A novel PKC activating molecule promotes neuroblast differentiation and delivery of newborn neurons in brain injuries

Domínguez-García, Samuel; Geribaldi-Doldán, Noelia; Gómez-Oliva, Ricardo; Ruiz, Felix A.; Carrascal, Livia; Bolívar, Jorge; Verástegui, Cristina; Garcia-Alloza, Monica; Macías-Sánchez, Antonio J.; Hernández-Galán, Rosario; Nunez-Abades, Pedro; Castro, Carmen

doi:10.1038/s41419-020-2453-9

A novel PKC activating molecule promotes neuroblast differentiation and delivery of newborn neurons in brain injuries

Article
Open access
Published: 22 April 2020

Volume 11, article number 262, (2020)
Cite this article

Download PDF

You have full access to this open access article

Cell Death & Disease

A novel PKC activating molecule promotes neuroblast differentiation and delivery of newborn neurons in brain injuries

Download PDF

Samuel Domínguez-García ORCID: orcid.org/0000-0003-4319-3466^1,2^na1,
Noelia Geribaldi-Doldán^2,3^na1,
Ricardo Gómez-Oliva ORCID: orcid.org/0000-0003-4093-2550^1,2,
Felix A. Ruiz ORCID: orcid.org/0000-0003-0748-5015^2,4,
Livia Carrascal^2,5,
Jorge Bolívar^2,6,
Cristina Verástegui^2,3,
Monica Garcia-Alloza^1,2,
Antonio J. Macías-Sánchez^2,7,
Rosario Hernández-Galán^2,7,
Pedro Nunez-Abades^2,5 &
…
Carmen Castro ORCID: orcid.org/0000-0002-6802-0572^1,2

4320 Accesses
15 Citations
10 Altmetric
Explore all metrics

Abstract

Neural stem cells are activated within neurogenic niches in response to brain injuries. This results in the production of neuroblasts, which unsuccessfully attempt to migrate toward the damaged tissue. Injuries constitute a gliogenic/non-neurogenic niche generated by the presence of anti-neurogenic signals, which impair neuronal differentiation and migration. Kinases of the protein kinase C (PKC) family mediate the release of growth factors that participate in different steps of the neurogenic process, particularly, novel PKC isozymes facilitate the release of the neurogenic growth factor neuregulin. We have demonstrated herein that a plant derived diterpene, (EOF2; CAS number 2230806-06-9), with the capacity to activate PKC facilitates the release of neuregulin 1, and promotes neuroblasts differentiation and survival in cultures of subventricular zone (SVZ) isolated cells in a novel PKC dependent manner. Local infusion of this compound in mechanical cortical injuries induces neuroblast enrichment within the perilesional area, and noninvasive intranasal administration of EOF2 promotes migration of neuroblasts from the SVZ towards the injury, allowing their survival and differentiation into mature neurons, being some of them cholinergic and GABAergic. Our results elucidate the mechanism of EOF2 promoting neurogenesis in injuries and highlight the role of novel PKC isozymes as targets in brain injury regeneration.

Targeting epidermal growth factor receptor to recruit newly generated neuroblasts in cortical brain injuries

Article Open access 30 November 2023

Extracellular vesicles of human glial cells exert neuroprotective effects via brain miRNA modulation in a rat model of traumatic brain injury

Article Open access 21 November 2023

Activation of Neurogenesis in Multipotent Stem Cells Cultured In Vitro and in the Spinal Cord Tissue After Severe Injury by Inhibition of Glycogen Synthase Kinase-3

Article Open access 30 September 2020

Introduction

Brain injuries of different etiologies, produce sensory-motor alterations and irreversible cognitive deficits¹. No effective treatments to compensate neuronal loss have been found so far. However, the discovery of neurogenesis in the adult brain revealing the capacity of the brain to generate new neurons from neural stem cells (NSC) has opened a door to new therapies to effectively treat this type of disorders. Adult neurogenesis occurs under physiological conditions in the dentate gyrus of the hippocampus (DG) and the subventricular zone (SVZ)^2,3. These regions also react to an injury activating NSC to produce neural progenitor cells (NPC), stimulating proliferation and differentiation of NPC into neuroblasts, and altering migration patterns of these neuroblasts to lead them towards the injured area^4,5,6. However, only a very small number of newly born neurons reach the lesion^7,8,9. This is a consequence of the release of inflammatory signals that create a gliogenic/non-neurogenic environment within the injured tissue¹⁰. For example, ligands of the epidermal growth factor receptor (EGFR) in injuries promote gliogenesis and impair migration of neuroblasts towards injuries¹¹. On the contrary, inhibition of EGFR ligand release facilitates neurogenesis in injuries^12,13,14. Transforming growth factor alpha (TGFα), and other EGFR ligands are synthesized as precursor membrane anchored proteins, which are secreted upon the metalloprotease-catalyzed proteolysis of the soluble, active ectodomain. ADAM17 is the main convertase involved in the ectodomain shedding of TGFα and other EGFR ligands^15,16,17. However, ADAM17 also catalyzes the proteolysis of ligands, that activate other receptors of the ErbB family such as neuregulins. The selectivity of this enzyme for each ligand governs ligand release and it is determined by phosphorylation reactions within the cytoplasmic domain of the pro-ligand molecules, catalyzed by kinases of the protein kinase C (PKC) family¹⁸. PKCα activated by phorbol-12-myristate-13-acetate (PMA) catalyzes the phosphorylation of TGFα, amphiregulin and HB-EGF precursors facilitating their ADAM17-mediated shedding. On the contrary, activation of novel PKCδ is required for ADAM17-mediated secretion of neuregulin 1 (NRG1)^18,19. Neuregulin-mediated activation of ErbB4 favors neurogenesis in the adult brain promoting neuroblast survival and organizing migration of neuroblasts from the SVZ towards the olfactory bulb^20,21. Considering these findings, it seems reasonable to hypothesize that specific activation of different PKC isozymes would alter the pattern of growth factor secretion within neurogenic niches, and will regulate either proliferation—mediated by classical PKCβ and α²²—or neuroblast survival and migration—mediated by novel PKC isozymes²³. Consequently, in order to promote neurogenesis in injuries, it would be useful to find molecules with the capacity to activate novel PKC specifically facilitating neuregulins release. Such molecules would probably promote differentiation of NPC into newborn neurons and enable neuroblasts migration from neurogenic areas towards injuries.

Results

The diterpene with lathyrane structure EOF2 activates PKC without promoting proliferation

The lathyrane EOF2 (CAS number 2230806-06-9) was previously described by our group as a diterpene with no effect on NPC proliferation²². Since other diterpenes induced proliferation of NPC²⁴ via classical PKC activation²³, we analyzed its capacity to activate PKC and to facilitate the generation of neurospheres. Although EOF2 treatment increased PKC activity by twofold in neurosphere cultures (supplementary fig. S1 D), it exerted no change in the size of the neurospheres and a reduction in the number of neurospheres generated. Given its capacity to activate PKC without inducing proliferation, it was possible that EOF2 specifically activated novel PKC without affecting the classical isozymes—reported as responsible of the proliferative effect²².

EOF2 facilitates NRG1 release

In order to determine whether EOF2 specifically induced neuregulin release, we used protein constructs in which NRG1 was fused to mCherry in the N-terminal and eGFP in the C-terminal (mCherry-NRG1-eGFP) (Fig. 1A) according to the work of Kamezaki et al. with modifications²⁵. A similar construct was used to test TGFα release (mCherry-TGFα-eGFP) (Fig. 2A). We tested the effect of EOF2 in HEK293T cells transfected with the constructs. As shown in supplementary table T1, HEK293T cells express the mRNAs encoding for PKC isozymes involved in neuregulins and TGFα release as well as ADAM17 protein, validating them as a model to test the release of the above-mentioned growth factors.

