1 Introduction

The wildlife trade is a key factor in biodiversity reduction. The unregulated or underregulated wildlife trade can facilitate the unsustainable exploitation of wild populations worldwide [1]. The Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) reported 90,513 seizures globally from 2016 to 2020. In addition, the report highlighted that reptiles had the third-highest number of seizures (i.e., 18%; 16,206 records) [2]. The United Nations Office on Drugs and Crime-2020 report emphasized that reptile species are primarily traded for decoration, fashion, food, tonics, medicine, pet trade, and breeding [3]. The International Union for Conservation of Nature (IUCN) has assessed reptile species and found that 32 species are extinct (EX), 2 species are extinct in the wild (EW), 430 species are critically endangered (CR), and 625 species are vulnerable (VU) [4].

In India, studies  reported that, there are four species of monitor lizards found, namely the Bengal monitor lizard, the Water monitor lizard (Varanus salvator), the Yellow monitor lizard (Varanus flavescens), and the Desert monitor lizard (Varanus griseus) Of these, the Bengal monitor lizard is found all over India; the Desert monitor lizard can be found in Rajasthan and Punjab; the Yellow monitor lizard is found in Uttar Pradesh and Bihar, and the Water monitor lizard is found in Orissa, Bengal, and eastern India [5, 6]. The trading of monitor lizard species is prohibited under the Indian Wildlife (Protection) Act, 1972, and they are listed as 'Schedule-I' species. Furthermore, the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) has listed the Bengal monitor lizard, the Yellow monitor lizard, and the Desert monitor lizard in Appendix I. On the other hand, the Water monitor lizard is listed in Appendix II [7].

Generally, the monitor lizards (Varanus spp.) are copiously poached for their meat, which is considered a delicacy and assumed to have medicinal properties. Studies have documented that the products prepared from the monitor lizards (Varanus spp.) are used to treat various diseases, i.e., asthma, haemorrhoids, rheumatism, and arthritis [8]. In addition, the oil prepared from the Varanus spp. is used for burns and spider and snake bites. Recently, Rajpoot et al. reported that the genital organs from Varanus spp. traded in the name of 'Hatha Jodi' (the root of the Tiger's Claw plant and used for human welfare).

Molecular species identification from the tissue and blood samples and investigation of poaching cases are much more straightforward than other types of samples [9]. However, dealing with dried and processed organs for species identification requires more effort and the development of alternative protocols for getting PCR-amplifiable DNA from the samples. Hence, the present study aims to identify species from the seized dried genital organs (suspected to be Bengal monitor lizard) received from the Tamil Nadu Forest Department at the Advanced Institute for Wildlife Conservation, Vandalur, Chennai — 600 048, India.

2 Materials and methods

2.1 Case history

The Tamil Nadu Forest Department officials sent the six (n = 6) (pack of three, each pack containing two samples) seized dried genital organs to the Advanced Institute for Wildlife Conservation, Tamil Nadu, India (https://www.aiwc.res.in), for species identification. The sample was received in a zip lock cover with a proper seal and chain of custody (Fig. 1).

Fig. 1
figure 1

Six numbers of seized dried genital organs (A–C) were received for species identification (suspected to be Bengal monitor lizard). For species identification one sample was taken from each pack

Full size image

2.2 DNA extraction

Step-1: Sample preparation: One sample was taken from each pack (A total of three samples), and 30 mg of each sample was weighed in a 1.5 ml centrifuge tube.

  • 1.1 Cell lysis: 500 µl of proteinase K (20 mg/ml, QIAGEN, Hilden, Germany) and 1 ml of EDTA (0.5 M EDTA, pH 8.0 and 1% lauryl-sarcosinate) were added into samples and incubated in a ThermoMixer (Eppendorf, Germany) for 60 minat 56 ˚C. At every 15-min interval, the samples were inversely mixed for 2–5 s. After the incubation, the resulting solutions were centrifuged at 6000 rpm for 5 min, and the supernatant was discarded. Following that, 200 µl of proteinase K was added to the pellet.

Step-2: DNA extraction: The resulting solution (pellet) from step 1 was taken for the DNA extraction, and the DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) was used as per manufacturer instructions with minor modifications. These modifications were as follows:

  • 2.1. To remove residual material from the sample, we centrifuged it two times at 10,000 rpm for five min at room temperature.

  • 2.2. Ice-cold ethanol was added for DNA precipitation, and the centrifuged tube was incubated in ice for 5 to 10 min.

