Introduction

Poly(A)-specific ribonuclease (PARN) is a 3′ to 5′ exonuclease that removes poly(A) or oligo(A) tails from the 3′ ends of RNAs1,2,3,4. PARN is expressed ubiquitously in almost all tissues of eukaryotic organisms5 and has multiple functions in eukaryotes. For example, during early development PARN plays a role in mRNA deadenylation in Xenopus5,6,7.

In human cells, PARN primarily functions in an adenylation/deadenylation regulatory pathway that regulates the decay rate of ncRNAs (Fig. 1)8. In this pathway, Y RNAs, snoRNAs, the human telomerase RNA (hTR), and some miRNAs can be oligoadenylated by noncanonical poly(A) polymerases, such as paralogs PAPD5 and PAPD78,9,10,11,12. The presence of the oligo(A) tail can then recruit processive sequence-independent 3′ to 5′ exonucleases to degrade ncRNAs9,11,13,14,15,16,17. Alternatively, the oligoadenylated tail can be removed by adenosine specific 3′ to 5′ exonucleases such as PARN to maintain stability of ncRNAs. Thus, when PARN is inhibited or defective, some ncRNAs are prematurely degraded, including hTR9,10,11,12,17,18,19,20.

Figure 1
figure 1

PARN functions in an adenylation/deadenylation regulatory pathway that regulates the decay rate of ncRNAs. ncRNAs could be targeted to adenylation by PAPD5 or deadenylation by PARN8. In PARN-deficient cells, the presence of oligo(A) tail can recruit 3′ to 5′ exonucleases to degrade ncRNAs.

Full size image

PARN also stabilizes some miRNAs by removing poly(A) tails added by PAPD5, which prevents the recruitment of exonucleases DIS3L or DIS3L2 to degrade miRNAs9,11. Importantly, several PARN-regulated miRNAs (miR-380-5p, miR-1285, miR-92, miR-214, miR-485, miR-331, miR-665, miR-3126, and miR-25) either have been shown, or are predicted, to target the TP53 mRNA21,22,23,24,25. p53 is tumor suppressor that prevents outgrowth of aberrant cells by inducing cell-cycle arrest, DNA repair or programmed cell death26. It has been shown that numerous human cancers increase proliferation and resistance to DNA-damage agents by downregulating the p53 pathway27,28. Moreover, depletion of PARN upregulates p53 and sensitizes cells to chemotherapeutic agents11,29. Thus, inhibition of PARN might be an effective intervention to induce the expression of p53 in some tumors and thereby limit tumor progression.

Currently, only a limited number of PARN inhibitors exist30,31,32,33,34. To identify potential inhibitors of PARN, we performed computational-based docking between human PARN and a small molecule library of adenosine analogs and performed high-throughput screening (HTS) of a small molecule library. The combination of these two approaches allowed us to identify four compounds that inhibit PARN in vitro and also repress PARN activity in Hela cells.

Results

Purification of PARN for in vitro assay

To test the effects of compounds on PARN, we purified the enzyme and developed an in vitro assay for PARN activity. Expression of full-length PARN led to aggregation, but expression of the C-terminal truncated protein (1-430 aa of PARN) was soluble. Previous work has shown that the D28A and F31A mutations in PARN inhibit PARN activity35. Given this, we expressed and purified the catalytic mutant PARN D28A F31A (PARNmut) as a negative control. Purification (see “Materials and methods”) yielded a dominant band for PARN1-430 and PARNmut on SDS-PAGE gels (Fig. 2a and b).

Figure 2
figure 2

PARN purification and validation. (a) SDS-PAGE gel of the fractions during PARN1-430 purification. (b) SDS-PAGE gel of the fractions during PARNmut purification. (c) Gel assay showing PARN1-430 and PARNmut’s activity activity on poly(A) tail RNA at different time points (0-, 10-, 20-, and 30-min post incubation), PARNmut shows no enzymatic activity on poly(A) RNA. (d) Representative gel confirming PARN activity on poly(A) RNA and non-poly(A) RNA after 20 min of incubation. Poly(A) tail RNA sequence is a fluorescently labeled RNA with a CCUUUCC followed by a 9 nucleotides oligo(A) tail. Non-poly(a) RNA is a fluorescently labeled RNA with a CCUUUCCGC tail instead of 9 nucleotides oligo(A) tail. Full gels are presented in Supplementary Fig. S1.