**Fig. 1: Real-time imaging of the EOF2 induced ectodomain shedding of Cherry-NRG1-GFP.**

**Fig. 2: Real-time imaging of the EOF2 induced ectodomain shedding of Cherry-TGFα-GFP.**

NRG1 release was measured as explained in M&M section. As shown in Fig. 1 the red/green ratio in HEK293T transfected with mCherry-NRG1-eGFP and treated with vehicle (none) did not vary with time (Fig. 1B, C) (supplementary movie 1), indicating that in the absence of a PKC-stimulating compound this ligand was not released. However, the addition of EOF2 induced a progressive reduction of this ratio (Fig. 1B, C) (supplementary movie 2), suggesting that this compound was facilitating the mCherry-labeled ectodomain shedding of neuregulin. Interestingly, these changes in color ratio were prevented by addition of the general PKC inhibitor Gö6850 to the culture medium (at a final concentration of 1 µM), 30 min before the beginning of the treatment with EOF2 (Fig. 1B, C) (supplementary movie 3). In order to uncertain the role that novel PKC played in this effect, we added the classical PKC inhibitor Gö6976 (at a final concentration of 1 µM), 30 min before the addition of EOF2 to mainly inhibit classical PKC. Results show a reduction in the red/green ratio even in the presence of the inhibitor, indicating that the effect on neuregulin release was mediated by novel PKC activation (Fig. 1A–C) (supplementary movie 4).

Furthermore, we analyzed the levels of mCherry signal in the culture medium of HEK293T cells transfected with the mCherry-NRG1-eGFP construct and treated with EOF2, vehicle, or EOF2 + Gö6850. 30, 60, and 180 min after the treatment cells were separated from the culture medium and mCherry fluorescence was measured in a fraction of 50 µL of medium (total volume of medium 1 mL) as a ratio of the GFP fluorescence remaining inside the cells. The red/green ratio in control cultures (non-treated transfected cells) at all time points was considered as 100% (Fig. 1D dashed line). A time-dependent increase in the red/green fluorescence ratio was observed in the culture medium upon treatment with EOF2. This was not observed in cultures treated with EOF2 + Gö6850 (Fig. 1D).

In order to analyze whether EOF2 specifically facilitated the shedding of NRG1, and had no effect on TGFα, we used the construct mCherry-TGFα-eGFP (Fig. 2A) transfected into HEK293 treated with EOF2. (Fig. 2B, C). Time-lapse imaging experiments showed no reduction in the red/green ratio upon treatment with either vehicle or EOF2 (supplementary movies 5–6), whereas a time dependent reduction was observed with the pan-PKC activator PMA (supplementary movie 7). Likewise, no alteration of the red/green ratio was observed when mCherry was measured in the culture medium of mCherry-TGFα-eGFP transfected cells at different time points (Fig. 2D).

EOF2 facilitates neuronal differentiation of SVZ isolated progenitors in vitro

To elucidate whether EOF2 played a role in neurogenesis, we tested the capacity of this compound to induce neuroblast enrichment in cultures of SVZ-isolated cells under differentiation conditions. Cells were cultured attached onto a substrate in the absence of growth factors and left for 72 h to differentiate in the presence and absence of EOF2. The percentage of neuroblasts (β-III-tubulin⁺) and glial cells (GFAP⁺) was quantified. In control cultures the percentage of GFAP⁺ cells and β-III-tubulin⁺ cells were similar (Fig. 3A–D). Treatment of cultures with EOF2 increased the percentage of β-III-tubulin⁺ cells in almost twofold (Fig. 3A–B), whereas the percentage of GFAP⁺ cells remained unchanged (Fig. 3A–C). In addition, a small reduction in the number of nonviable cells in cultures treated with EOF2 was observed (Fig. 3D), suggesting an additional role for EOF2 in promoting survival.

**Fig. 3: EOF treatment promotes differentiation of NPC to neurons.**

EOF2-induced differentiation of SVZ isolated progenitors in vitro is mediated by novel PKC

We next study the expression patterns of the classical and novel PKC isozymes in cultures of attached SVZ isolated cells. Classical PKCβ and novel PKCθ, were the most abundant followed by classical PKCα and novel PKCε. Almost undetectable levels of classical PKCγ or novel PKCδ and PKCη were observed (Fig. 4A). Therefore, we analyzed whether blocking the expression of the most abundant novel PKCθ reverted the effect of EOF2. Attached SVZ isolated cells were cultured in the absence of growth factors and transfected with a siRNA to interfere with PKCθ expression as previously described²⁶. Cells were left for 72 h in the presence and absence of EOF2 and the percentage of neuroblasts and glial cells was quantified. The elevated percentage of neuroblasts found in the presence of EOF2 was reduced to almost control levels in cultures in which PKCθ expression was inhibited by the siRNA (Fig. 4B, C). EOF2 alone or in combination with PKCθ siRNA had no effect on the percentage of GFAP⁺ cells (Fig. 4B, D).

**Fig. 4: EOF2 induce neuronal differentiation via PKCθ activation without affecting glia formation in NPC cultures.**

NRG1 and ErbB4 expression in brain injuries

In attempt to understand whether this differentiating compound could be used to promote neurogenesis in injuries, we analyzed the expression of neuregulin and its receptor ErbB4 within the perilesional area and in the adjacent SVZ in response to an injury. We performed mechanical cortical injuries in mouse brains and 14 days post injury (dpi) the expression of neuregulin and ErbB4 in the injury and in the ipsilateral SVZ was analyzed by real time qPCR. The expression of NRG1 did not change between the ipsilateral and contralateral side (Supplementary Fig. S2 B) neither within the injury or the SVZ. However, a twofold increase in ErbB4 expression was found in the ipsilateral SVZ (supplementary Fig. S2 A).

Local infusion of EOF2 in brain injuries enhances the number of neuroblasts

We next analyzed whether EOF2 infusion in brain injuries facilitated the generation of neuroblasts and neurons within the perilesional area. Mechanical injuries in the motor cortex of mouse brains were performed and EOF2 was locally infused by implanting osmotic minipumps releasing EOF2 or vehicle for 2 weeks. BrdU was injected on the day of sacrifice (Fig. 5A). Treatment had no effect on the extent of the injury or on the size of the perilesional area, in control and treated groups (inter-animal differences: 30 ± 4 × 10³ µm²/section). The number of BrdU⁺ cells in the perilesional area of mice treated with either vehicle or EOF2 for 14 dpi was similar between the two groups (Fig. 5B, C). Neuroblasts within the peri-lesional area of control mice were hardly visible. Interestingly, the number of neuroblasts increased dramatically in mice treated with EOF2 (Fig. 5B, D–F).

**Fig. 5: Local administration of EOF2 induces neuronal differentiation in the injured cortex.**

Local infusion of EOF2 in brain injuries reduces the number of glial cells

We next analyzed the number of BrdU⁺ cells that expressed the glial marker GFAP in both control and EOF2 treated mice, as well as the area occupied by glial cells as a measure of gliosis and glial scar. Noticeable, the GFAP burden was significantly reduced in injuries treated with EOF2 compared with controls (Fig. 6A–D). Accordingly, the percentage of BrdU⁺ cells that co-localized with the glial cell marker GFAP was also reduced in treated injuries (Fig. 6A–C). This suggested a role for EOF2 in reducing gliosis around the injured area (Fig. 6A, B). No effect of the treatment was observed on the number of nestin⁺ undifferentiated progenitors or in its proliferation rate (Fig. 6B, E, F).

**Fig. 6: Local administration of EOF2 reduce glial differentiation in the injured cortex.**

Local treatment of injuries with EOF2 did not affect neurogenesis in the SVZ or DG

It was then tested whether local treatment with EOF2 affected neurogenesis in the SVZ and DG. We analyzed BrdU⁺, BrdU⁺/DCX⁺ BrdU⁺/GFAP⁺, and BrdU⁺/nestin⁺ cells in both the SVZ and DG. As expected, in response to the injury, the number of BrdU⁺ cells was significantly increased in the ipsilateral SVZ (supplementary fig. S3 A–F) and DG (supplementary fig. S4 A–F) of control and EOF2-treated mice compared with the contralateral areas, indicating the presence of a proliferative response to the injury. However, no effect of EOF2 was observed on the proliferation of progenitor cells and their progeny in the two neurogenic niches (supplementary figs. S3 and S4 A–F).

