10, 35 and 63 post primary immunization (p.i.). As shown on Figure3a (Day 63 p.i.), the total amount of anti-AChR IgG antibody was elevated in Crry −/− EAMG. While the IgG1 levels were comparable between the WT and Crry −/− groups (Figure3b), the production of complement fixing antibodies IgG2b (Figure3c) and IgG2c (Figure3d) in Crry −/− EAMG mice was significantly increased. Similar patterns in the AChR specific antibodies profile, but to a lesser magnitude, was observed on Day 10 and seven days after the secondary immunization (AChR + IFA; Day 35 p.i.). Mock immunized mice (PBS + CFA or PBS + IFA) did not generate any measurable levels of anti-AChR antibodies.

Figure 3
figure 3

a, b, c, d. The level of anti-AChR specific complement fixing antibodies IgG 2b and IgG 2c is augmented in Crry−/−EAMG mice. The amount of antibodies produced was determined by ELISA and the level of anti-AChR antibodies production is expressed in O.D. Blood serum from WT EAMG and Crry −/− EAMG mice was collected at Day 63 p.i. Data shown represent one of three independent experiments. Error bars indicate ± SEM values; Asterisks on the top of the bars (*, **) represent statistically significant difference at p < 0.05 and p < 0.01.

Full size image

Immunofluorescence staining for the deposition of C3, C3 fragments (C3b/iC3b) and C5b-9 (MAC) at the NMJs

As a result of augmented production of complement fixing antibodies (IgG2b, IgG2c) in Crry −/− EAMG mice, a significant deposition of IgG and subsequent complement activation at the NMJs were expected. Complement deposition at the NMJs was assessed by staining for C3, C3 fragments (C3b/iC3b) and C5b-9 (MAC). Despite the overall lower complement activity in blood serum of Crry −/− mice, diaphragms from WT EAMG and Crry −/− EAMG showed similar deposition of C3 (Figure4a, b) and C3 fragments (C3b/iC3b; Figure4d, e). Interestingly, strong presence in complement components at the NMJs of WT EAMG and Crry −/− EAMG mice did not result in effective MAC formation (C5b-9; Figure4c, f). Quantitatively, we did not find any significant differences in deposition of C3, C3b/iC3b fragments and C5b-9 (MAC) at the NMJ of WT EAMG and Crry −/− EAMG mice (Figure5). Mock (PBS) immunized WT and Crry −/− mice did not exhibit any IgG or complement components deposition at the NMJ (data not shown).

Figure 4
figure 4

a, b, c, d, e, f. Decreased complement activity in blood serum of Crry−/−EAMG mice did not alter the amount of complement deposition at the NMJs. Diaphragms from WT EAMG (Figure4a, b, c) and Crry −/− EAMG (Figure4d, e, f) mice were stained for the presence of C3, C3b/iC3b and C5b-9 (green fluorescence) complement components. The NMJs were visualized with bungarotoxin (BTX; red fluorescence). Not immunized WT Ctrl and Crry −/− Ctrl mice did not show complement deposition at the NMJ (data not shown). Diaphragms of a minimum of 5 mice from each experimental group were analyzed. Scale bars for magnification (20 μm) are shown on each microphotograph. See Material and Methods for experimental details.

Full size image
Figure 5
figure 5

Deposition of C3, C3b/iC3b and C5b-9 (MAC) is similar at the NMJs of WT EAMG and Crry−/−EAMG mice. Diaphragms from WT EAMG and Crry −/−EAMG mice were stained for C3, C3b/iC3b and C5b-9 (MAC) and BTX staining was used to visualize the NMJs. The results are expressed as percentage of NMJ (%) with detected complement deposits. Minimum three sections with 10–15 NMJs from each diaphragm were quantified (n = 5 mouse per experimental group).

Full size image

Specific recall responses to the AChR antigen

Furthermore, we investigated the effect of Crry deficiency on the development of the adaptive immune response in actively induced EAMG. The recall response of splenic T cells to the AChR antigen was determined by ELISPOT assay on Day 63 post primary immunization. At this time point, the frequency of tAChR responding cells isolated from WT EAMG and Crry −/− EAMG was considerably different. Crry −/− EAMG mice have more IFN-γ (Figure6a) and IL-4 (Figure6b) positive cells than WT EAMG mice. The numbers of spots were increased in a dose dependent fashion when recall antigens were provided at a dose of 10.0, 1.0, 0.1 μg/ml of tAChR. Re-stimulation of control (PBS) immunized Crry −/− and WT cells with tAChR showed no spot formation. Stimulation with Con A (1 μg/ml) resulted in development of a comparable number of spots in both complement regulator deficient (Crry −/−) and complement regulator sufficient WT mice (data not shown).