Full size image

We found that purified PARN1-430 shows enzymatic activity on the poly(A) tail of test substrates. PARN1-430 was incubated with a fluorescently labeled RNA with a CCUUUCC sequence followed by a 9 nucleotide-long poly(A) tail and the reaction product was visualized on denaturing acrylamide gels. We observed that PARN removed the 3′ oligo(A) tail from the RNA substrate (Fig. 2c and d). The activity was dependent on PARN since PARNmut protein showed no removal of the 3′ adenosines (Fig. 2c). Moreover, we observed that PARN is inhibited when treated with adenosine monophosphate (AMP), as has been reported previously31. PARN1-430 showed reduced activity when incubated with an unadenylated RNA (Fig. 2d), consistent with the finding that PARN1-430 preferentially degrades poly(A) tail36.

Developing a high-throughput PARN inhibition assay

To easily screen compounds for inhibition of PARN activity, we developed an assay in which fluorescence was used as the readout for monitoring PARN1-430’s activity (Fig. 3a). This assay was modeled on a similar assay developed for Caf1/CNOT7 deadenylase37. In this assay, PARN1-430 was incubated with a 5′-fluorescently labeled oligoadenylated RNA. In the absence of deadenylation, this substrate RNA can effectively hybridize to a complementary DNA oligonucleotide with a quencher on its 3′ end leading to a loss of fluorescence (Fig. 3a). When the RNA substrate is deadenylated, the quenching oligonucleotide is no longer able to stably hybridize leading to an increase in fluorescence in the reaction.

Figure 3
figure 3

Developing a fluorescence assay for PARN inhibition. (a) Cartoon depicting the inhibition fluorescence assay. Schematic diagram of the fluorescence-based deadenylase assay. The assay is based on a 5′ FAM-labelled RNA oligonucleotide substrate. After incubation of the substrate in the presence of PARN1-430, the reaction is stopped and a 3′ BHQ-labelled DNA oligonucleotide probe complementary to the RNA substrate is added. The fluorescence of intact substrate is quenched upon probe hybridization because of the proximity of the BHQ fluorophore. In contrast, the BHQ-labelled probe cannot hybridize to the FAM-labelled reaction product allowing detection of FAM fluorescence37. (b) PARN1-430 inhibition assay with fluorescence as a readout with time course for PARN1-430 treatment (73 nM), PARN1-430 inhibition with 2.5 mM AMP, and no-enzyme control. 2-way ANOVA, multiple comparisons test, average ± SD, n = 3 replicates. *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001, n.s. was not indicated. (c) Dose–response curve of PARN1-430 enzymatic activity using different PARN1-430 concentrations (36.5–730 nM). Dotted-line represents RNA and RNA + Quencher data. One-way ANOVA, multiple comparisons test, average ± SD, n ≥ 3 replicates. *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001, n.s. was not indicated. (d) PARN1-430 and PARNmut enzymatic activity measured at different time points. PARN showed an increase in activity versus time while PARNmut showed no activity up to 30 min incubation. Dotted-line represents RNA and RNA + Quencher data. 2-way ANOVA, multiple comparisons test, average ± SD, n = 3 replicates. *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001, n.s. was not indicated.

Full size image

This assay has several features that make it useful for assessing PARN activity. First, it is time-dependent (Fig. 3b and d). Second, it is dependent on PARN concentration (Fig. 3c). Third, we observed that AMP, which is a product of PARN activity and can inhibit PARN1-430 at high concentrations (> 1 mM), effectively inhibited PARN1-430 (Fig. 3b)31. Finally, we observed that fluorescence correlates with shortening of the 3′ oligo A tail on the substrate by running the material on a gel and observing shortening of the substrate with PARN1-430, but no shortening with PARNmut (Figs. 2c and 3d). In this assay, PARN1-430 inhibition is inversely proportional to the reaction fluorescence measured as output, which we can use to test possible PARN inhibitors.