Intranasal administration of EOF2 facilitates neuroblast migration towards the perilesional area

In order to test whether neuroblast found in EOF2 treated mice had migrated from the adjacent SVZ, we had to find a method of administration that allowed EOF2 to reach neurogenic regions. In addition, used a BrdU labeling approach that allowed BrdU to incorporate in proliferating cells of the SVZ before performing the injury. Thus, healthy mice were injected with BrdU for three consecutive days and left for another 3 days for the BrdU to be cleared. By using this strategy, only proliferating cells in neurogenic niches were labeled with BrdU. Then, mice were injured and treated for 14 days with daily intranasal administrations of EOF2 or vehicle (Fig. 7A). Mice were sacrificed 14 dpi and the co-localization of BrdU with DCX, and GFAP was quantified. Interestingly, BrdU⁺ cells were only detected within the perilesional area of mice treated with EOF2 (Fig. 7B, C). Also, we were able to find a significant amount of DCX⁺ neuroblasts that were not present within the perilesional area of control mice (Fig. 7B, D). BrdU⁺ cells were GFAP⁺ or DCX⁺ (Fig. 7B, E–G). Despite the presence of BrdU⁺/GFAP⁺ cells in treated mice, no effect on the GFAP burden was observed in treated mice compared with control (Fig. 7H). The analysis of BrdU⁺ cells in the SVZ shows a large reduction in the number of BrdU⁺ cells in the ipsilateral SVZ of both control and EOF2 treated mice in comparison with their contralateral SVZ (supplementary fig. S5). Moreover, EOF2 treated mice showed a smaller number of BrdU⁺ cells in the SVZ than their control counterparts (supplementary fig. S5). In addition, we have observed that neuroblasts migrated from the SVZ of EOF2 treated mice towards the injury through organized migratory pathways that described a track from the SVZ towards the injury through the corpus callosum reaching the lesioned area (supplementary fig. S6). This was not observed in control mice.

**Fig. 7: Intranasal administration of EOF2 induce neuroblast migration from the neurogenic regions to the damage area.**

In addition, only EOF2-treated mice showed mature NeuN⁺ neurons that had incorporated BrdU within the perilesional area (Fig. 8A, B–D). Accordingly, a larger number of mature neurons were quantified within the perilesional area of EOF2-treated mice 14 dpi (Fig. 8B, C). We next use a longer treatment (28 days) that allowed neuroblasts to further differentiate maintaining the BrdU labeling protocol. We analyzed the number of BrdU⁺ cells within the perilesional area after a 28-day treatment and assessed their capacity to differentiate into mature neurons of different phenotypes. We found that the number of BrdU⁺ cells 28 dpi was reduced by 50% (supplementary fig. S7 A–C) compared with 14 pdi. Almost 35% of the BrdU⁺ cells co-localized with Choline acetyl transferase (ChAT⁺) (supplementary fig. S7 A, D) and around 5% co-localized with parvalbumin (supplementary fig. S7 B–D) indicating that some of the new neurons had differentiated into cholinergic and GABAergic neurons.

**Fig. 8: Intranasal administration of EOF2 induces neuronal differentiation in the peri-lesional area after brain injury.**

Discussion

We have studied in here the neurogenic effect of a small molecule, the diterpene with lathyrane skeleton EOF2. Unlike other lathyranes, EOF2 does not promote proliferation of NPC²². However, we have demonstrated that it specifically facilitates novel PKC-mediated NRG1 release, without affecting TGFα release. This molecule promotes neuronal differentiation of NPC in vitro in a novel PKC dependent manner. Moreover, EOF2 in vivo enables migration of neuroblasts from neurogenic areas towards an injury leading to neuroblast and neuron enrichment in damaged brain regions.

Targeting neuregulin release to promote neurogenesis in injuries

Previous reports have demonstrated the role of individual PKC isozymes as mediators of different steps in the neurogenic process^27,28, some of them highlighting the role of non-tumor promoting diterpenes as PKC activators that promote neurogenesis in neurogenic niches^22,29. However, neurogenic signaling molecules behave differently depending on the niche. This is the case of TGFα, a growth factor that promotes neurogenesis in neurogenic niches³⁰ while inducing gliogenesis and impairing neuroblast migration in injuries^7,11. Thus, a key step to facilitate neurogenesis in injuries is the introduction of neurogenic cues to counteract the gliogenic ones generated by the injury. In this work, we have focused on neuregulins, which are expressed in neuroblasts, and activate TrkA receptors on neighbor cell types. The pathways associated to these receptors promote neuroblast survival³¹. Also, neuregulin-mediated activation of ErbB4 receptors facilitates NSC proliferation and neuroblast migration^20,21. We searched for a compound able to deliver neuregulins to the injured brain tissue. We chose to study the effect of EOF2 because of its lack of effect on stimulating NPC proliferation in a classical PKC dependent manner²² and its similarity to other classical PKC activating compounds (supplementary fig. 8). According to the report of Newton 2018³², the affinity of novel PKC isozymes for DAG and therefore for this type of compounds is higher than that of classical PKC isozymes suggesting the possibility that EOF2 was a novel PKC activating compound with no capacity to activate the classical.

PKC isozymes participate in the release of ligands that activate ErbB receptors²⁵. These ligands are synthesized and transported to the plasma membrane as transmembrane pro-ligands. The active soluble ligand is proteolyzed from the pro-ligand and released to the extracellular medium in a reaction catalyzed by enzymes of the ADAM family, particularly ADAM17¹⁵. The selectivity of ADAM17 for its substrates depends on phosphorylation reactions on the pro-ligands catalyzed PKC kinases^18,19. Thus, phosphorylation of TGFα, HB-EGF, amphiregulin and other EGFR ligands by classical PKC determines their secretion, whereas, phosphorylation of NRG1 by novel PKC isozymes facilitates its release^18,19,25. We used fusion proteins in which NRG1 and TGFα were fused to two fluorescent probes. Similar fusion proteins had previously been used for this particular purpose²⁵. As time-lapse imaging fluorescence experiments show, EOF2 induces the shedding of NRG1 in HEK293T transfected cells, in a time dependent manner. The release of neuregulin to the extracellular medium was still partially observed in the presence of a classical PKC inhibitor, which at the concentration required to inhibit cPKC by 80%, partially inhibits novel PKC by 30–40%³³. This indicates that the inhibition of classical PKC does not impair NRG1 release and suggests a role for novel PKC isozymes in the EOF2 stimulated NRG1 release. Unfortunately, commercially available specific inhibitors of novel PKC could not be used to definitely demonstrate the role of novel PKC isozymes in EOF2-mediated NRG1 release. EOF2 did not induce TGFα release to the extracellular medium, indicating that EOF2 specifically facilitated NRG1 release. These results agree with previous studies showing that PKC-δ is required for NRG1 cleavage, and that PKC-δ phosphorylation of serine 286 in the neuregulin cytosolic domain is essential for induced neuregulin cleavage¹⁸. Interestingly, other reports show that classical PKC activation is required for PMA-induced cleavage of all EGFR ligands¹⁹.

Novel PKC-mediated differentiation of NPC into neuroblasts

EOF2 promoted neuronal differentiation of NPC in vitro in cultures of SVZ isolated cells. This effect correlated with a reduction in the percentage of nonviable cells, suggesting an effect of EOF2 on neuroblast survival and in neuroblasts differentiation. Considering the role of neuregulins in maintaining neuroblasts survival³¹, it would be possible that EOF2-mediated neuregulin release facilitated neuroblasts survival in our cultures. However, an effect on NPC differentiation towards a neuronal fate is also possible, and a combination of both effects might be the reason for the elevated number of neuroblasts. The effect of EOF2 was reverted by blocking the expression of the most abundant novel PKC isozyme found in our cultures, PKCθ. This result represents another evidence that supports the role of EOF2 in novel PKC activation, and neuronal differentiation probably mediated by neuregulin release.