Figure 6
figure 6

a, b. Crry−/−EAMG mice show augmented IFN-γ and IL-4 recall responses to tAChR ex vivo . Splenic cell suspensions (105 cells/well) isolated from WT EAMG and Crry −/− EAMG mice were re-stimulated in triplicate with tAChR at concentrations of 10, 1.0, 0.1, and 0.01 μg/ml. The frequency of IFN-γ and IL-4 secreting cells was determined by ELISPOT assay and additional controls for negative or positive spot production were established. Con A (1 μg/ml) treated cells (positive control) generated comparable number of spots in all experimental groups (243 ± 57 WT and 211 ± 36 Crry −/−), whereas PBS immunized (negative control) mice did not have any spots. Results shown are representative of two independent experiments. Asterisks (*) represent statistically significant differences at p < 0.05.

Full size image

T and B cells subsets distribution in WT EAMG and Crry −/− EAMG

We have also examined if established EAMG affects T and B cell subset distribution in Crry −/− mice. T and B cell subset analysis was performed in WT EAMG and Crry −/− EAMG mice by flow cytometry at Day 63 post immunization. As a control, we also included WT and Crry −/− mice without disease induction. WT EAMG and Crry −/− EAMG mice had comparable T cell subset distribution (Figure7a). Repeated immunization with tAChR did not have direct effect on T and B cell subset distribution (Day 63). However, the percentage of B cells in the spleen of Crry −/− mice was reduced (Figure7b). Decline in B cell population was not related to the EAMG.

Figure 7
figure 7

a, b Induction of EAMG in Crry−/−and WT mice did not affect the distribution of T and B cell subsets. Splenic cell suspensions from tAChR and mock immunized mice were analyzed by Flow cytometry at Day 63. Results are expressed as percentage of positive cells for each marker (CD3ε PE-Cy7, CD4 PE, CD8 APC, CD45R/B220 PE-Cy7, CD23 PE, sIgM APC; BD Biosciences). Results shown are representative of two independent analyses (n = 4–7 mice per group).

Full size image

Th1, Th2 and Th17 cytokine production in EAMG

We investigated whether there were any differences in production of Th1, Th2 and Th17 cytokines followed by tAChR immunization. While only pro-inflammatory cytokines (IL-6 and TNF) were detected in WT Ctrl mice (Figure8a), blood serum of Crry −/− Ctrl mice showed small increases in levels of IL-2, IL-4, IL-6, IFN-γ and IL-17. In comparison to the WT Ctrl, Crry −/− Ctrl and WT EAMG the highest serum cytokines concentrations were detected in Crry −/− EAMG mice (Figure8b). Crry deficiency in EAMG was associated with increased serum levels of the pro-inflammatory TNF as well as IL-2, IL-4, IL-6 and IL-17. In average Crry −/− EAMG mice showed about two to three folds increase in serum cytokines concentration (Table2). We assume that increase in IL-6 and TNF cytokine levels in WT Ctrl mice was caused by repeated immunizations with complete and incomplete Freund’s adjuvant (PBS + CFA, PBS + IFA).

Figure 8
figure 8

a, b. Levels of Th1, Th2 and Th17 cytokines are increased in plasma of Crry−/−EAMG. Ex vivo cytokine production from blood plasma collected at Day 63 p.i. from mock immunized WT and Crry −/− mice and tAChR immunized mice (WT EAMG and Crry −/− EAMG) was analyzed with cytometric bead arrays (CBA, BD Biosciences). Individual cytokine concentrations are shown in pg/ml. Asterisks (*) indicate values p < 0.05 between complement regulator sufficient WT and complement regulator deficient Crry −/− mice (Figure6a - Ctrl,Figure 6b - EAMG). Results shown are representative of three independent analyses (n = 4–6 mice per experimental group).