Computational-based library docking to identify potential PARN inhibitors

To identify potential small molecule PARN inhibitors, we first used a computational-based docking approach to screen a library of 1820 adenosine analogs from the SelleckChem kinase inhibitor library against the crystal structure of the PARN nuclease domain (PDB: 2A1R)35. This library was utilized as the kinase inhibitors are ATP-mimetics and the PARN active site binds adenosine. The PARN nuclease domain includes the four conserved residues among DEDD superfamily, Asp28, Glu30, Asp292, and Asp382, that are important for the catalytic activity of PARN and are required for the binding of divalent metal ions38. Mutations of these residues lead to loss of function in PARN38,39,40. Therefore, based on this information, we targeted this catalytic site of PARN and selected high-ranking compounds by XP GScore, an approximation of ligand binding free energy, and by interaction with the Asp28-Phe31 region. Analysis of the docking simulation identified several structurally distinct compounds predicted to dock into the PARN catalytic pocket (Fig. 4).

Figure 4
figure 4

Docking of small molecule adenosine analogs into the PARN catalytic site. Ligand interaction map of the predicted binding mode of AICAR, AZD8835, Claribine, Vidarabine, GNF-7, 5-Iodotubercidin, Regadenson, and Clofarabine, where red residues are charged negative, purple residues are charged positive, green residues are hydrophobic, and blue residues are polar, magenta arrows indicate H-bonds, violet lines indicate salt bridges, and gray spheres represent areas of solvent exposure. HIP represents the ND1 and NE2 protonation state of His and NMA represents N-methyl amide of a capped termini. At least one H-bond interaction was observed between the docked small molecule and amino acid residues Asp28-Phe31.

Full size image

Testing compounds predicted to interact with PARN

To determine if any of the compounds predicted to dock to PARN showed effects on PARN1-430, we tested 15 compounds based on their docking ranks and commercial availability using the fluorescence assay and gels (Fig. 5 and Table 1). This screen identified 7 compounds that showed PARN1-430 inhibition. GNF-7 (labeled as 5o) has the strongest inhibitory effect on PARN1-430 (Fig. 5a). In agreement with the fluorescence assay results, the gel assay also revealed GNF-7 (Fig. 5c), a Bcr-Abl inhibitor41, as the most effective PARN1-430 inhibitor (Fig. 5b). GNF-7 inhibits PARN1-430 with a lower concentration compared to AMP (2.5 mM) (Fig. 5a and b).

Figure 5
figure 5

Testing drugs on activity of PARN using RNA substrates in vitro. (a) Inhibition fluorescence assay showing effects of different drugs on PARN1-430. PARN1-430 was pretreated with drugs at room temperature for 10 min before adding RNA substrate. AMP and GNF-7 were shown in pink and red, respectively. One-way ANOVA, multiple comparisons test, average ± SD, n ≥ 3 replicates. *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001, n.s. was not indicated. (b) Gels illustrating inhibitory effects of different drugs on PARN1-430. The reaction was performed the same as the fluorescence assay, heat inactivated, then loaded and visualized on gels. Full gels are presented in Supplementary Fig. S1. (c) Molecular structure of GNF-7. (d) Dose–response curve of GNF-7 on PARN1-430. PARN1-430 was pre-treated with different concentrations of GNF-7 for 10 min and incubated with RNA substrate. The reaction was quenched with DNA quencher and fluorescence intensity was measured. The IC50 was determined to be 35 ± 15 μM. The vertical dotted line marks the fitted IC50 of GNF-7 and the horizonal dotted line marks 50% inhibition. (e) Kinetic analysis of AMP and GNF-7 effects on PARN1-430 and a no-enzyme control. Pretreated PARN1-430 was incubated with RNA substrate for 0, 10, 20, and 30 min and the fluorescence intensity were measured at each time point. 2-way ANOVA, multiple comparisons, average ± SD, n = 3 replicates. *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001, n.s. was not indicated.