Enabling neuronal replacement in injuries with EOF2

Previous studies describe a response of neurogenic niches to cortical and spinal cord injuries^{34,35,36,37,38}. Most of these studies show a neurogenic response of the DG and SVZ together with the absence of newly generated neuroblast within the perilesional area in control conditions. Interestingly, inhibiting ADAM17-mediated release of TGFα resulted in a neurogenic response within the perilesional area that produced a large number of new neurons⁸. In agreement with these studies, we show in here that injuries of control mice treated with vehicle showed none or a very small number of neuroblasts. The importance of our work is that we find a considerable number of newborn neurons in injuries of mice treated with EOF2. Previous results have identified neuroblasts migrating from the SVZ towards the site of injury through the corpus callosum. However, in the absence of treatments these neuroblasts never reached the injured site⁸. This indicated that signaling molecules that lead neuroblasts towards the injury, need to be released—as described in Comte et al. 2011, for Galectin-3—to maintain motility from the SVZ to the olfactory bulb³⁹. Since neuregulins play a role in neuroblast migration and survival it was reasonable to test the effect of EOF2 on migration finding an administration method that allowed the continuous administration of the compound avoiding local damage and allowing a more extensive delivery of EOF2, reaching the DG and SVZ. We used intranasal delivery, a method that has been successfully used in previous works^40,41,42. Detection of migrating cells was possible by using a BrdU labeling strategy in which BrdU was administered to the mice 6 days prior to inducing the injury. Using this strategy, we have demonstrated that the presence of the injury induces migration of BrdU⁺ cells from the SVZ but only in mice treated with EOF2 BrdU⁺ cells migrate from the SVZ reaching the injury. Moreover, in treated mice a considerable number of DCX⁺ neuroblasts and NeuN⁺ neurons that co-localize with BrdU were found within the perilesional area 14 dpi indicating that these neuroblasts had migrated from the SVZ. The presence of neuroblasts describing a track from the SVZ through the corpus callosum and cortex and reaching the lesioned area in treated mice supports this fact (supplementary fig. S6). An attempt of neuroblast migration was observed from the SVZ of control mice, however, no neuroblasts were found within the corpus callosum, the cortex or around the perilesional area in these mice. Neuroblasts left the SVZ and reached the corpus callosum without migrating through it towards the injury (supplementary fig. S6). After a longer 28-day treatment with EOF2 around 50% of the BrdU⁺ cells found 14 dpi survived. At this stage, a percentage of the BrdU⁺ cells had differentiated into mature cholinergic neurons and a few of them differentiated into parvalbumin⁺ GABAergic neurons. The rest of BrdU⁺ cells, not labeled with ChAT or parvalbumin, may be neuroblasts, undifferentiated progenitors, glial cells, or they may have developed a different neuronal phenotype. In summary, all this indicates that EOF2 facilitated migration of neuroblasts and that these neuroblasts differentiated into mature neurons. Similar results have been obtained upon reduction of TGFα release by ADAM17 inhibition⁸. Therefore, it is feasible that the capacity of EOF2 to favor neuregulin release over TGFα is promoting neurogenesis in injuries.

Conclusion

In conclusion, we are reporting in here the discovery of EOF2 as a new non-tumorigenic specific activator of novel PKC isozymes, with the capacity to induce neurogenesis in brain injuries. We have unraveled its mechanisms of action mediated by its capacity to activate novel PKC releasing neuregulin. In addition, we have used an effective, noninvasive intranasal administration method of this compound for its effective delivery in the mouse brain promoting neuronal replacement in injuries. Our work highlights the role of novel PKC, as targets and for an effective treatment to compensate neuronal loss in damaged brain areas, being of special relevance in the development of new drugs to use in brain injury regeneration strategies.

Materials and methods

Reagents

The lathyrane EOF2 3,8,12-tri-O-acetyl-7-O-(4-methoxyphenyl) acetylingol; CAS number 2230806–06–9; was isolated and purified in our laboratory, as described previously^43,44. Briefly, purification by semipreparative HPLC was performed with a Hitachi/Merck L-6270 apparatus equipped with a differential refractometer detector (RI-7490). A LiChrospher® Si 60 (10 μm) LiChroCart® (250 mm × 10 mm) column was used in isolation experiments. Silica gel (Merck) was used for column chromatography. TLC was performed on Merck Kieselgel 60 F254, 0.25 mm thick. Infrared spectra were recorded on a FT-IR spectrophotometer and reported as wavenumbers (cm⁻¹). ¹H and ¹³C NMR measurements were obtained on a 400 MHz spectrometer with SiMe₄ as the internal reference. Chemical shifts were referenced to CDCl₃ (δ_H 7.25, δC 77.0), NMR assignments were made by a combination of 1D and 2D techniques. Multiplicities are described using the following abbreviations: s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet, and br = broad. High-Resolution Mass Spectrometry was performed with a QTOF mass spectrometer in positive ion ESI mode.

The commercial PKC activators PMA (13-O-acetyl-12-O-tetradecanoylphorbol, also known as TPA) and prostratin (13-O-acetyl-12-deoxyphorbol) were both purchased from Sigma-Aldrich (St. Louis, MO, USA). The general PKC inhibitor bisindolylmaleimide I (also known as GF109203X, GFX or Gö6850) and the classical PKC inhibitor Gö6976 were from Calbiochem (Millipore, Billerica, MA, USA), and were added to the cells at final concentrations of 5 µM and 1 µM, respectively. Stock solutions of all PKC interacting compounds were prepared in DMSO and pre-diluted in culture medium before addition to cell cultures. When cultures were co-treated with PKC inhibitors and activators, PKC inhibitors were added to the cells 30 min before addition of PKC activators. Specific small interference RNAs (siRNAs) were from Thermo Scientific Dharmacon (Lafayette, CO, www.dharmacon.com).

Other products, unless otherwise indicated, were purchased from Sigma-Aldrich (St. Louis, MO, USA).

Animal subjects

CD1 male mice were used throughout this study. Animals were housed under controlled conditions of temperature (21–23 °C) and light (LD 12:12) with free access to food (AO4 standard maintenance diet, SAFE, Épinay-sur-Orge, France) and water. Care and handling of animals were performed according to the Guidelines of the European Union Council (2010/63/EU), and the Spanish regulations (65/2012 and RD53/2013) for the use of laboratory animals. All studies involving animals are reported in accordance with the ARRIVE guidelines for reporting experiments involving animals^45,46.

Only male mice were used in this work. The total number of animals used was: 24 2-month old adult mice and 150 7-day old pups. The number of animals used in each experiment was determined based on previous studies^22,29,47.

Adult male mice were randomized during the first week after birth by cross fostering and male were used at the age of 2 months.

The protocol used has been authorized by the Ethics Committee of the “Consejería de Agricultura, Pesca y Desarrollo Cultural de la Junta de Andalucía”, Spain with the approval number 30/03/2016/038.

SVZ cell isolation and culture

NPC were isolated from the SVZ of 7-day postnatal (P7) mice following the same procedure described before⁴⁸, and were cultured as described elsewhere⁴⁹. The sacrifice of P7 mice was done by decapitation without anesthesia, and six pups were used for each independent culture. EGF (20 ng/ml, from GIBCO) and bFGF (10 ng/ml; from PeproTech, Frankfurt, Germany) were used for culture expansion, but only bFGF was present in most experimental settings, unless otherwise indicated.

Cloning of human neuregulin and TGFα cDNA fused to GFP and Cherry

Full-length cDNA encoding the membrane-bound isoform of human pro-neuregulin-1 β1-type (NRG1, NCBI reference sequence: NP_039250.2) with mCherry cDNA inserted between nucleotides 93 and 94 of NRG1 open reading frame was cloned into pEGFP-N1 to add EGFP cDNA to the 3′ end. Construct was synthesized by GeneCust (Boynes, France) to generate the mCherry-NRG1-GFP construct. The mCherry-TGFα-GFP construct containing the human transforming growth factor alpha (TGFA, NCBI reference sequence: NM_003236.4), containing mCherry cDNA between nucleotides 126 and 127 of TGFA was built using the same strategy and synthesized by GeneCust (Boynes, France).

HEK293T cultures and transfection

HEK293T cells were obtained from ATCC (Manassas, VA, USA). They were cultured in DMEM at 37 °C and 5% CO2 (Thermo Fisher Scientific, Inc., Rockford, IL, USA), supplemented with fetal bovine serum (10%), 1× GlutaMA^TM-I (Thermo Fisher Scientific, Inc., Rockford, IL, USA) and penicillin/streptomycin (1%). Cells were passaged, seeded, and allowed to attach for 24 h. Lipofectamine 2000 (Invitrogen; Carlsbad, CA, USA) was used for transfection of these plasmids. Afterwards, medium was changed to eliminate Lipofectamine. After an overnight incubation, the cells were starved for at least 30 min in serum-free Fluorobrite DMEM (Thermo Fisher Scientific) containing 1% P/S, 0.25% bovine serum albumin, and 1× GlutaMAX^TM-I. and cells were used either in time-lapse or fluorescence experiments. Control experiments were performed to make sure that the 3.5 h serum starvation did not affect cell viability. The percentages of viable transfected cells in serum starved vs non-starved were 95.12 ± 0.73 vs 94.97 ± 0.5, indicating that serum deprivation for 3.5 h did not exert an effect on cell viability.