  • 2.3. The resulting solutions were centrifuged at 10,000 rpm for 7 min, and the tubes were air-dried before the DNA elution.

  • 2.4. DNA elution was carried out in 25 µl Nuclease-Free Water (Thermo Fisher Scientific) and the DNA concentration was estimated using NanoDrop (Thermo Fisher, Massachusetts, United States).

2.3 PCR amplification

For species identification, a partial fragment of the mitochondrial cytb gene was amplified from the DNA extracted from seized dried genital organs using the universal primer (F: 5′-TACCATGAGGACAAATATCATTCTG -3′; R: 5′- CCTCCTAGTTTGTTAGGGATTG ATCG-3′) reported by Verma et al. [10]. The PCR was carried out in a 25 µl reaction mix containing 1.5 mM MgCl2, Tris–HCl pH 8.5 (1 × Taq DNA Polymerase Master Mix RED, Ampliqon, Denmark) and 10 pmol (5 pmol) each primer; 120 ng of genomic DNA was diluted with Nuclease-Free Water (Thermo Fisher, Massachusetts, United States) to make up the final volume to 25 µl. The PCR amplifications were carried out an Eppendorf Master Cycler X50 PCR Cycler (Eppendorf, US) using a program consisting of 35 cycles: pre-denaturation at 95 °C for 10 min, followed by 94 °C for 40 s, annealing at 49.2 °C for 1 min, and extension at 72 °C for 2 min, ending with a final extension at 72 °C for 10 min. After the PCR, the electrophoresis was carried out on 2% agarose gel with 2.5 µl of the PCR products and 2 µl of Novel Juice Stain (GeneDireX, Inc., USA). Subsequently, the agarose gel is imaged using Gel Doc XR + Gel Documentation System (Bio-Rad Laboratories, Bio-Rad Ltd, US).

2.4 Sanger sequencing and data analyses

About 50 µl of PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and eluted into 15 μl nuclease-free water (NFW). Then, samples were sequenced by double-pass (both the DNA stands) in 25-μl reactions containing 100 ng/µl of purified PCR product and 10 pmol of primer, following the instructions of the Sequencing Standard, BigDye™ Terminator v3.1 Kit (Thermo Fisher Scientific Inc, Waltham, Massachusetts, United States) using an Applied Biosystems 3500 Genetic Analyzer. The sequenced results were analyzed for quality of sequencing; errors, miscalls, and noise were trimmed, and the contig sequence was generated and aligned using Bio-Edit7.2 version [11]. Then, individual sequences were compared with the sequences on the NCBI database using the Basic Local Alignment Search Tool (BLAST). Then, the DNA sequences were aligned with cytb gene sequences of V. bengalensis (MG 670552.1), V. flavescens (OP 141876.1), V. griseus (NC 010974.1) and V. salvator (OP141877.1) using Clustal-W. The maximum likelihood (ML) [12] phylogenetic tree was constructed with the aligned sequences based on the best fit model of T93 + G (identified on the basis of Bayesian information criterion (BIC) score) by bootstrapping 1000 replication with the help of MEGA 11 [13].

3 Results and discussion

The wildlife DNA forensic lab deals with wildlife crimes. Most of the samples received for analysis are seized or recovered wildlife articles, and extracting DNA from these samples is challenging. Therefore, there is an urgent need to establish sample-specific DNA extraction and PCR amplification protocols, which will play a key role in resolving wildlife crimes. With this regard, Sinha et al. [14], D’Cruze et al. [15], and Singh et al. [16] reported species identification from seized animals and snake oil; Johnson et al. [17] documented that different wildlife animal parts were used for the preparation of wine. In addition, Ghosh et al. [18] studied species identification from unidentified cooked meat, and Nooratiny et al. [19] showed DNA extraction from ghee and beef species identification. Other than this, no studies focused on species identification from products prepared using wild animal articles.

The current study is devoted to species identification from the seized dried genital organs. We used modified protocol for DNA extraction from genital organs, and the extracted DNA has shown good amplification for the cytb gene. The PCR amplicons are sequenced, and 434 bp for sample A, 430 bp for sample B, and 425 bp for sample C were obtained, respectively. The BLAST similarity search revealed 99.38% (for sample A), 99.20% (for sample B), and 99.00% (for sample C) similarity with the cytb gene of Bengal monitor lizard. Further, the maximum likelihood phylogenetic tree was constructed using the contig sequence from the seized dried genital organs (Sample A–C), in-house repository cytb sequence for Bengal monitor lizard and other Varanus spp. cytb sequences were downloaded from NCBI database (Fig. 2). The dendrogram showed that the seized dried genital organs (Sample A–C) were identical to Bengal Monitor lizard and had 100% bootstrap support. Besides, we analyzed nucleotide variations in the cytb gene among the Varanus spp.., and the results exhibited unambiguous evidence (Fig. 3). Hence, the comprehensive analysis of the similarity index, phylogenetic analysis, and sequence variation revealed that the seized dried genital organs belonged to Bengal Monitor lizard and significantly differs from other three species of this genus reported in India.