Full size image
Table 1 List of all the compounds tested as PARN inhibitors with their corresponding properties30,32,33,34.
Full size table

A dose response curve and kinetic analysis demonstrated that GNF-7 inhibits PARN1-430 in a dose-dependent manner (Fig. 5d). The IC50 of GNF-7 on PARN1-430 was determined by non-linear fit to be 35 \(\pm\) 13 μM. This identified GNF-7 as a potential inhibitor of PARN1-430 based on in vitro analyses.

High throughput screening of Enamine kinase library

To identify PARN inhibitors in a high-throughput manner, 24,000 compounds from the Enamine kinase library were tested in a HTS utilizing the fluorescence assay (Fig. 3a). The top 18 compounds with IC50s of less than 10 μM based on testing at different concentrations (Table 1) were then selected for further testing.

To visualize the inhibitory effects of these compounds on PARN, the reactions were run on gels. We showed all compounds could inhibit PARN at 20 μM, except for TH18 (Fig. 6). This result was consistent with the fluorescence assay, suggesting that these compounds can inhibit PARN in vitro.

Figure 6
figure 6

Testing high-throughput screening hits using gel assay. (a) Gels illustrating inhibitory effects of different drugs on PARN1-430. The reaction was performed the same as the fluorescence assay, heat inactivated, then loaded and visualized on gels. Full gels are presented in Supplementary Fig. S1. (b) Dose-response curve of TH11 on PARN1-430. (c) Dose-response curve of TH15 on PARN1-430. (d) Dose-response curve of TH16 on PARN1-430.

Full size image

Examine inhibitory effects of identified compounds on PARN in cells

To test if the compounds identified by docking and HTS affect PARN in cells, we examined the effect of GNF-7, and the compounds from the HTS on RNAs previously known to be affected by PARN activity. Specifically, previous studies showed the levels of telomerase RNA, hTR, and several miRNAs, including miR-21-5p, decreased when PARN is depleted in Hela cells9,11. Therefore, we treated Hela cells with all the compounds (50 µM for GNF-7 and 10 µM for TH1-18) for 2 days and measured the levels of these RNAs using northern blotting and/or RT-qPCR.

We observed that treatment with GNF-7 reduced miR-21-5p levels to ~ 35% compared to the controls when using northern blotting (Fig. 7c and d). Of the compounds from the HTS, TH11, 15, and 16 showed the strongest effects and reduced miR-21-5p levels to ~ 50% compared to the controls (Fig. 7f and g). These effects were similar to a PARN KD, which reduced miR-21-5p levels to ~ 75% compared with siRNA controls. None of the compounds reduced PARN protein levels in Hela cells (Fig. 7a and b). Moreover, RT-qPCR was done to examine the changes in hTR levels of the compounds, which confirmed a decrease in levels of hTR with compounds or siPARN treatments, compared to the controls, (Fig. 7e and h). This suggested that GNF-7, TH11, TH15, and TH16 treatments can inhibit PARN activity in cells and thereby decrease specific RNA levels.

