Abstract
Background
Our previous study revealed that Vav3 oncogene is overexpressed in human prostate cancer, activates androgen receptor, and stimulates growth in prostate cancer cells. The current study is to determine a potential role of Vav3 oncogene in human breast cancer and impact on estrogen receptor a (ERα)-mediated signaling axis.
Methods
Immunohistochemistry analysis was performed in 43 breast cancer specimens and western blot analysis was used for human breast cancer cell lines to determine the expression level of Vav3 protein. The impact of Vav3 on breast cancer cell growth was determined by siRNA knockdown of Vav3 expression. The role of Vav3 in ERα activation was examined in luciferase reporter assays. Deletion mutation analysis of Vav3 protein was performed to localize the functional domain involved in ERα activation. Finally, the interaction of Vav3 and ERα was assessed by GST pull-down analysis.
Results
We found that Vav3 was overexpressed in 81% of human breast cancer specimens, particularly in poorly differentiated lesions. Vav3 activated ERα partially via PI3K-Akt signaling and stimulated growth of breast cancer cells. Vav3 also potentiated EGF activity for cell growth and ERα activation in breast cancer cells. More interestingly, we found that Vav3 complexed with ERα. Consistent with its function for AR, the DH domain of Vav3 was essential for ERα activation.
Conclusion
Vav3 oncogene is overexpressed in human breast cancer. Vav3 complexes with ERα and enhances ERα activity. These findings suggest that Vav3 overexpression may aberrantly enhance ERα-mediated signaling axis and play a role in breast cancer development and/or progression.
Similar content being viewed by others
Background
Vav3 oncogene, a quanine nucleotide exchange factor (GEF) for Rho family GTPases, belongs to Vav family proteins. The three mammalian Vav proteins (Vav1, Vav2, and Vav3) differ in their tissue distribution. Vav1 is primarily expressed in hematopoietic cells, while Vav2 and Vav3 are more ubiquitously expressed [1, 2]. Vav proteins contain multiple function motifs and are involved in various cellular signaling processes, including cytoskeleton organization, calcium influx, phagocytosis, and cell transformation [3]. Vav proteins share a common structure, including a N-terminal calponin homology (CH) domain involved in Ca+2 mobilization and transforming activity, an acidic domain (AD) containing three regulatory tyrosines, a Dbl homology (DH) domain with a conserved region that promotes the exchange of GDP for GTP on Rac/Rho GTPases, a pleckstrin homology (PH) domain binding to PIP3 that enables its movement to the inner face of the plasma membrane, two Src-homology 3 (SH3) domains interacting with proteins containing proline-rich sequences, and a Src-homology 2 (SH2) domain interacting with proteins containing phosphorylated tyrosines [4, 5]. Tyrosine phosphorylation by receptor protein tyrosine kinase or cytoplasmic protein tyrosine kinase is required for Vav protein activation. In the non-phosphorylation state, Vav is folded, which is achieved by binding of the tyrosines in the AD domain to the DH domain and binding of the CH domain to the C1 region. Upon phosphorylation of the tyrosines in the AD domain, the folding is opened and the DH domain is exposed. Thus, Vav protein is activated and interacts with substrate proteins, and the PH domain is exposed for PIP3 binding [6].
Breast cancer is the most common malignant disease worldwide and the number one cause of cancer-related death among non-smoking women in the US. The major problem in breast cancer therapy is development of estrogen-insensitive growth after hormonal therapy. Aberrant ERα activation by various mechanisms contributes to breast cancer development and estrogen-resistant diseases [7–9]. This ERα hypersensitivity can be achieved by estrogen-independent mechanisms, such as ERα phosphorylation by crosstalking with signal transduction pathways and overexpression of nuclear receptor coactivator SRC3 [10, 11]. Numerous studies have shown that EGFR/HER2-elicited signaling is involved in human breast cancer [9]. In addition, elevated PI3K-Akt signaling, mediated by PTEN deletion and/or mutation and PI3K subunit p110a (PI3KCA) mutation, upregulates ERα activity and is correlated with the breast cancer development and anti-estrogen resistance [12–15]. Activation of PI3K has been implicated in part because the downstream PI3K target, Akt, phosphorylates and promotes ligand-independent ERα activation [16, 17]. Transgenic breast cancer mouse models have confirmed that elevated signaling in the EGFR/HER2-PI3K-Akt pathway either by targeted Akt overexpression or HER2 overexpression in breast epithelial cells induces breast cancer development [18–20]. These signaling pathways have been the targets for breast cancer therapy [7–9].
The classical ERα is a ligand-dependent transcription factor that activates transcription of its target genes in nucleus, which is known as genomic ERα activity. Recent findings revealed that the classical steroid hormone receptors also associate with cell membrane and mediate cell signaling through kinase cascade, defined as nongenomic activity [21, 22]. Nongenomic ERα resides in multiprotein complexes with molecules, such as MNAR/PELP1 and src, in the cytoplasm and signals through the PI3K-Akt and MAPK pathways in breast cancer cells [23, 24]. Nongenomic ERα signaling has been shown to contribute to estrogen-independent growth in breast cancer.