Cell viability assays

Cells from neurospheres were seeded at a density of 20000 cells/mL, and cultured in the absence or presence of specific treatments and left for 72 h. Then, cells were detached and mixed with trypan blue [0.04% wt/vol in phosphate-buffered saline (PBS)]. Hek293 cells were seeded at a density of 200000 cells/mL and cultured as indicated in the above section. Then cells were detached from the surface and mixed with trypan blue [0.04% wt/vol in phosphate-buffered saline (PBS)]. Nonviable cells (those including the trypan blue dye) and viable cells (those excluding trypan blue) were counted using a hemocytometer under an inverted microscope and were expressed as percentage of the total number of cells. Samples were coded and blinded quantifications were done in five independent experiments; each of these five independent experiments was performed in triplicate. Experiments were performed and quantified by different persons.

In vitro time-lapse experiments

Transfected HEK293T cells were plated in 35 mm high µ–dishes (Ibidi, Munich, Germany). Cells were treated with EOF2 or inhibitors, as described in the results and figure legends. Time-lapse assays were performed with a Zeiss Axio Observer.Z1-Inverted Microscope, using a plan-apochromat 40× / 0.95 Korr M27 air objective lens. Images of transfected cells were obtained every 1 min. Captured images were processed using ZEN lite software and the efficiency of NRG1 and TGFα cleavage determined by analyzing the mCherry/GFP fluorescence intensity over the entire cell areas. The mCherry/GFP ratios were calculated and normalized to the average ratio measured before stimulation with EOF2 using the Microsoft Excel software. Ratiometric images were built using ImageJ software, after background subtraction, the mCherry/GFP image was calculated dividing mCherry channel by the GFP channel. For each pixel, a pseudocolor scale is used for coding the ratio.

Fluorescence analysis of mCherry-fused TGFα or neuregulin in the culture medium of HEK293T

Transfected HEK293T cells were plated in Costar® 12-well cell culture microplate in 1 mL volume of culture medium. Upon treatment with the EOF2 and/or inhibitors, 50 μL aliquots of culture medium were removed at 30, 60, and 180 min and specific mCherry fluorescence was measured using the culture medium of non-transfected cells as blank. Then, cells were washed with PBS, scratched from the surface of the plates and GFP fluorescence signal of the whole cells for each condition was determined using non-transfected cells as blank. Fluorescence of non-treated transfected cells was used as control. All fluorescence experiments were done using Costar® 96-well black polystyrene plates and a BioTek™ Synergy™ Mx Monochromator-Based MultiMode Reader. Interference fluorescence from the culture media was minimized by the optimization of the detection parameters: mCherry: excitation 587 nm, emission 610 nm; GFP: excitation 488 nm, emission 510 nm. Positive controls of TGFα and NRG1 shedding, after classical PKC activation were done previously using PMA and inhibitors.

PKC kinase activity assay

Neurospheres were disaggregated and 20,000 single cells were seeded per well. Treatments (5 μM EOF2 or vehicle) were added for 1 h prior to cell centrifugation (200 g, 5 min) and lysis. Inhibitors were added 30 min before the addition of the treatments. Protein content was measure in the lysates using the BCA method (Thermo Fisher Scientific, Rockford, IL, USA), and 1.5 μg of crude protein was used per assay. The amount of PKC kinase activity was measured in each sample using the PKC Kinase Activity Assay Kit (Abcam, Cambridge, U.K.; cat. No. ab139437), following the manufacturer’s instructions. Positive controls (20–60 ng of purified active PKC supplied by the kit) and blanks (diluent only) were included in each independent determination. Blanks were subtracted from measurements before comparisons were made.

Cell culture adhesion, treatment, and transfection

Neurosphere cells were centrifuged, resuspended in defined medium with growth factors, and seeded. Cell transfection with specific siRNAs was performed 18 h after seeding; for this, cells were changed to antibiotic-free medium and transfected using Lipofectamine 2000, following the manufacturer’s instructions. Lipofectamine was removed 6 h later, EOF2 was added and cells were maintained for 48 additional hours before being fixed for immunocytochemistry.

Immunocytochemistry

Immunostaining for GFAP and β-III-tubulin was performed as previously described²⁹. The primary antibodies used for this were: mouse monoclonal anti-βIII-tubulin (1:1000, Cell Signaling Technology, Boston, MA, USA) and rabbit polyclonal anti-GFAP (1:3000, Dako, Hamburg, Germany). The secondary antibodies used were: donkey anti-rabbit IgG labeled with AlexaFluor® 488 (1:1000) and donkey anti-mouse IgG labeled with AlexaFluor® 594 (1:1000), from Invitrogen (Carlsbad, CA, USA). Samples were coded before immunostaining and blinded quantifications of labeled cells were done in nine independent experiments. Experiments were performed and quantified by different individuals to avoid subjective bias during the quantification process. Original fluorescence colors have been changed in some of the pictures shown, using the ImageJ software, to enhance visualization of markers.

RNA isolation, reverse transcription and real-time quantitative PCR

Total RNA isolation from differentiated cells, the injured and the intact cortex, reverse transcription and RT-qPCR to relatively quantify the expression of the different isozymes of PKC were performed as previously described⁷. The housekeeping transcript used was 18S rRNA. All PCR reaction within each experiment was run in duplicates. Amplification specificity was confirmed by melting-curve analysis of the PCR products. The relative expression of each mRNA was calculated as 2^−ΔCt, where ΔCt = Ct (target mRNA)−Ct (18S). No signal was detected in non-template or non-RT controls.

Primer sequences (5´-3´) and annealing temperatures were the following: for detecting expression of mouse mRNA levels in neuroespheres we used the following primers: PKCα, FW: TGAATCCTCAGTGGAATGAGT, RW: GGTTGCTTTCTGTCTTCTGAA, 55 °C; for PKCβ, FW:CCCGAAGGAAGCGAGGGCAATGAAG, RW:AGTTCATCTGTACCCTTCCGCTCTG, 63 °C; for PKCγ, FW:TGAGAGAGTGCGGATGGGCCCC, RW:GCAGGCGTCCTGGGCTGGCACC, 65 °C; for PKCδ, FW:GAGGCCTTGAACCAAGTGACCC, RW:CTTGCCATAGGTCCAGTTGTTG, 57 °C; for PKCε, FW:CCCATCTGAAGACGACCGATCC, RW:CGGTTGTCAAATGACAAGGCC, 60 °C; for PKCθ, FW:CCATGTCACCGTTTCTTCGAATC, RW:TCTGCCCATTTTCTGATTCC, 56 °C; for PKCη, FW:ATGGCCACGTACCTGAGGCAGC, RW:GGACGACGCAGGTGCACACTTGG, 65 °C; for PKCλ, FW:CGTTGGGAGCTCTGACAATC, RW:ACCTGCTTTTGCTCCATCATG, 55 °C; for PKCζ, FW:AGGAGAAGAGTACGGGTTCAGC, RW:GTGTTCATGTCAGGGTTGTCCG, 57 °C.

For mouse neuregulin and ErbB4 in injuries and SVZ we used NRG1, FW: CGCTGTTCTGGTCTCATCCG, RW: GCGGTGGAGTGGAGTGTAAG, 54 °C; for ErbB4, FW: TACCTCCTCCCATCTACACATCC, RW: CCTCTGGTATGGTGCTGGTTG, 57 °C.

The primers used for detection of human PKC isozyme mRNAs from HEK293 are described supplementary table T1.

Mechanical lesions in brain cortex

Unilateral cortical lesions were performed in the cortex of the right hemisphere of adult mice anesthetized with an intraperitoneal injection of a 100 mg/kg ketamine and 20 mg/kg xylazine cocktail. Animals were placed in a stereotaxic frame (Kopf Instruments), and a small craniotomy was performed at +1.4 mm rostral and +1.5 mm lateral to Bregma. A controlled mechanical lesion was performed in the underlying primary motor cortex, using a manually driven drill (0.7 mm diameter) that was allowed to penetrate 1 mm below the bone surface. These injuries reached the corpus callosum without damaging it.