Fig. 2
figure 2

Phylogenetic tree for species identification from seized dried genital organs (samples A, B and C). The maximum likelihood (ML) tree was constructed by aligning a partial fragment of the mitochondrial cytochrome-b (cytb) gene sequences generated from seized dried genital organs (samples A, B and C) and other the monitor lizards (Varanus spp.) cytb sequences were downloaded from the NCBI database. An Elephas maximus cytb sequence was used as an outgroup. (The inserted monitor lizard picture was adapted from https://www.naturepl.com)

Full size image
Fig. 3
figure 3

Mitochondrial cytochrome-b (cytb) sequence alignment showing the sequence variation in Varanus spp. Multiple sequence alignment was performed with a partial fragment of the cytb gene sequences generated from seized dried genital organs (samples A, B and C) and other monitor lizards (Varanus spp.) cytb sequences were downloaded from the NCBI database. Dissimilar DNA sequences are colored and boxed; the dotted lines indicate nucleotide similarity 

Full size image

TRAFFIC India highlighted that lizards are poached and traded for their meat, blood, oil, and skin. They are often captured using noose traps and snares and are targeted by their burrows. The meat is considered a delicacy by locals and the oil obtained from the skin and tail of the lizard is sold as a local remedy for various ailments, including joint pain [20]. In India, lizard poaching has been highlighted in different media; For example, The Forest Department of Odisha seized the Indian monitor from the traders [21]; the Directorate of Revenue Intelligence (DRI), Mumbai, India zonal unit has seized 781 Bengal Monitor Lizard (Hemipenes) and 19.6 kg of soft corals that were seized in April 2024 in Mumbai were allegedly brought from Gujarat for sale in Maharashtra [22]; on July 2024, the Wildlife Trust of India (WTI) and the Amritsar Forest Department conducted a major raid in Majith Mandi, Amritsar, India, and found that 158 Hatha Jodi (monitor lizard genitals), 38 suspected bear biles, 69 sea fans, 1.4 kg of organ pipe corals and approx. 4.8 kg of gorgonian species corals [23]. The above insistences confirm that lizards are poached throughout India and there is an urgent need to make efforts to protect these species.

To save the species of monitor lizards, the World Wide Fund for Nature (WWF-India) and TRAFFIC India are stepping up their campaign to prevent the monitor lizards trade. The campaign emphasized the current threat to monitor lizards and conveyed the key message: "Buying is Stealing". This warning message warns people against purchasing medical products from monitor lizards and other protected from wildlife species [24].

One of the main challenges in combating illegal wildlife trade is the identification of species from traded articles [10]. Although morphological identifications can be done if the seized articles are intact, in many cases, the samples received for forensic analysis are pre-processed, damaged, and treated with various chemicals to alter the original structure [25]. Therefore, species identification using morphological techniques is impossible for these types of samples.

Next, DNA-based techniques are used for species identification; DNA extraction is the first step in molecular species identification. Obtaining good-quality DNA depends primarily on the nature of the sample, and the researcher uses various methodologies, including new methods and modifications to existing methods, to extract DNA from the sample for species identification [10].

In light of this, the current study demonstrated the molecular species identification of dried seized genital organs by amplifying a partial fragment of the mitochondrial cytb gene, followed by DNA sequence analysis. Based on our experience, we understand that in Hatha Jodi (the genital ligand of lizards), traders use various techniques to alter the original structure before marketing. Therefore, the forensic laboratory may likely receive altered or modified lizard genital organs for species identification from different law enforcement agencies. Hence, a modification or alteration in the existing methodology was required to identify species from modified Hatha Jodi (monitor lizard genitals).

The current study has successfully identified the species of seized dried genital organs by performing minor modifications in DNA extraction followed by amplifying a partial fragment of the mitochondrial cytb gene. This study will help solve similar wildlife cases in the future, contributing to the conservation of Varanus species.