Recently, we and others found that Vav3 oncogene is overexpressed in androgen-independent prostate cancer cells, enhances androgen receptor (AR) activity, and stimulates androgen-independent growth in prostate cancer cells [25, 26]. We further showed that Vav3, as a signal transducer, upregulates AR activity partially via PI3K-Akt signaling [25]. The DH domain of Vav3 is responsible for AR activation. Vav3 also potentiates EGF activity for cell growth and AR activation in prostate cancer cells. More importantly, Vav3 is overexpressed in 32% of human prostate cancer. These findings suggest that Vav3 overexpression may be involved in prostate cancer.
The purpose of this study is to determine the role of Vav3 in breast cancer. We found that Vav3 is overexpressed in human breast cancer specimens and cell lines. Vav3 stimulates growth of breast cancer cells and activates ERα partially via PI3K-Akt signaling. Vav3 potentiates EGF activity for cell growth and ERα activation in breast cancer cells. These data suggest that Vav3 impacts on ERα signaling axis and its overexpression may be involved in breast cancer.
Methods
Reagents
RPMI 1640 medium was purchased from Invitrogen (Gaithersburg, MD). Fetal bovine serum (FBS) and charcoal/dextran-treated FBS were purchased from HyClone Laboratories (Logan, UT). Human Vav3-specific Stealth™ Select RNAi (siVav3-247: 5'-CCCAGTTTCTCTGTTTGAAGAACAT-3') and its control (control-247: 5'-CCCTTCTCTGTTTGTAAAGAGACAT-3') were designed by a software in Invitrogen website and we purchased both oligos from Invitrogen as described before [25]. The transfection reagent Lipofectamine™ 2000 was from Invitrogen. Anti-Vav3 and anti-ERα antibodies were obtained from Upstate Biotechnology (Charlottesville, VA).
Cell culture
The human breast cancer cell lines MCF7 and T47D, and cervical carcinoma cell line Hela were obtained from ATCC (Rockville, MD) and maintained in RPMI-1640 medium supplemented with 10% FBS (complete medium) at 37°C in 5% CO2. Nontumoral breast epithelial MCF-10A cells were obtained from ATCC. Transient transfection experiments were performed in RPMI-1640 medium supplemented with 10% charcoal/dextran-treated FBS (stripped medium).
Plasmids
Plasmids pBEF-Vav3, pHEF-Vav3*, pHEF-Vav3*-ΔDH, pHEF-Vav3*-ΔSH, and control vector pHEF were detailed in our previous studies [25]. pS2-Luc is a gift from Dr. Sohaib Khan, Department of Cell Biology, University of Cincinnati College of Medicine. ERα and ERE-Luc are gifts from Dr. Zafar Nawaz, Braman Breast Cancer Institute, University of Miami Miller School of Medicine.
For generation of GST-Vav3-DH+PH construct, we designed upper primer 5' CGAGAATTCAAGGCAGAGGAAGCACATCAG containing Eco RI site and lower primer 5' TCTGCGGCCGCTGTTTAGGAGTTCTTCGCAG containing Not I site flanking both the DH and PH domains of Vav3 gene. The PCR product by amplification of the DH and PH domains using this pair of primers was subcloned into pGEX-4T-1 vector (GE Healthcare Bio-Sciences Corp. Piscataway, NJ) in frame by Eco RI and Not I sites.
Cell growth assay
Tumor cell growth was estimated by MTT assay as previously described [27]. Briefly, breast cancer cells were seeded into 96-well cell culture plates at a density of 2.5 × 103 cells/well in stripped medium. After incubation in 5% CO2 at 37°C overnight, the cells were transfected with Vav3 siRNA and control siRNA using Lipofectamine 2000 and then cultured in stripped medium without or with E2 (10-9M) for 5 days. At the end of incubation, 20 ul of MTT (2.5 mg/ml in PBS) was added to each well, and the cells were further incubated for one hour at 37°C to allow complete reaction between the dye and the enzyme mitochondrial dehydrogenase in the viable cells. After removal of the residual dye and medium, 100 ul of dimethylsulfoxide was added to each well, and the absorbance at 570 nm was measured using BMG microplate Reader (BMG Labtech, Inc., Durham, NC).
Western blot analysis
Western blot analysis was performed as previously described [27]. Briefly, aliquots of samples with the same amount of protein, determined using the Bradford assay (BioRad, Hercules, CA), were mixed with loading buffer (final concentrations of 62.5 mM Tris-HCl, pH 6.8, 2.3% SDS, 100 mM dithiothreitol, and 0.005% bromophenol blue), boiled, fractionated in a SDS-PAGE, and transferred onto a 0.45-um nitrocellulose membrane (BioRad). The filters were blocked with 2% fat-free milk in PBS, and probed with first antibody in PBS containing 0.1% Tween 20 (PBST) and 1% fat-free milk. The membranes were then washed four times in PBST and incubated with horseradish peroxidase-conjugated secondary antibody (BioRad) in PBST containing 1% fat-free milk. After washing four times in PBST, the membranes were visualized using the ECL Western blotting detection system (Amersham Co., Arlington Height, IL). For western blot analysis of Vav3 expression, the first antibody was incubated overnight at 4°C.