Studies describing neurogenic responses in mechanical lesions

Mice were injured using the procedure mentioned above, and were sacrificed at 14 days post-injury (dpi). Mice were given three intraperitoneal injections of BrdU (70 mg/kg each) separated by 3 h intervals on the day of sacrifice. Mice were sacrificed by brain perfusion, and brains were processed for post-mortem studies as described below. In the same surgical acts in which cortical lesions were performed, Alzet osmotic mini-pumps (Charles Rivers Barcelona, Spain) were implanted subcutaneously in 12 animals and connected to infusion cannulas (brain kit II, Alzet) whose tips were placed 0.5 mm deep into the lesion, allowing a continuous delivery of a 5 µM solution of EOF2 in PBS (containing 0.4% DMSO) or vehicle (six mice received EOF2 and six mice received vehicle). Treatments lasted for 14 days.

Studies describing migration towards mechanical lesions

In a different set of experiments, aimed to study the migration of progenitors from neurogenic regions towards the injured area, mice received BrdU injections 6, 5, and 4 days before the injury was performed. This paradigm allowed for substantial clearance of BrdU and, therefore, it allowed BrdU labeling of NPC in the SVZ but not locally in the injured tissue. These mice (vehicle; n = 6 and EOF2-treated; n = 6) were sacrificed on day 14 after injury. Starting the day of injury, animals were treated with daily intranasal administrations of a 5 µM solution of EOF2 or vehicle, until they were sacrificed 14 dpi (Figs. 7, 8).

Intranasal administration of EOF2

EOF2, was delivered intranasally as previously described^40,41,42. Treatments were administered manually while the animal was placed in a standing position with an extended neck as previously described⁴². 18 µL of each solution 5 µM EOF2, or vehicle was delivered over both nasal cavities alternating 3 µL/each using a micropipette. Mouse was maintained in such position for ten additional seconds to ensure all fluid was inhaled.

In all experiments, mice were coded, treatment (vehicle or EOF2) was assigned randomly to code numbers and applied. In addition, blind quantifications were performed to avoid subjective biases.

Immunohistochemistry

Brain processing and immunohistochemical detection of the proliferation marker BrdU, the astrocyte and neural stem cell marker GFAP, the neural progenitor cell marker nestin, the early neuronal differentiation marker doublecortin (DCX), and the mature neuron maker NeuN were performed as previously described⁴⁹.

Primary antibodies used were mouse monoclonal anti-BrdU (1:100) from Dako (Hamburg, Germany) or rat monoclonal anti-BrdU (1:100) from Abcam (Cambridge, UK), mouse polyclonal anti-GFAP both from Cell Signaling (Beverly, MA, USA), goat polyclonal anti-DCX (1:500), goat polyclonal anti-nestin (1:500), and mouse monoclonal anti-NeuN (1:100) all of them from Abcam (Cambridge, UK); goat anti-ChAT, polyclonal, 1:100, Merk Millipore (Billerica, MA, USA) mouse anti-parvalbumin, monoclonal, 1:100, Merk Millipore (Billerica, Ma, USA). Secondary antibodies used were Alexa Fluor 488 donkey anti-mouse, Alexa Fluor 594 donkey anti-mouse, Alexa Fluor 405 goat anti-mouse, Alexa Fluor 594 donkey anti-rat, Alexa Fluor 488 donkey anti-rabbit, Alexa Fluor 594 donkey anti-rabbit and Alexa Fluor 594 donkey anti-goat (all at 1:1000, from Life Tech).

Quantification of neurogenesis in brain sections

SVZ cells positive for BrdU, DCX, GFAP, NeuN, and nestin were estimated as previously described^29,49. Positive cells were counted throughout the entire perilesional area or lateral and laterodorsal walls of the lateral ventricles (where the SVZ NPC are located) in every fifth section; 14–16 sections per brain where analyzed under fluorescence microscopy at ×20 magnification. A confocal microscope (OLYMPUS FV1000) was used to take images from triple-labeled brain sections. Mice were coded depending on the treatment and quantification of cells in brain slices was done in blinded analysis.

Statistical analysis

The data and statistical analysis comply with the recommendations on experimental design and analysis in pharmacology⁵⁰. Statistical analysis was performed using the computer program IBM SPSS Statistics 22. Normal distribution of the data was first analyzed using a Shapiro–Wilks test. Then, a Brown Forsythe test was performed to test the equality of variances. Afterwards, when more than one treatment group were compared, statistical analyses were performed using one-way ANOVA followed by a post-hoc Bonferroni’s test unless otherwise indicated. A Student’s t test was used when only one treatment group was compared with the control. Differences were considered significant at values of p < 0.05. In general, sample size used in statistical analysis were n = 6 for in vivo experiments and n = 5–9 for in vitro experiments. Sample sizes were chosen based on a previous works related to this one^8,22,29,47.