Figure 7
figure 7

GNF-7, TH11, TH15, and TH16 inhibit PARN in cells. (a) Representative western blots showing GNF-7, TH11, TH15, and TH16 treatments do not affect PARN level. Hela cells were treated with siPARN and 50 μM GNF-7 (or 10 μM TH11, TH15, or TH16) (scramble siRNA and DMSO as controls) for 2 days before lysed. The blot was blotted against anti-PARN antibody. (b) Quantification of the changes in PARN levels of western blot using GAPDH as loading controls. siPARN and drug treatments were normalized to scramble siRNA and DMSO controls, respectively. siPARN and drug treatment data were compared to scr and DMSO data, respectively. One-way ANOVA, multiple comparisons test. Average ± SD, N = 3 biological replicates, n = 1. (c) Representative northern blot showing that miR-21-5p levels decreased in both PARN KD and GNF-7 treatment. Hela cells were treated with siPARN and 50 μM GNF-7 (scramble siRNA and DMSO as controls) for 2 days before RNA extraction. (d) Quantification of miR-21-5p levels normalized to U1 RNA. One-way ANOVA, multiple comparisons test, average ± SD, N = 3 biological replicates, n = 1. (e) RT-qPCR showing that hTR levels reduced in siPARN and GNF-7 treatments compared to scr and DMSO controls, respectively. One-way ANOVA, multiple comparisons test, average ± SD, N = 3 biological replicates, n = 2. (f) Representative northern blot showing that miR-21-5p levels decreased in TH11, TH15, and TH16 treatments. Hela cells were treated with 10 μM of TH1-TH18 (DMSO as control) for 2 days before RNA extraction. (g) Quantification of miR-21-5p levels normalized to U1 RNA. One-way ANOVA, multiple comparisons test, average ± SD, N = 3 biological replicates, n = 1. (h) RT-qPCR showing that hTR levels reduced in siPARN and drug treatments compared to scr and DMSO controls, respectively. One-way ANOVA, multiple comparisons test, average ± SD, N = 3 biological replicates, n = 2. For nothern blot and RT-qPCR quantifications, Scr and DMSO controls were independently set to 1 and used as control for siPARN and drug treatments, respectively. *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001, n.s. was not indicated. Full blots are presented in Supplementary Fig. S1.

Full size image

Previous work has shown that PARN inhibition leads to cell death in combination with DNA damaging agent, which has been interpreted to occur through the induction of p5311. Given this, we examined if GNF-7, TH11, TH15, or TH16 affected cell growth either by themselves or in combination with the chemotherapeutic agent, doxorubicin. We observed that at 25 μM GNF-7 and 10 μM of TH11, TH15, and TH16, Hela cells showed growth defects compared to DMSO treatment (Fig. 8a and c). More importantly, we observed that both PARN KD (as previously shown) and cells treated with these compounds showed increased cell death after 24 h of doxorubicin treatment compared to the scramble siRNA and DMSO controls (Fig. 8b and d). This indicates that GNF-7, TH11, TH15, and TH16 increase the sensitivity of cells to the chemotherapeutic agent, possibly through upregulating p53.

Figure 8
figure 8

Cell death assay for GNF-7 treatment. (a) Numbers of cells at 2 days after DMSO and GNF-7 treatment. 2-way ANOVA, multiple comparisons test, average ± SD, N = 3 biological replicates, n = 1. (b) Numbers of cells at 0 and 24 h-post doxorubicin treatment. Hela cells were treated with siPARN or GNF-7 for 2 days (scramble siRNA and DMSO as controls) before adding doxorubicin. Cells were collected for quantification after 0- and 24-h post doxorubicin treatment. 2-way ANOVA, multiple comparisons test, average ± SD, N = 3 biological replicates, n = 1. *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001, n.s. was not indicated. (c) Numbers of cells at 2 days after DMSO and TH1-TH18 treatment. One-way ANOVA, multiple comparisons test, average ± SD, N = 3 biological replicates, n = 1 (d) Numbers of cells at 0 and 24 h-post doxorubicin treatment. Hela cells were treated with siPARN, TH11, TH15, or TH16 for 2 days (scramble siRNA and DMSO as controls) before adding doxorubicin. Cells were collected for quantification after 0- and 24-h post doxorubicin treatment. 2-way ANOVA, multiple comparisons test, average ± SD, N = 3 biological replicates, n = 1. *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001, n.s. was not indicated.

Full size image

Discussion

Herein, we report the identification of PARN inhibitors in vitro and in cells. PARN was purified and its poly(A) trimming activity was shown to be dose-dependent, which can be measured by a simple fluorescence assay (Fig. 3c). This assay is a useful tool for determining PARN enzymatic activity and for possible drug screen. In computational modeling, we identified several compounds predicted to dock with PARN and tested them using in vitro assays (Figs. 4 and 5). Moreover, with HTS, we found multiples PARN inhibitors using the fluorescence assay. These together identified GNF-7, a Bcr-Abl inhibitor, TH11, TH15, and TH16 as compounds that inhibit PARN. GNF-7, TH11, TH15, and TH16 were showed to inhibit PARN in a dose-dependent manner with a IC50 of 35 \(\pm\) 13, 3.36, 2, and 7.9 μM, respectively, which are significantly lower compared to AMP (Fig. 5d, 6b–d)31. We also observed these compounds cause phenotypes consistent with PARN inhibition in cells with a reduction in hTR and miR-21-5p RNA levels similar to PARN KD (Fig. 7c–h).