Reporter assay
Cells (105/well) were seeded in 12 well tissue culture plates. Next day, Optifect-mediated transfection was used for the transient transfection assay according to the protocol provided by Invitrogen/Life Technologies, Inc. The cells were then treated with hormone or drugs in stripped medium for 24 hours. Subsequently, the cell extracts were prepared and luciferase activity was assessed in a Berthold Detection System (Pforzheim, Germany) using a kit (Promega, Madison, WI) following the manufacture's instruction. For each assay, cell extract (20 ul) was used and the reaction was started by injection of 50 ul of luciferase substrate. Each reaction was measured for 10 seconds in the Luminometer. Luciferase activity was defined as light units/mg protein.
GST pull down
GST-Vav3-DH+PH and control GST vectors were transformed into BL21 bacteria, respectively (Protein Express, Inc. Cincinnati, OH). The transformed bacteria were cultured in L-Broth with addition of 100 uM of IPTG to induce GST-fusion protein expression. Then, the bacteria were harvested and subjected to GST fusion protein purification by Sonication and using Glutathione Sepharose 4B (Amersham Bioscience).
For pull down reaction, 5~10 ug of GST or GST-Vav3-DH+PH was incubated with 1 mg of cell extracts from MCF7 cells in a binding buffer [20 mM of Tris.CL, PH. 7.9; 300 mM of KCL; 0.05% of NP-40; 0.2 mM of EDTA; 20% of Glycerol; 1 mM of Dithiothritol; 1 mM of phenylmethylsulfonyl fluoride (PMSF), 1× of protease inhibitor cocktail (Roche Diagnostics)] for overnight [28, 29]. Then, the beads were washed for five times in a washing buffer (20 mM of Tris.CL, PH. 7.9; 300 mM of NaCL; 0.01% of NP-40; 0.2 mM of EDTA; 20% of Glycerol; 0.5 mM of Dithiothritol) and boiled in 1 × SDS loading buffer. The proteins in the supernatant were subjected for SDS-PAGE, which was visualized by Coomassie Blue staining. The samples were also subjected to western blot analysis for ERα.
Immunohistochemistry (IHC) staining
IHC staining was performed as detailed in our previous studies [25]. Briefly, paraffin-embedded section of breast cancer tissue array (US Biomax, Rockville, MD) was deparaffinized in xylene, rehydrated in graded alcohol, and transferred to PBS. The slides were treated with a citric acid-based antigen-retrieval buffer (DAKO Co., Carpinteria, CA), followed by 3% H2O2 in methanol, incubated in blocking buffer (5% BSA and 5% horse serum in PBS) and then in the blocking buffer containing antibodies against human Vav3 (Upstate Biotechnology Inc.). After washing, the slide was incubated with a biotinylated secondary antibody (BioGenex Laboratories, San Ramon, CA), followed by washing and incubation with the streptavidin-conjugated peroxidase (BioGenex). A positive reaction was visualized by incubating the slides with stable diaminobenzidine and counterstaining with Gill's hematoxylin (BioGenex) and mounted with Universal Mount mounting medium (Fisher Scientific, Pittsburgh, PA). The intensity and extent of cytoplasm-positive labeling for Vav3 in tissue arrays were assessed semiquantitatively and scored as 0 (no staining), 1+ (weak and focal staining in <25% of tissue), 2+ (moderate intensity in 25–50% of tissue), and 3+ (moderate intensity in >50% of tissue), and 4+ (strong and diffused staining in >50% of tissue).
Results
Expression analysis of Vav3 in human breast cancer specimens
To determine a potential role of Vav3 in breast cancer, we evaluated Vav3 expression in surgical specimens of human breast cancer by IHC analysis using anti-Vav3 antibody. No significant Vav3 immunoreactivity was detected in all normal breast tissue sections (0/8) (Table 1 and Figure 1). In contrast, Vav3 staining, detected in both cytoplasm and nucleus of the epithelial cells but not in stroma of breast tissues, was found in 35 out of 43 tumor tissue sections (35/43, 81%, p < 0.0001). Among the tumor sections, Vav3 staining was found in approximately 67% (27/35) of the specimens with well to moderately differentiated tumors and 100% (8/8) of those with poorly differentiated tumors, respectively. The statistical analysis of association of Vav3 overexpression with poorly differentiated breast tumors failed (p > 0.05), possibly due to the small number of poorly differentiated tumor specimens. The proportion of sections with higher intensity of Vav3 staining, however, was significantly elevated in the specimens with poorly differentiated tumors (p < 0.01). As shown in Figure 1, for moderately and poorly differentiation breast cancer cells, the nuclei are significantly enlarged, hyperchromatic with coarse clumping of chromatin, prominent nucleoli, and irregular nuclear membrane.
Immunoblotting analysis also revealed that Vav3 expression was elevated in MCF-7 and T47D breast cancer cells in comparison with that in nontumoral breast epithelial MCF-10A cells (Figure 2A). ERα was detected in the two breast cancer cell lines, but not at the very low level in nontumoral MCF-10A cells.
Vav3 is involved in growth of breast cancer cells
To determine a potential role of Vav3 in growth of breast cancer cells, we determined the role of Vav3 on estrogen-independent growth in breast cancer cells. Control and Vav3-transfected MCF7 cells were incubated in stripped medium in the presence of increasing concentrations of EGF. We found that Vav3 overexpression stimulated MCF7 cell growth in the absence of EGF and also significantly potentiated the cell growth in response to EGF treatment in a dose-dependent manner (Figure 2B. Elevated expression of Vav3 upon transient transfection of Vav3 expression vector was confirmed by western blot analysis in these cells (Figure 2C).