References

Blennow, K., Hardy, J. & Zetterberg, H. The neuropathology and neurobiology of traumatic brain injury. Neuron 76, 886–899 (2012).
Article CAS PubMed Google Scholar
Gage, F. H. et al. Survival and differentiation of adult neuronal progenitor cells transplanted to the adult brain. Proc. Natl Acad. Sci. USA 92, 11879–11883 (1995).
Article CAS PubMed Google Scholar
Doetsch, F., Garcia-Verdugo, J. M. & Alvarez-Buylla, A. Cellular composition and three-dimensional organization of the subventricular germinal zone in the adult mammalian brain. J. Neurosci. 17, 5046–5061 (1997).
Article CAS PubMed PubMed Central Google Scholar
Jin, K. et al. Neurogenesis in dentate subgranular zone and rostral subventricular zone after focal cerebral ischemia in the rat. Proc. Natl Acad. Sci. USA 98, 4710–4715 (2001).
Article CAS PubMed Google Scholar
Liu, J., Solway, K., Messing, R. O. & Sharp, F. R. Increased neurogenesis in the dentate gyrus after transient global ischemia in gerbils. J. Neurosci. 18, 7768–7778 (1998).
Article CAS PubMed PubMed Central Google Scholar
Fallon, J. et al. In vivo induction of massive proliferation, directed migration, and differentiation of neural cells in the adult mammalian brain. Proc. Natl Acad. Sci. USA 97, 14686–14691 (2000).
Article CAS PubMed Google Scholar
Romero-Grimaldi, C. et al. ADAM-17/tumor necrosis factor-alpha-converting enzyme inhibits neurogenesis and promotes gliogenesis from neural stem cells. Stem Cells 29, 1628–1639 (2011).
Article CAS PubMed Google Scholar
Geribaldi-Doldan, N. et al. Specific inhibition of ADAM17/TACE promotes neurogenesis in the injured motor cortex. Cell Death Dis. 9, 862 (2018).
Article PubMed PubMed Central CAS Google Scholar
Susarla, B. T., Villapol, S., Yi, J. H., Geller, H. M. & Symes, A. J. Temporal patterns of cortical proliferation of glial cell populations after traumatic brain injury in mice. ASN Neuro. 6, 159–170 (2014).
Article PubMed CAS Google Scholar
Buffo, A. et al. Origin and progeny of reactive gliosis: a source of multipotent cells in the injured brain. Proc. Natl Acad. Sci. USA 105, 3581–3586 (2008).
Article CAS PubMed Google Scholar
Kim, Y., Comte, I., Szabo, G., Hockberger, P. & Szele, F. G. Adult mouse subventricular zone stem and progenitor cells are sessile and epidermal growth factor receptor negatively regulates neuroblast migration. PLoS ONE 4, e8122 (2009).
Article PubMed PubMed Central CAS Google Scholar
Kuhn, H. G., Winkler, J., Kempermann, G., Thal, L. J. & Gage, F. H. Epidermal growth factor and fibroblast growth factor-2 have different effects on neural progenitors in the adult rat brain. J. Neurosci. 17, 5820–5829 (1997).
Article CAS PubMed PubMed Central Google Scholar
Gonzalez-Perez, O., Romero-Rodriguez, R., Soriano-Navarro, M., Garcia-Verdugo, J. M. & Alvarez-Buylla, A. Epidermal growth factor induces the progeny of subventricular zone type B cells to migrate and differentiate into oligodendrocytes. Stem Cells 27, 2032–2043 (2009).
Article CAS PubMed PubMed Central Google Scholar
Dominguez-Garcia, S., Castro, C. & Geribaldi-Doldan, N. ADAM17/TACE: a key molecule in brain injury regeneration. Neural Regen. Res. 14, 1378–1379 (2019).
Article PubMed PubMed Central Google Scholar
Blobel, C. P. ADAMs: key components in EGFR signalling and development. Nat. Rev. 6, 32–43 (2005).
Article CAS Google Scholar
Lee, D. C. et al. TACE/ADAM17 processing of EGFR ligands indicates a role as a physiological convertase. Ann. N. Y. Acad. Sci. 995, 22–38 (2003).
Article CAS PubMed Google Scholar
Sunnarborg, S. W. et al. Tumor necrosis factor-alpha converting enzyme (TACE) regulates epidermal growth factor receptor ligand availability. J. Biol. Chem. 277, 12838–12845 (2002).
Article CAS PubMed Google Scholar
Dang, M. et al. Regulated ADAM17-dependent EGF family ligand release by substrate-selecting signaling pathways. Proc. Natl Acad. Sci. USA 110, 9776–9781 (2013).
Article CAS PubMed Google Scholar
Dang, M. et al. Epidermal growth factor (EGF) ligand release by substrate-specific a disintegrin and metalloproteases (ADAMs) involves different protein kinase C (PKC) isoenzymes depending on the stimulus. J. Biol. Chem. 286, 17704–17713 (2011).
Article CAS PubMed PubMed Central Google Scholar
Anton, E. S. et al. Receptor tyrosine kinase ErbB4 modulates neuroblast migration and placement in the adult forebrain. Nat. Neurosci. 7, 1319–1328 (2004).
Article CAS PubMed Google Scholar
Ghashghaei, H. T. et al. The role of neuregulin-ErbB4 interactions on the proliferation and organization of cells in the subventricular zone. Proc. Natl Acad. Sci. USA 103, 1930–1935 (2006).
Article CAS PubMed Google Scholar
Murillo-Carretero, M. et al. ELAC (3,12-di-O-acetyl-8-O-tigloilingol), a plant-derived lathyrane diterpene, induces subventricular zone neural progenitor cell proliferation through PKCbeta activation. Br. J. Pharm. 174, 2373–2392 (2017).
Article CAS Google Scholar
Geribaldi-Doldan, N., Gomez-Oliva, R., Dominguez-Garcia, S., Nunez-Abades, P. & Castro, C. Protein Kinase C: targets to regenerate brain injuries? Front. Cell Dev. Biol. 7, 39 (2019).
Article PubMed PubMed Central Google Scholar
Flores-Giubi, E. et al. Lathyrane, premyrsinane, and related diterpenes from euphorbia boetica: effect on in vitro neural progenitor cell proliferation. J. Nat. Prod. 82, 2517–2528 (2019).
Article CAS PubMed Google Scholar
Kamezaki, A. et al. Visualization of Neuregulin 1 ectodomain shedding reveals its local processing in vitro and in vivo. Sci. Rep. 6, 28873 (2016).
Article CAS PubMed PubMed Central Google Scholar
Garcia-Bernal, F. et al. Protein Kinase C inhibition mediates neuroblast enrichment in mechanical brain injuries. Front. Cell Neurosci. 12, 462 (2018).
Article CAS PubMed PubMed Central Google Scholar
Wang, J. et al. Metformin activates an atypical PKC-CBP pathway to promote neurogenesis and enhance spatial memory formation. Cell Stem Cell 11, 23–35 (2012).
Article CAS PubMed Google Scholar
Fatt, M. et al. Metformin acts on two different molecular pathways to enhance adult neural precursor proliferation/self-renewal and differentiation. Stem Cell Rep. 5, 988–995 (2015).
Article CAS Google Scholar
Rabaneda, L. G. et al. Altered regulation of the Spry2/Dyrk1A/PP2A triad by homocysteine impairs neural progenitor cell proliferation. Biochim Biophys. Acta 1863, 3015–3026 (2016).
Article CAS PubMed Google Scholar
Tropepe, V., Craig, C. G., Morshead, C. M. & van der Kooy, D. Transforming growth factor-alpha null and senescent mice show decreased neural progenitor cell proliferation in the forebrain subependyma. J. Neurosci. 17, 7850–7859 (1997).
Article CAS PubMed PubMed Central Google Scholar
Verdi, J. M. et al. A reciprocal cell-cell interaction mediated by NT-3 and neuregulins controls the early survival and development of sympathetic neuroblasts. Neuron 16, 515–527 (1996).
Article CAS PubMed PubMed Central Google Scholar
Newton, A. C. Protein kinase C: perfectly balanced. Crit. Rev. Biochem. Mol. Biol. 53, 208–230 (2018).
Article CAS PubMed PubMed Central Google Scholar
Wu-Zhang, A. X. & Newton, A. C. Protein kinase C pharmacology: refining the toolbox. Biochem. J. 452, 195–209 (2013).
Article CAS PubMed PubMed Central Google Scholar
Cavanagh, J. B. The proliferation of astrocytes around a needle wound in the rat brain. J. Anat. 106, 471–487 (1970).
CAS PubMed PubMed Central Google Scholar
Adrian, E. K. Jr. & Walker, B. E. Incorporation of thymidine-H3 by cells in normal and injured mouse spinal cord. J. Neuropathol. Exp. Neurol. 21, 597–609 (1962).
Article PubMed Google Scholar
Chirumamilla, S., Sun, D., Bullock, M. R. & Colello, R. J. Traumatic brain injury induced cell proliferation in the adult mammalian central nervous system. J. Neurotrauma 19, 693–703 (2002).
Article CAS PubMed Google Scholar
Dash, P. K., Mach, S. A. & Moore, A. N. Enhanced neurogenesis in the rodent hippocampus following traumatic brain injury. J. Neurosci. Res. 63, 313–319 (2001).
Article CAS PubMed Google Scholar
Rice, A. C. et al. Proliferation and neuronal differentiation of mitotically active cells following traumatic brain injury. Exp. Neurol. 183, 406–417 (2003).
Article CAS PubMed Google Scholar
Comte, I. et al. Galectin-3 maintains cell motility from the subventricular zone to the olfactory bulb. J. Cell Sci. 124, 2438–2447 (2011).
Article CAS PubMed PubMed Central Google Scholar
Thorne, R. G., Pronk, G. J., Padmanabhan, V. & Frey, W. H. 2nd Delivery of insulin-like growth factor-I to the rat brain and spinal cord along olfactory and trigeminal pathways following intranasal administration. Neuroscience 127, 481–496 (2004).
Article CAS PubMed Google Scholar
Francis, G. J. et al. Intranasal insulin prevents cognitive decline, cerebral atrophy and white matter changes in murine type I diabetic encephalopathy. Brain 131, 3311–3334 (2008).
Article PubMed Google Scholar
Marks, D. R., Tucker, K., Cavallin, M. A., Mast, T. G. & Fadool, D. A. Awake intranasal insulin delivery modifies protein complexes and alters memory, anxiety, and olfactory behaviors. J. Neurosci. 29, 6734–6751 (2009).
Article CAS PubMed PubMed Central Google Scholar
Zhao, N. D. et al. Identification of ingol and rhamnofolane diterpenoids from euphorbia resinifera and their abilities to induce lysosomal biosynthesis. J. Nat. Prod. 81, 1209–1218 (2018).
Article CAS PubMed Google Scholar
Avila, L. et al. Effects of diterpenes from latex of Euphorbia lactea and Euphorbia laurifolia on human immunodeficiency virus type 1 reactivation. Phytochemistry 71, 243–248 (2010).
Article CAS PubMed Google Scholar
McGrath, J. C., Drummond, G. B., McLachlan, E. M., Kilkenny, C. & Wainwright, C. L. Guidelines for reporting experiments involving animals: the ARRIVE guidelines. Br. J. Pharm. 160, 1573–1576 (2010).
Article CAS Google Scholar
Kilkenny, C. et al. Animal research: reporting in vivo experiments: the ARRIVE guidelines. Br. J. Pharm. 160, 1577–1579 (2010).
Article CAS Google Scholar
Carrasco, M. et al. Glycine N-methyltransferase expression in the hippocampus and its role in neurogenesis and cognitive performance. Hippocampus 24, 840–852 (2014).
Article CAS PubMed PubMed Central Google Scholar
Torroglosa, A. et al. Nitric oxide decreases subventricular zone stem cell proliferation by inhibition of epidermal growth factor receptor and phosphoinositide-3-kinase/Akt pathway. Stem Cells 25, 88–97 (2007).
Article CAS PubMed Google Scholar
Rabaneda, L. G. et al. Homocysteine inhibits proliferation of neuronal precursors in the mouse adult brain by impairing the basic fibroblast growth factor signaling cascade and reducing extracellular regulated kinase 1/2-dependent cyclin E expression. FASEB J. 22, 3823–3835 (2008).
Article CAS PubMed Google Scholar
Curtis, M. J. & Abernethy, D. R. Revision of instructions to authors for pharmacology research and perspectives: enhancing the quality and transparency of published work. Pharmacol. Res. Perspect. 3, https://doi.org/10.1002/prp2.106 (2015).