The discovery and development of a selective and effective PARN inhibitor could be a useful tool for cancer treatment. PARN is a processive deadenylase and PARN KD has been shown to upregulate p53 protein in cancer cells, which causes cell-cycle arrest and prevents cell growth and development11,29. Thus, targeting PARN may offer a potential therapeutic approach for repressed p53-induced cancers. Previous reports have described aminoglycosides, synthetic nucleotides with fluoro-glucopyranosyl sugar moiety and benzoyl-modified cytosine or adenine, glucopyranosyl analogs bearing uracil, 5-fluorouracil, or thymine as base moiety, and purine-2,6-dione derivatives as possible PARN inhibitors (Table 1), although these compounds required relatively high concentrations and/or have not been shown to inhibit PARN activity in cells30,32,33,34. While some purine-2,6-dione derivatives showed PARN inhibition at relatively low concentrations: 30 μM (5b, 8a–d, and 8f), 10 μM (5j and 5k), and 3 μM (8e and 8j) using a similar fluorescence assay, only five IC50 values were reported with the lowest value of 23.9 ± 3.7 μM (compound 8j) (Table 1)34. The IC50 of compound 8j is slightly lower than that of GNF-7, suggesting compound 8j may be a good candidate for PARN inhibitor as well. The remainder of these previously identified PARN inhibitors were either tested with a different substrate (poly(A)) or their IC50s were not determined making a direct comparison between the effectiveness of these inhibitors on the activity of PARN difficult30,32,33,34.

From our assays, we identified the pyrimidopyrimidin-2-one GNF-7, TH11, TH15, and TH16 as PARN inhibitors. All the compounds are kinase inhibitors. GNF-7 is considered a multi-kinase inhibitor, but it is not a broad-spectrum kinase inhibitor42. GNF-7 is a potent inhibitor of Bcr-Abl tyrosine kinase, ACK1 (activated CDC42 kinase 1), and GCK (germinal center kinase) with IC50s of 133 nM, 25 nM, and 8 nM, respectively41,43. This is not unexpected since most kinase inhibitors are ATP mimetics; however, our studies support that GNF-7, TH11, TH15, and TH16 inhibit PARN activity and could be used as lead compounds for structure–activity study to develop PARN inhibitors with improved potency and selectivity.

Several observations argue GNF-7, TH11, TH15, and TH16 can inhibit PARN in cells. First, these drug treatments of cells decreased the levels of hTR and miR-21-5p (Fig. 7c–h), as is seen in PARN- deficient cells9,11,12,17,18. Second, we observed that GNF-7, TH11, TH15, and TH16 acted similarly to siRNA KD of PARN at increasing cell death in the presence of doxorubicin (Fig. 8b and d). Taken together, we propose that GNF-7, TH11, TH15, and TH16 can be used as chemical tools for the inhibition of PARN both in vitro and in cells. However, since these compounds can inhibit a range of kinases, finding additional PARN inhibitors, or developing derivatives of these compounds with more selectivity for PARN is an important future area of future research.