We then determined whether knockdown expression of Vav3 inhibits growth of these breast cancer cells using Vav3 siRNA that has been characterized previously [25]. Lipofectamine 2000 used for transfection of siRNA has been shown to knock down more than 80% activity of the endogenous gene in a panel of cells tested (Invitrogen). We confirmed a reduced level of Vav3 upon transfection of Vav3 siRNA by protein expression analysis relative to the control (Figure 2D). A growth stimulatory effect in response to estrogen stimulation was observed in T47D and MCF7 cells (Figure 2E and 2F). We found that knockdown expression of Vav3 significantly inhibited both estrogen-dependent and -independent growth in these breast cancer cells (Figure 2E and 2F). At 1.2 pM of siRNA, the growth of T47D and MCF7 cells was inhibited by 64% and 68% in the absence of estrogen and 46% and 77% in the presence of estrogen relative to their respective controls. These data suggest that Vav3 is involved in both estrogen-dependent and -independent growth in breast cancer cells.
Vav3 upregulates ERα activity
Previous studies have revealed that Vav3*, a Vav3 mutant with N-terminal domain deletion including the AD domain containing three tyrosine residues, is a constitutive active form and has much stronger oncogenic effect relative to that by wild type Vav3 [30]. Structure analysis of Vav protein suggested that in the non-phosphorylation state, Vav protein is folded, which is achieved by binding of tyrosines in the AD domain to the DH domain and binding of the CH domain to the C1 region [6]. Phosphorylation of the tyrosines in the AD domain results in unfolding of Vav protein and exposure of the DH domain for interacting with substrate proteins. Consistently, we found that the constitutive active Vav3* shows a much stronger activity in upregulation of AR activity than that by Vav3 [25].
To determine whether Vav3 regulates ERα activity, we used both Vav3 and Vav3* for the reporter assay. Hela cells were transiently cotransfected with a luciferase reporter driven by the estrogen response element (ERE), ERα expression vector, and either Vav3 or Vav3* expression vector. Overexpression of Vav3, and Vav3* with a greater effect relative to the empty vector pHEF, enhanced both basal and estrogen-stimulated ERα activity (Figure 3A). Furthermore, we found that both estrogen-stimulated and Vav3-activated ERα activities were blocked by ER antagonist Tamoxifen (Figure 3A). The inhibitory effect for ERα by Tamoxifen was compromised with Vav3 overexpression. Upregulation of the endogenous ERα activity by Vav3 relative to the empty vector pHEF was also confirmed in MCF7 cells by stimulation of luciferase reporter expression driven by ERE (Figure 3B) and natural promoter of ERα target gene pS2 (Figure 3C). Vav3 also significantly enhanced ERα activity stimulated by sub-physiological concentrations of estrogen (10-11 and 10-10 M) (Figure 3B). These data suggest that Vav3 overexpression confers ERα hypersensitivity.
We next examined the domains of Vav3 required for upregulation of ERα activity by analyzing both wild type Vav3 and Vav3 deletion mutants (Figure 4A). We found that Vav3* demonstrated a much stronger activity for ERα activation relative to Vav3 as compared with the empty vector pHEF, supporting the previous observation that activity of Vav3 is subjected to regulation by phosphorylation (Figure 4B and Figure 5D) [6]. In addition, deletion of the DH domain, but not the SH domain or the CH domain, abolished Vav3 function for ERα activation (Figure 4B). The truncated Vav3 protein with deletion of both PH and SH domains failed to activate ERα. Therefore, consistent with our previous observation of its effect for AR, the DH domain of Vav3 is also essential for ERα activation [25].
Vav3 enhances ERα activity partially via the PI3K-Akt pathway and potentiates EGF for ERα activation
Elevated PI3K-Akt signaling enhances ERα activity and is thought to be critical for breast cancer development and progression [11, 31, 32]. Since Vav3 is a potential upstream regulator of the PI3K-Akt pathway [33, 34], we investigated whether Vav3 overexpression impacts on PI3K-Akt signaling-mediated ERα activation. Hela cells were transiently cotransfected with ERE-Luc reporter, and expression vectors ERα, Vav3*, and p85 (the regulatory subunit of PI3K) and p110 (the catalytic subunit of PI3K). As shown in Figure 5A, cotransfection of Vav3* or PI3K relative to the empty vector pHEF or pCR3.1 stimulated ERα activity. ERα activity was further enhanced in cells cotransfected with both Vav3* and PI3K. On the other hand, cotransfection of a dominant-negative Akt relative to the empty vector pCR3.1 blocked Vav3*-mediated ERα activation (Figure 5B). Next, we determined the role of endogenous PI3K in Vav3-induced ERα activation. Data in Figure 5C showed that PI3K inhibitor Wortmannin blocked both basal and Vav3-stimulated ERα activation in the absence and presence of E2. Similar results were also noted in cells treated with PI3K inhibitor LY294002 (data not shown). These data indicate that Vav3 activates ERα at least partially via PI3K-Akt signaling.