Download references

Acknowledgements

We dedicate this paper to our late colleague and friend, Dr. Maribel Murillo-Carretero, whose dedication and critical advice was very valuable to this work. This work was supported by the Spanish Ministerio de Ciencia, Innovación y Universidades (Grant Numbers RTI2018–099908-B-C21, and RTI2018–099908-B-C21 MICINN/FEDER granted to CC and RHG respectively and BFU2016–75038R granted to MGA) and Consejería de Economía, Conocimiento, Empresas y Universidades Junta de Andalucía (grant number FEDER-ANDALUCÍA sol-2018–00106647-tra). We thank Antonio Torres for his technical assistance. We thank the Servicio de experimentación y producción animal (SEPA) de la Universidad de Cádiz as well as the Servicios Centrales de apoyo a la investigación en Ciencias de la Salud (SCICS) and Servicios centrales de Ciencia y tecnología (SC-ICYT) de la Universidad de Cádiz. We appreciate the assistance provided by Juan Luis Ribas and Modesto Carballo of the Servicio de Microscopia y Biología, respectively, of the Centro de Investigación, Tecnología e Innovación de la Universidad de Sevilla (CITIUS).

Author information

These authors contributed equally: Samuel Domínguez-García, Noelia Geribaldi-Doldán

Authors and Affiliations

Área de Fisiología, Facultad de Medicina, Universidad de Cádiz, Cádiz, Spain
Samuel Domínguez-García, Ricardo Gómez-Oliva, Monica Garcia-Alloza & Carmen Castro
Instituto de Investigación e Innovación Biomédica de Cádiz (INiBICA), Cádiz, Spain
Samuel Domínguez-García, Noelia Geribaldi-Doldán, Ricardo Gómez-Oliva, Felix A. Ruiz, Livia Carrascal, Jorge Bolívar, Cristina Verástegui, Monica Garcia-Alloza, Antonio J. Macías-Sánchez, Rosario Hernández-Galán, Pedro Nunez-Abades & Carmen Castro
Departamento de Anatomía y Embriología Humanas, Facultad de Medicina, Universidad de Cádiz, Cádiz, Spain
Noelia Geribaldi-Doldán & Cristina Verástegui
Área de Nutrición, Facultad de Medicina Universidad de Cádiz, Cádiz, Spain
Felix A. Ruiz
Departamento de Fisiología, Facultad de Farmacia, Universidad de Sevilla, Sevilla, Spain
Livia Carrascal & Pedro Nunez-Abades
Área de Bioquímica, Facultad de Ciencias, Universidad de Cádiz, Puerto Real, Spain
Jorge Bolívar
Departamento de Química Orgánica, Facultad de Ciencias, Universidad de Cádiz, Puerto Real, Spain
Antonio J. Macías-Sánchez & Rosario Hernández-Galán

Authors

Samuel Domínguez-García
View author publications
You can also search for this author in PubMed Google Scholar
Noelia Geribaldi-Doldán
View author publications
You can also search for this author in PubMed Google Scholar
Ricardo Gómez-Oliva
View author publications
You can also search for this author in PubMed Google Scholar
Felix A. Ruiz
View author publications
You can also search for this author in PubMed Google Scholar
Livia Carrascal
View author publications
You can also search for this author in PubMed Google Scholar
Jorge Bolívar
View author publications
You can also search for this author in PubMed Google Scholar
Cristina Verástegui
View author publications
You can also search for this author in PubMed Google Scholar
Monica Garcia-Alloza
View author publications
You can also search for this author in PubMed Google Scholar
Antonio J. Macías-Sánchez
View author publications
You can also search for this author in PubMed Google Scholar
Rosario Hernández-Galán
View author publications
You can also search for this author in PubMed Google Scholar
Pedro Nunez-Abades
View author publications
You can also search for this author in PubMed Google Scholar
Carmen Castro
View author publications
You can also search for this author in PubMed Google Scholar

Corresponding authors

Correspondence to Pedro Nunez-Abades or Carmen Castro.

Ethics declarations

Conflict of interest

The authors declare that they have no conflict of interest.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Edited by M. Agostini

Supplementary information

Supplementary Figure legends

Supplementary Figure S1

Supplementary Figure S2

Supplementary Figure S3

Supplementary Figure S4

Supplementary Figure S5

Supplmentary Figure S6

Supplementary Figure S7

Supplementary Figure S8

Supplementary table T1

Supplementary movie 1

Supplementary movie 2

Supplementary movie 3

Supplementary movie 4

Supplementary movie 5

Supplementary movie 6

Supplementary movie 7

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Domínguez-García, S., Geribaldi-Doldán, N., Gómez-Oliva, R. et al. A novel PKC activating molecule promotes neuroblast differentiation and delivery of newborn neurons in brain injuries. Cell Death Dis 11, 262 (2020). https://doi.org/10.1038/s41419-020-2453-9

Download citation

Received: 02 September 2019
Revised: 02 April 2020
Accepted: 03 April 2020
Published: 22 April 2020
DOI: https://doi.org/10.1038/s41419-020-2453-9
Springer Nature Limited

This article is cited by

Targeting epidermal growth factor receptor to recruit newly generated neuroblasts in cortical brain injuries
- Ricardo Gómez-Oliva
- Noelia Geribaldi-Doldán
- Carmen Castro
Journal of Translational Medicine (2023)
Advances in intranasal application of stem cells in the treatment of central nervous system diseases
- Yu-Ting Zhang
- Kai-Jie He
- Chun-Feng Liu
Stem Cell Research & Therapy (2021)

A novel PKC activating molecule promotes neuroblast differentiation and delivery of newborn neurons in brain injuries

Abstract

Similar content being viewed by others

Introduction

Results

The diterpene with lathyrane structure EOF2 activates PKC without promoting proliferation

EOF2 facilitates NRG1 release

EOF2 facilitates neuronal differentiation of SVZ isolated progenitors in vitro

EOF2-induced differentiation of SVZ isolated progenitors in vitro is mediated by novel PKC

NRG1 and ErbB4 expression in brain injuries

Local infusion of EOF2 in brain injuries enhances the number of neuroblasts

Local infusion of EOF2 in brain injuries reduces the number of glial cells

Local treatment of injuries with EOF2 did not affect neurogenesis in the SVZ or DG

Intranasal administration of EOF2 facilitates neuroblast migration towards the perilesional area

Discussion

Targeting neuregulin release to promote neurogenesis in injuries

Novel PKC-mediated differentiation of NPC into neuroblasts

Enabling neuronal replacement in injuries with EOF2

Conclusion

Materials and methods

Reagents

Animal subjects

SVZ cell isolation and culture

Cloning of human neuregulin and TGFα cDNA fused to GFP and Cherry

HEK293T cultures and transfection

Cell viability assays

In vitro time-lapse experiments

Fluorescence analysis of mCherry-fused TGFα or neuregulin in the culture medium of HEK293T

PKC kinase activity assay

Cell culture adhesion, treatment, and transfection

Immunocytochemistry

RNA isolation, reverse transcription and real-time quantitative PCR

Mechanical lesions in brain cortex

Studies describing neurogenic responses in mechanical lesions

Studies describing migration towards mechanical lesions

Intranasal administration of EOF2

Immunohistochemistry

Quantification of neurogenesis in brain sections

Statistical analysis

References

Acknowledgements

Author information

Authors and Affiliations

Corresponding authors

Ethics declarations

Conflict of interest

Additional information

Supplementary information

Rights and permissions

About this article

Cite this article

Share this article

This article is cited by

Search

Navigation