Materials and methods

Computational-based library docking

The SelleckChem kinase inhibitor library (SelleckChem, Cat. No. L1200) consisting of 1,820 compounds was docked into active site of the 2.6 Å human PARN nuclease domain crystal structure (PDB: 2A1R)35, using the Glide module within Schrödinger (Release 2020-3, Schrödinger LLC, New York, NY)44,45,46. Prior to docking, the water molecules were removed, and the proteins were prepared by assigning bond orders, adding hydrogens, and repairing any side chains or missing amino acid sequences. To complete protein preparation a restrained minimization of the protein structure was performed using the default constraint of 0.30 Å RMSD and the OPLS_2005 force field47. The prepared protein was subjected to SiteMap analysis46, that identified the catalytic binding site and docking grids were generated using Receptor Grid Generation. The compounds in the SelleckChem kinase inhibitor library were prepared using LigPrep by generating possible states at the target pH 7.0 using Epik and minimized by applying the OPLS_2005 force field47. Molecular docking simulations were performed using the Glide ligand docking module in XP (extra precision) mode and included post-docking minimization45. The docked structures were examined and high-ranked compounds with favorable XP GScores for ligand binding, that displayed interaction with residues Asp28-Phe31, the divalent metal cation binding site within the active site (Fig. 4), were selected for evaluation. The XP GScore is an empirical scoring function that approximates the ligand binding free energy; therefore, a more negative value represents favorable binding.

High-throughput screening

2 µL of protein (100 nM final concentration) (stock protein was diluted in 1× lysis buffer (HEPES KOH, pH 7.4, 30 mM, KOAc 100 mM, and Mg(OAc)2 2 mM) was added to wells using offline Multidrop Combi nL. The reaction was pre-incubated with 12.5 nL of Sygnature library (Enamine kinase library (HBL-24) (31.25 μM) for 15 min before 2 µL of RNA (10 µM) was added (DMSO was added to control wells using Echo 655). The reaction was incubated at 22 °C for 20 min in Cytomat automatic incubator. After the incubation, the reaction was quenched by adding 4 µL of quencher solution (30 µM of 3′-BHQ labeled quench DNA in 1% SDS) using Multidrop Combi nL. The quenched reaction was incubated at room temperature for 10 min and fluorescence was measured using PHERAstar FSX (λ485/520). For the counter screen, no protein was added to the reaction.

For active potency, dilution series of 10 mM of kinase library compounds (8 points 1:3 dilution, final top concentration was 100 µM) was used to generate IC50 curves. Curves were fitted within Genedata using SmartFit algorithm.

Plasmids and Purification of recombinant PARN

Human PARN ORF was codon-optimized using iDT codon optimizer tool for bacterial expression and the corresponding gene block fragment was purchased from iDT. PcoldI-PARN plasmid with Chloramphenicol resistance containing the full-length human PARN ORF was a kind gift from Professor Yukihide Tomari20. Full-length PARN ORF was cut from the Pcold-PARN plasmid using NdeI-XhoI restriction digest and the native vector was gel purified. PARN 1-430 ORF fragment was PCR amplified from the gene block using the following primers and gel purified.

Fwd primer: TAAGCACATATGATGGAAATCATTCGCTCC

Rev primer: TGCTTACTCGAGTTAAATGTCCATCACACGCA

The purified PCR product was ligated to the PcoldI NdeI-XhoI digest vector using T4 DNA ligase I (NEB M0202S) and correct insertion was verified using Sanger sequencing. PARN D28A F31A double mutant was created by site-directed mutagenesis of the PARN1-430 expressing plasmid using the following primers and mutation insertion was verified using sanger sequencing.

Fwd primer: TTTTTTGCAATTGCAGGGGAGGCTTCCGGTATTTCC

Rev primer: GGAAATACCGGAAGCCTCCCCTGCAATTGCAAAAAA

For recombinant protein purification, the vector was expressed in Rosetta 2 DE at 37 °C overnight with Amp-Camp (50 µg/mL). The starter culture was transferred into 1 L of TB culture and incubated at 37 °C to reach O.D. of 1. The proteins were induced with 1 mM IPTG for 2 days at 15 °C. The proteins were purified using Ni-NTA column and buffer exchanged into storage buffer (30 mM Hepes KOH, pH 7.4, 100 mM KOAc, 2 mM Mg(OAc)2, 30% glycerol, 1 mM TCEP). Proteins were verified on SDS gels and stored at − 80 °C.

siRNAs

siRNAs targeting PARN (siGenome) was purchased from Dharmacon in the Smartpool formulation (M-011348-00-0005). All-stars negative control siRNA from QIAGEN (SI03650318) was used as negative control.