In agreement with its effects on estrogen-independent growth in breast cancer cells (Figure 2B), overexpression of Vav3 potentiated EGF-stimulated ERα activation (Figure 5D). This data suggests that Vav3 overexpression may mediate EGFR/HER2/neu-elicited signaling leading to ERα hypersensitivity.
Vav3 complexes with ERα and impacts on ERα signaling axis
Recent findings implicate that Vav family proteins also complex with transcription factors and regulate gene expression [35, 36]. A nuclear localization signal (NLS) in the PH domain was shown to be solely responsible for the nucleus localization of Vav1 protein, indicating a role of Vav family protein as a transcription coregulator. We have demonstrated that the DH domain of Vav3 is essential for AR and ERα activation (Figure 4) [25]. We performed sequence analysis of Vav proteins and found that the DH domain of Vav3 contains three consensus sequences of the LXXLL motifs or NR boxes, which have been well characterized and involved in interaction with nuclear receptors (Figure 6A). In addition, homologous analysis of Vav3 and Vav1 genes identified a conserved NLS in the PH domain of Vav3 (Figure 6B). These findings suggest that Vav3 is also localized in nucleus and regulates transcription of nuclear receptors.
We then determined whether Vav3 complexes with ERα. We performed GST pull down experiment to confirm the interaction between Vav3 and ERα. A GST fusion protein including the DH and PH domain of Vav3 (GST-Vav3-DH+PH) was generated (Figure 7A). Cell extract derived from MCF7 cells was incubated with immobilized GST-Vav3-DH+PH fusion protein or GST protein. Then, the pull down samples were fractionated by SDS-PAGE (Figure 7B) and subjected to western blot analysis for ERα. We found that GST-Vav3-DH+PH fusion protein, but GST protein, interacted with ERα (Figure 7C). In summary, we found that Vav3 contains NLS in the PH domain and three LXXLL motifs in the DH domain. The deletion mutation and functional analysis by luciferase reporter assay showed that the DH domain of Vav3 is essential for enhancing ERα activity and is involved in complex with ERα. Our data suggest that Vav3 complexes with ERα and its overexpression enhances ERα signaling axis in breast cancer cells.
Discussion
Previous studies from our group have demonstrated that Vav3 is overexpressed in human prostate cancer and potentiates AR signaling [25]. Breast cancer and prostate cancer are steroid-dependent tumors and share a significant similarity in their characteristics and treatment. For instance, growth of these cancer cells, mediated by their corresponding hormone receptors ERα and AR, is hormone-dependent. Hormone ablation is common therapy for both cancers. Recurrent diseases develop hormone-independent growth. Given that steroidal nuclear receptors share many common properties, we hypothesized that Vav3 may regulate ERα activity and is involved in human breast cancer. We tested this hypothesis in the present study by examining the expression of Vav3 in human breast cancer specimens and cell lines and investigated a potential role of Vav3 in breast cancer cell growth and ERα signaling. We found that Vav3 was overexpressed in human breast cancer, particularly in the poorly differentiated lesions and in the two most commonly used breast cancer cell lines. The knockdown expression of Vav3 compromised both estrogen-stimulated and -independent growth of breast cancer cells. On the other hand, overexpression of Vav3 enhanced ERα signaling. These data strongly suggest that Vav3 may play an important role in breast cancer development and/or progression.
Vav3 is an oncogene identified in cell transformation experiments [3]. Vav3 is activated upon ligand stimulation of EGF, insulin, Ros, and IGF receptors and physically associates with a variety of signaling molecules, including Rac1, Cdc42, PI3K, Grb2, and PLC-γ, leading to alteration in cell morphology and cell transformation [33]. Overexpression of Vav3 leads to PI3K activation and focus formation in NIH3T3 cells [34]. In contrast, blocking PI3K activation by PTEN and LY294002 inhibits Vav3-induced cell transformation. Furthermore, it has been shown that Vav3*, a Vav3 mutant with N-terminal domain deletion including the acidic domain, is a constitutive active form and has much stronger oncogenic effect compared with that by Vav3 [30]. Consistently, we found that the augmentation of ERα signaling by Vav3 overexpression was similarly inhibited by Wortmannin and by overexpression of a dominant-negative Akt. In addition, Vav3 showed a lower activity for ERα activation relative to that by Vav3*. EGF treatment significantly potentiated Vav3 activity for ERα activation. These data suggest that Vav3 is subjected to regulation by phosphorylation, most likely at the three tyrosines in the AD domain, which may cause conformation change, release the inhibitory effect of the N-terminal domain, and expose the DH domain for ERα binding.
Many coactivators of steroid hormone receptors have the LXXLL motifs, where L is leucine and X is any amino acid [37, 38]. These coregulators interact with and upregulate ERα-mediated signaling in both nucleus and cytoplasm. For instance, SRC-1 and its related proteins are a family of coactivators containing the homologous bHLH-PAS domain and receptor-interacting domain (RID) with multiple LXXLL motifs and enhance transcription activity of nuclear receptors [37, 38]. PELP1/MNAR containing the LXXLL motif interacts with and enhances both genomic and nongenomic ERα activities [21, 24]. Recent findings implicate that Vav family proteins also complex with transcription factors and regulate gene expression. Vav1 was identified in the component of transcriptionally active nuclear factor of activated T cells (NFAT)- and nuclear factor NFkB-like complexes [35, 36]. A nuclear localization signal (NLS) in the PH domain is solely responsible for nucleus localization of Vav1 protein, indicating a role of Vav family proteins as a transcription coregulator. We found that Vav3 contains the LXXLL motifs in the DH domain and NLS in the PH domain. This finding suggests that Vav3 is also a nuclear protein.