Full size image
Table 2 Cytokine induction ratio is increased in Crry −/− EAMG mice
Full size table

Discussion

Our study shows that lack of Crry in EAMG is associated with altered humoral and adaptive immune responses. Crry deficiency enhanced the production of complement fixing antibodies (IgG2b, IgG2c) and augmented specific recall responses in vitro. Production of Th1, Th2 and Th17 cytokines was also increased. In comparison to WT EAMG, Crry −/− EAMG mice showed symptoms of induced muscle weakness but this difference, except one time point, did not reach a statistical significance. This result was probably due to a unique situation where simultaneously Crry deficiency and reduced amount serum C3 and fB levels occur in Crry −/− mice.

Analysis of splenocytes from Crry −/− EAMG mice demonstrated that there were significant changes in the frequency of IFN−γ and IL-4 secreting cells after the re-stimulation with tAChR. It is well established that IFN-γ and IL-4 play a critical role in the pathogenesis of EAMG. IFN-γ knockout mice showed dramatic reduction in mouse AChR-specific IgG1 and IgG2a antibodies and were resistant to EAMG[25]. A recent study on rat myocytes suggests that the IL-4 receptor provides a link between the immune system and muscle in EAMG[26]. Overproduction of IL-6 also plays an important role in age related pathogenic mechanisms mainly in early-onset of MG[27]. This corroborates with the evidence of steroids preventing MG crisis through their effect on down-regulating IL-6[28]. In summary, pro-inflammatory cytokines affect the AChR expression and contribute to the initiation of the autoimmune response[29]. We found that levels of IL-2, IL-4, IL-6, TNF, and IL-17 cytokines were elevated in serum of Crry −/− EAMG mice. Similarly to Mu et al. we showed that the cytokine balance is rearranged during disease development and IL-17 is involved in EAMG[30].

However, increased number of IFN-γ and IL-4 cells in Crry −/− EAMG had a restricted impact on the clinical outcome of EAMG in our current study. In comparison to the previous studies that EAMG model was performed on a C3 sufficient background, we assume that this was due to decreased complement activity in Crry −/− mice affecting both innate and adaptive immune responses. Despite lowered complement activity in bloodstream of Crry −/− mice, we observed that there was considerable deposition of C3 and cleaved C3 fragments (C3b/iC3b) at the NMJ of Crry −/− EAMG mice. If Crry −/− mice have a normal level of complement, the uncontrolled complement activation would result in a more severe form of tissue injury.

Our current observation and the studies by Heeger et al[31] on decay accelerating factor (DAF) deficient mice support the idea that regulators of complement activity impact adaptive immune response[32]. Their significant finding is that the enhanced production of IL-2 and IFN-γ by DAF −/− T cells after re-stimulation is largely complement dependent. Pavlov and colleagues reported similar findings that splenic cells from DAF deficient mice proliferated more vigorously following in vitro stimulation with allogeneic cells[33]. The essential role of both complement regulators, Crry and DAF in preventing of tissue injury was validated in vivo on antibody induced autoimmune glomerulonephritis[34].

The important role of RCA complement regulatory proteins in EAMG pathogenesis is probably through their functions on altering adaptive immune responses[35, 36]. Results from our study show that Crry deficiency modulates antigen specific response in EAMG. However, the detected changes in humoral and adaptive immune response did not eventually lead to the development of an augmented severe disease phenotype. This is in contrast with studies when mice overexpressing Crry or a soluble form of Crry (Crry-Ig) were used for inhibition of complement activity and disease prevention[37, 38].

Currently, it is still a challenge for us to fully understand to what extent and how deficiency in specific RCA affects humoral and adaptive immune response in MG and EAMG. Ours and the others data suggest that there is systemic and indirect effect of complement on T cell immunity[39]. Additional evidence indicates that different expression of RCA in muscle could affect the outcome of EAMG. In passively induced EAMG, the expression of Crry and DAF is increased at diaphragm junctions, whereas more DAF and less of Crry is present at the extraocular muscle junctions. This distinctive pattern in Crry and DAF distribution may contribute to the higher susceptibility of eye muscle to MG[40].

Conclusions

Our observations point to two important biological consequences linked with Crry deficiency and EAMG pathogenesis. Crry −/− mice have impairment in membrane -related inhibition of complement activation and show failure in controlling complement homeostasis. However, Crry participates in crosstalk between the innate and adaptive immune response. We propose that modulation of complement activity with different soluble or membrane bound regulators of complement activity represents a potentially effective way to modify autoimmune processes in MG and EAMG.