Cell culture

HeLa cells were purchased from ATCC (CCL2) and verified for absence of mycoplasma contamination. HeLa cells were cultured in DMEM containing 10% FBS, 1% Pen/Strep, at 37 °C under ambient conditions.

HeLa cells were seeded ~ 100,000 cells/well in a six-well plate 24 h before transfection/GNF-7 (50 µM) treatment. siRNA transfection was performed using Lipofectamin RNAiMAX (Thermo Fisher Scientific) as per manufacturer’s protocol. 48 h after transfection/drug treatment, cells were collected for either RNA or protein analysis.

RNA extraction and Northern blotting

Total RNA was extracted from cell lysates using TriZol as per manufacturer’s protocol and DNAse treated. After quantification on Nanodrop, total RNA was separated on an acrylamide 7 M Urea gel. RNA was transferred to a nylon membrane (Nytran SPC, GE Healthcare) using semiwet transfer. After UV/EDC crosslinking, the blot was pre-hybridized and hybridized in PerfectHyb Plus Hybridization Buffer (Sigma Aldrich) at 42 °C. Northern probes have been previously described11,48. After hybridization and washing in 2 × SSC 0.1% SDS wash buffer, blots were exposed to a cassette and imaged on a Typhoon FLA 9500 Phosphoimager. Band intensities were quantified using ImageJ and normalized to the U1 levels under each condition.

RT-qPCR

Extracted total RNA was reverse transcribed using Mir-X miRNA first strand synthesis kit (Taraka, Cat # 638315) to make cDNA and qPCR was perfomred with iQ SYBR Green Supermix (BioRad, Cat. No. 1708880) with CGCTGTTTTTCTCGCTGACT (forward primer) and GCTCTAGAATGAACGGTGGAA (reverse primer) for hTR. The RNA levels were normalized using 5S rRNA as a housekeeping gene.

Western blotting

Cells was lysed with 2× lysis buffer (2.5% SDS, 4% BME, protease inhibitor) and was separated on a 4–12% Bis–Tris NuPage gel (ThermoFisher) and transferred to protran membrane (Amer- sham). After blocking in 5% non-fat milk in 1×TBST, blots were probed with anti-PARN (Abcam, ab188333, 1:1000 dilution) overnight at 4 °C and HRP anti-rabbit goat (Cell Signaling Technology, 7074S, 1:1000 dilution) secondary antibody for one hour. Blot was quantified using ImageJ and normalized to GAPDH levels (GAPDH antibody (0411) HRP) (Santa Cruz Biotechnology, sc-47724 HRP).

Inhibition fluorescence assay

1 µL of protein (73 nM as final concentration) (stock protein is diluted in 1× lysis buffer (HEPES KOH, pH 7.4, 30 mM, KOAc 100 mM, and Mg(Oac)2 2 mM) was added to 4 µL of 2.5× reaction buffer (Tris–HCl pH 7.4, 10 mM, KCl 50 mM, MgCl2 5 mM). If drug was added, reaction was pre-incubated with drugs for 10 min before 5 µL of RNA (5 µM as final concentration) was added. The reaction was incubated at 37 °C for 20 min. After the incubation, the reaction was either diluted with 2× loading buffer and heated to 95 °C for 5 min for gel or quenched by adding 10 µL of quencher solution (30 µM of 3′-BHQ labeled quench DNA in 1% SDS). Quenched reaction was incubated at room temperature for 10–60 min and fluorescence was measured using Fluorescein wavelength measurement.

Gels

15% TBE-Urea gel (Thermo Fisher Scientific) was prerun at 20W for 30 min. RNAs from the reaction was loaded into 15% TBE gels and run at 300 V for 35 min. The gel was visualized using iBright (Invitrogen FL1500).

Cell death assay

The same number of Hela cells were seed into 6 well-plates and treated with GNF-7 (SelleckChem, S8140), TH1-18, or transfected for 2 days. Cell counting were done 2 days post-treatment. For doxorubicin (EMD Millipore, 504042) treatment, doxorubicin (1 μM) was added to cells. Cells were collected and counted at 0 h and 24 h after treatment.