Previous study has shown that Vav protein can be activated by receptor tyrosine kinase upon activation of EGFR [39]. Furthermore, ERα resides in multi-protein complexes with molecules, such as MNAR/PELP1 and src, in the cytoplasm and signals through the PI3K-Akt and MAPK pathways in breast cancer cells [23, 24]. ERα was also found localized in lipid rafts and involved in signaling elicited by EGFR and HER2 receptors [40, 41]. We found that Vav3 activates ERα partially via PI3K-Akt signaling and potentiates EGF effect for cell growth and ERα activation in breast cancer cells. More interestingly, we found that Vav3 complexes with ERα. These findings suggest that Vav3 enhances ERα signaling axis in breast cancer cells. Vav3 overexpression may confer ERα hypersensitivity and play a role in breast cancer. Given both nuclear and cytoplasmic localization of Vav3 protein, our data implicate that Vav3 may impact on both genomic and nongenomic ERα activity. Furthermore, the relationship of Vav3 and ERα in the context of EGFR/HER2 and PI3K-Akt signaling is remained to be determined.
Our findings support the notion that Vav3 overexpression may play a role in breast cancer, based on the following reasons: 1) Vav3 is overexpressed and correlated with poorly differentiated tumors in human breast cancer; 2) Vav3 contains the LXXLL motifs and complexes with ERα; 3) Vav3 enhances ERα activity partially via the PI3K-Akt pathway; 4) Vav3 is a protein with multiple domains and functions, including the SH2 domain interacting with receptor protein tyrosine kinase, the PH domain binding PIP3 involved in association with the cell membrane, and the DH domain involved in interaction with ERα; 5) Vav3 potentiates EGF for cell growth and ERα activation. Taken together, these findings suggest that Vav3 overexpression enhances ERα-mediated signaling axis and may be involved in breast cancer.
Data presented in this report clearly show that Vav3 is overexpressed in human breast cancer and is involved in growth of breast cancer cells and ERα signaling. Whereas our data showed that Vav3 complexes with ERα, molecular mechanisms underlying the enhancement of ERα signaling remain to be elucidated. Nevertheless, data presented here strongly suggest a novel mechanism that potentially leads to ERα hypersensitivity and breast cancer development and/or progression.
Abbreviations
- ERα:
-
estrogen receptor α
- EGFR:
-
epidermal growth factor receptor
- HER2:
-
human epidermal growth factor receptor
- GEF:
-
quanine nucleotide exchange factor
- IHC:
-
Immunohistochemistry
- NLS:
-
nuclear localization signal.
References
Bustelo XR: Regulatory and signaling properties of the Vav family. Mol Cell Biol. 2000, 20 (5): 1461-1477. 10.1128/MCB.20.5.1461-1477.2000.
Bustelo XR: Vav proteins, adaptors and cell signaling. Oncogene. 2001, 20 (44): 6372-6381. 10.1038/sj.onc.1204780.
Katzav S, Martin-Zanca D, Barbacid M: vav, a novel human oncogene derived from a locus ubiquitously expressed in hematopoietic cells. Embo J. 1989, 8 (8): 2283-2290.
Zugaza JL, Lopez-Lago MA, Caloca MJ, Dosil M, Movilla N, Bustelo XR: Structural determinants for the biological activity of Vav proteins. J Biol Chem. 2002, 277 (47): 45377-45392. 10.1074/jbc.M208039200.
Moores SL, Selfors LM, Fredericks J, Breit T, Fujikawa K, Alt FW, Brugge JS, Swat W: Vav family proteins couple to diverse cell surface receptors. Mol Cell Biol. 2000, 20 (17): 6364-6373. 10.1128/MCB.20.17.6364-6373.2000.
Aghazadeh B, Lowry WE, Huang XY, Rosen MK: Structural basis for relief of autoinhibition of the Dbl homology domain of proto-oncogene Vav by tyrosine phosphorylation. Cell. 2000, 102 (5): 625-633. 10.1016/S0092-8674(00)00085-4.
Sommer S, Fuqua SA: Estrogen receptor and breast cancer. Semin Cancer Biol. 2001, 11 (5): 339-352. 10.1006/scbi.2001.0389.
Hennessy BT, Smith DL, Ram PT, Lu Y, Mills GB: Exploiting the PI3K/AKT pathway for cancer drug discovery. Nature reviews. 2005, 4 (12): 988-1004. 10.1038/nrd1902.
Rau KM, Kang HY, Cha TL, Miller SA, Hung MC: The mechanisms and managements of hormone-therapy resistance in breast and prostate cancers. Endocrine-related cancer. 2005, 12 (3): 511-532. 10.1677/erc.1.01026.
Glaeser M, Floetotto T, Hanstein B, Beckmann MW, Niederacher D: Gene amplification and expression of the steroid receptor coactivator SRC3 (AIB1) in sporadic breast and endometrial carcinomas. Horm Metab Res. 2001, 33 (3): 121-126. 10.1055/s-2001-14938.
Rochette-Egly C: Nuclear receptors: integration of multiple signalling pathways through phosphorylation. Cell Signal. 2003, 15 (4): 355-366. 10.1016/S0898-6568(02)00115-8.
Mills GB, Lu Y, Fang X, Wang H, Eder A, Mao M, Swaby R, Cheng KW, Stokoe D, Siminovitch K, Jaffe R, Gray J: The role of genetic abnormalities of PTEN and the phosphatidylinositol 3-kinase pathway in breast and ovarian tumorigenesis, prognosis, and therapy. Semin Oncol. 2001, 28 (5 Suppl 16): 125-141. 10.1016/S0093-7754(01)90290-8.
Isakoff SJ, Engelman JA, Irie HY, Luo J, Brachmann SM, Pearline RV, Cantley LC, Brugge JS: Breast cancer-associated PIK3CA mutations are oncogenic in mammary epithelial cells. Cancer research. 2005, 65 (23): 10992-11000. 10.1158/0008-5472.CAN-05-2612.
Li SY, Rong M, Grieu F, Iacopetta B: PIK3CA mutations in breast cancer are associated with poor outcome. Breast Cancer Res Treat. 2005, 1-5.
Clark AS, West K, Streicher S, Dennis PA: Constitutive and inducible Akt activity promotes resistance to chemotherapy, trastuzumab, or tamoxifen in breast cancer cells. Mol Cancer Ther. 2002, 1 (9): 707-717.
Ali S, Coombes RC: Endocrine-responsive breast cancer and strategies for combating resistance. Nat Rev Cancer. 2002, 2 (2): 101-112. 10.1038/nrc721.
Felekkis KN, Narsimhan RP, Near R, Castro AF, Zheng Y, Quilliam LA, Lerner A: AND-34 activates phosphatidylinositol 3-kinase and induces anti-estrogen resistance in a SH2 and GDP exchange factor-like domain-dependent manner. Mol Cancer Res. 2005, 3 (1): 32-41.
Guy CT, Webster MA, Schaller M, Parsons TJ, Cardiff RD, Muller WJ: Expression of the neu protooncogene in the mammary epithelium of transgenic mice induces metastatic disease. Proceedings of the National Academy of Sciences of the United States of America. 1992, 89 (22): 10578-10582. 10.1073/pnas.89.22.10578.
Blanco-Aparicio C, Perez-Gallego L, Pequeno B, Leal JF, Renner O, Carnero A: Mice expressing myrAKT1 in the mammary gland develop carcinogen-induced ER-positive mammary tumors that mimic human breast cancer. Carcinogenesis. 2007, 28 (3): 584-594. 10.1093/carcin/bgl190.
Maroulakou IG, Oemler W, Naber SP, Tsichlis PN: Akt1 ablation inhibits, whereas Akt2 ablation accelerates, the development of mammary adenocarcinomas in mouse mammary tumor virus (MMTV)-ErbB2/neu and MMTV-polyoma middle T transgenic mice. Cancer research. 2007, 67 (1): 167-177. 10.1158/0008-5472.CAN-06-3782.
Vadlamudi RK, Kumar R: Functional and biological properties of the nuclear receptor coregulator PELP1/MNAR. Nuclear receptor signaling. 2007, 5: e004-
Gururaj AE, Rayala SK, Vadlamudi RK, Kumar R: Novel mechanisms of resistance to endocrine therapy: genomic and nongenomic considerations. Clin Cancer Res. 2006, 12 (3 Pt 2): 1001s-1007s. 10.1158/1078-0432.CCR-05-2110.
Greger JG, Fursov N, Cooch N, McLarney S, Freedman LP, Edwards DP, Cheskis BJ: Phosphorylation of MNAR promotes estrogen activation of phosphatidylinositol 3-kinase. Mol Cell Biol. 2007, 27 (5): 1904-1913. 10.1128/MCB.01732-06.
Wong CW, McNally C, Nickbarg E, Komm BS, Cheskis BJ: Estrogen receptor-interacting protein that modulates its nongenomic activity-crosstalk with Src/Erk phosphorylation cascade. Proceedings of the National Academy of Sciences of the United States of America. 2002, 99 (23): 14783-14788. 10.1073/pnas.192569699.
Dong ZY, Liu Y, Lu S, Wang A, Lee K, Wang LH, Revelo M, Lu S: Vav3 oncogene is overexpressed and regulates cell growth and androgen receptor activity in human prostate cancer. Mol Endo. 2006, 20: 2315-2325. 10.1210/me.2006-0048.
Lyons LS, Burnstein KL: Vav3, a Rho GTPase Guanine Nucleotide Exchange Factor, Increases During Progression to Androgen Independence in Prostate Cancer Cells and Potentiates Androgen Receptor Transcriptional Activity. Mol Endocrinol. 2005, December 29,
Lu S, Tsai SY, Tsai MJ: Melecular mechanisms of androgen-independent growth of human prostate cancer LNCaP-AI cells. Endocrinology. 1999, 140: 5054-5059. 10.1210/en.140.11.5054.
Zhang J, Kalkum M, Yamamura S, Chait BT, Roeder RG: E protein silencing by the leukemogenic AML1-ETO fusion protein. Science. 2004, 305 (5688): 1286-1289. 10.1126/science.1097937.
Zhang J, Kalkum M, Chait BT, Roeder RG: The N-CoR-HDAC3 nuclear receptor corepressor complex inhibits the JNK pathway through the integral subunit GPS2. Mol Cell. 2002, 9 (3): 611-623. 10.1016/S1097-2765(02)00468-9.
Lopez-Lago M, Lee H, Cruz C, Movilla N, Bustelo XR: Tyrosine phosphorylation mediates both activation and downmodulation of the biological activity of Vav. Mol Cell Biol. 2000, 20 (5): 1678-1691. 10.1128/MCB.20.5.1678-1691.2000.
Tremblay A, Tremblay GB, Labrie F, Giguere V: Ligand-independent recruitment of SRC-1 to estrogen receptor beta through phosphorylation of activation function AF-1. Mol Cell. 1999, 3 (4): 513-519. 10.1016/S1097-2765(00)80479-7.
Yeh S, Lin HK, Kang HY, Thin TH, Lin MF, Chang C: From HER2/Neu signal cascade to androgen receptor and its coactivators: a novel pathway by induction of androgen target genes through MAP kinase in prostate cancer cells. Proceedings of the National Academy of Sciences of the United States of America. 1999, 96: 5458-5463. 10.1073/pnas.96.10.5458.
Zeng L, Sachdev P, Yan L, Chan JL, Trenkle T, McClelland M, Welsh J, Wang LH: Vav3 mediates receptor protein tyrosine kinase signaling, regulates GTPase activity, modulates cell morphology, and induces cell transformation. Mol Cell Biol. 2000, 20 (24): 9212-9224. 10.1128/MCB.20.24.9212-9224.2000.
Sachdev P, Zeng L, Wang LH: Distinct role of phosphatidylinositol 3-kinase and Rho family GTPases in Vav3-induced cell transformation, cell motility, and morphological changes. J Biol Chem. 2002, 277 (20): 17638-17648. 10.1074/jbc.M111575200.
Houlard M, Arudchandran R, Regnier-Ricard F, Germani A, Gisselbrecht S, Blank U, Rivera J, Varin-Blank N: Vav1 is a component of transcriptionally active complexes. J Exp Med. 2002, 195 (9): 1115-1127. 10.1084/jem.20011701.
Movilla N, Bustelo XR: Biological and regulatory properties of Vav-3, a new member of the Vav family of oncoproteins. Mol Cell Biol. 1999, 19 (11): 7870-7885.
Voegel JJ, Heine MJ, Tini M, Vivat V, Chambon P, Gronemeyer H: The coactivator TIF2 contains three nuclear receptor-binding motifs and mediates transactivation through CBP binding-dependent and -independent pathways. Embo J. 1998, 17 (2): 507-519. 10.1093/emboj/17.2.507.
Leo C, Chen JD: The SRC family of nuclear receptor coactivators. Gene. 2000, 245 (1): 1-11. 10.1016/S0378-1119(00)00024-X.
Tamas P, Solti Z, Bauer P, Illes A, Sipeki S, Bauer A, Farago A, Downward J, Buday L: Mechanism of epidermal growth factor regulation of Vav2, a guanine nucleotide exchange factor for Rac. J Biol Chem. 2003, 278 (7): 5163-5171. 10.1074/jbc.M207555200.
Fan P, Wang J, Santen RJ, Yue W: Long-term treatment with tamoxifen facilitates translocation of estrogen receptor alpha out of the nucleus and enhances its interaction with EGFR in MCF-7 breast cancer cells. Cancer research. 2007, 67 (3): 1352-1360. 10.1158/0008-5472.CAN-06-1020.
Marquez DC, Chen HW, Curran EM, Welshons WV, Pietras RJ: Estrogen receptors in membrane lipid rafts and signal transduction in breast cancer. Molecular and cellular endocrinology. 2006, 246 (1–2): 91-100. 10.1016/j.mce.2005.11.020.
Pre-publication history
The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/8/158/prepub
Acknowledgements
This work is supported by grants from the American Cancer Society Ohio Division, Inc., Ohio Cancer Research Associates, and NIH R01CA119935.
Author information
Authors and Affiliations
Corresponding author
Additional information
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
KL generated GST fusion protein for pull down analysis. YL performed cell cultures, proliferation assays, Western blot analysis, and reporter assay. ZD performed IHC. JQM did histopathological analysis of breast cancer tissues. JZ provided plasmid and expertise in protein/protein interaction. SL contributed to conception and design of study and interpretation of data. All authors read and approved the final manuscript.
Authors’ original submitted files for images
Below are the links to the authors’ original submitted files for images.
Rights and permissions
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
About this article
Cite this article
Lee, K., Liu, Y., Mo, J.Q. et al. Vav3 oncogene activates estrogen receptor and its overexpression may be involved in human breast cancer. BMC Cancer 8, 158 (2008). https://doi.org/10.1186/1471-2407-8-158
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/1471-2407-8-158