1 Introduction

The CD system abbreviated for “Cluster of Differentiation” is a very well-known system which is utilized to categorize cells according to the molecules present on their surface. These cell surface markers are frequently employed to link cells with certain properties or immunological functions. CD markers are generally surface proteins that belong to several different classes, such as integrins, adhesion molecules, glycoproteins, and receptors. CD markers not only indicate the growth of tumor stem cells, but also their invasion and metastasis. Most of the CD markers reported have also been related to tumor cell types. Each surface marker selected in this study is unique regarding its functions like CD13, also referred to as aminopeptidase, a membrane-bound ecto-enzyme which is Zn2+ dependent that breaks down proteins and peptides having neutral amino acids at N-terminus [1]. This enzyme is found mostly present on surfaces of all myeloid cells. It is known to play a role in processes such as mitosis, cell adhesion, invasion, angiogenesis, resistance to radiation and anti-apoptosis [2,3,4,5,6,7] and marks it as a promising therapeutic target. Aminopeptidase N has been linked to the development of several types of human cancers and it has been proposed as a potential target for anti-cancerous therapy [8,9,10,11]. CD19, a protein from the immunoglobulin superfamily expressed on the surface of B cells (also most B- cell malignancies such as CLL, B-ALL, etc.) serves as an important target for CAR-directed therapies. CD19 a transmembrane function as a dominant signaling molecule belonging to the immunoglobulin superfamily, a transmembrane glycoprotein of molecular weight of 95kd. Most B-cell malignancies express CD19 in normal and neoplastic B cells, as well as Follicular dendritic cells. Antigen-independent development and immunoglobulin-induced activation of B-lymphocytes are found to be critically dependent on CD19. As a result, it is critical for the body to mount an optimal immunological response. Additionally, it works in complex with the BCR and other surface molecules to promote the direct and indirect binding and recruitment of several downstream protein kinases [12, 13]. CD24 is heavily glycosylated, anchored by glycosyl-phosphatidyl-inositol present on cells in a wide variety of cancer cells and strongly expressed in non-small cell carcinomas, ovarian, breast, prostate, renal, bladder, and other human malignancies [14]. It functions in cell–cell adhesion and cell–matrix interactions and metastasis and hence is a significant marker in tumor prognosis and diagnosis [15,16,17]. CD38 is a multifunctional ectoenzyme that functions as a nicotinamide adenine dinucleotide (NAD+) glycohydrolase and catalyzes the synthesis and degradation of cADPR affecting calcium signaling and release, thus decreasing extracellular NAD+ , altering calcium cascade and deeply contributing to adenosine-mediated immune suppression found to alters the activity of T, NK, and dendritic cells and attracts migration of suppressor cells. Targeting CD38 would reduce the anti-inflammatory response and rejuvenate the antitumor activity of immune cells. It is a novel multifunctional transmembrane ectoenzyme that hydrolyzes NAD. It is ubiquitously expressed by B lymphocytes, natural killer cells and monocytes and hence is a good target for Multiple Myeloma (MM) patients for immunotherapy. It serves as a cell surface receptor and is crucial for the proliferation of immune cells and the activation of lymphocytes [18]. CD38 may represent a potential prognostic factor in Triple-negative breast cancer (TNBC) [19].

Researchers have approached the identification of specific surface markers or their signaling regulators in achieving a better chance of developing new therapeutic alternatives for patients suffering from cancer. As CD stem cell markers are overexpressed in different types of cancer and affect the biological function, hence, we thought to target the G4 motifs with designed peptide QQWQQQQWQ (QW10) in cell mimicking physiological ionic and molecular crowding conditions to observe the changes upon peptide binding on G4 structures. QW10 is a designed peptide with an abundance of glutamine with intermittent tryptophan residues. We have recently published the structural specificity of this peptide on telomeric G-quadruplex [20] and significant structural change in c-Myc G4 structure [21]. Our results suggested that the peptide has unique ability to destabilize the G4 structure not only under dilute condition but also in cell-mimicking molecular crowding condition. However, this peptide also can destabilize the Watson.Crick bonded duplex and it did not bind to i-motif structure formed by complementary c-rich strand.

However, in our recent publication, we have identified the G-quadruplex (G4) forming motifs in some cancer stem cell markers (CD13, CD19, CD24 and CD38) using a bioinformatics approach. Next, we have tried to identify their structures in different ionic conditions and under cell-mimicking molecular crowding conditions. Our CD spectroscopy results suggested mainly the formation of a mixed G-quadruplex structure which had high thermal stability due to the formation of unimolecular, dimeric and trimeric G-quadruplex depending on the G4-sequence and solution conditions confirmed by native gel data [1]. Until now, no systemic study has been performed to target the G-quadruplex forming motifs in stem cell markers with peptides. Hence, we have studied the G-quadruplex peptide interaction in the presence of different ionic and cell-mimicking molecular crowding conditions. As the topology of the G-quadruplex structure depends on surrounding solution conditions, our CD results suggested mainly the formation of mixed G-quadruplex structure [1] by all sequences which were completely destabilized upon peptide binding not only under dilute conditions but also under cell-mimicking molecular crowding conditions. These structures had high thermal stability and we observed a significant decrease in Tm values indicating the structural conversion of G-quadruplex into dimeric structures and our electrophoretic mobility shift assay confirmed the destabilization of G-quadruplex structure.

2 Materials and methods

2.1 DNA oligonucleotides

PAGE (Polyacrylamide Gel Electrophoresis)—purified single-stranded DNA oligonucleotides for cancer stem cell marker sequences were purchased from Helix Biosciences in lyophilized form with a purification grade of 1 micromole (µM) scale (sequences mentioned below) [1]. The lyophilized powder of the oligonucleotide was directly dissolved in MilliQ water to form the stock solution which was stored at − 20 °C. The concentration of these single-stranded DNA oligonucleotides was evaluated by measuring the absorbance at a high temperature at a wavelength of 260 nm using the Shimadzu 2600 spectrophotometer (Shimadzu, Tokyo, Japan) coupled with a thermoprogrammer. Extinction coefficients of the oligonucleotides were calculated manually using the mononucleotide and dinucleotide data values using the nearest-neighbour approximation [22,23,24].

  • Sequences used in this study to see the interaction with peptides are as follows [1]:

  • CD13: 5ʹ- GGGTGAATGGGAGGGGAAGGG -3ʹ

  • CD19: 5ʹ- GGGCCGGGCTGGGGCAGGG -3ʹ

  • CD24: 5ʹ- GGGGAGCCGGGGTGGGCGGG -3ʹ

  • CD38: 5ʹ- GGGGTTGGGGGTGGGAAGGG -3ʹ

2.2 Peptide

High-Performance Liquid Chromatography (HPLC)-purified peptide (QW10) with sequence QQWQQQQWQQ [20, 21, 25] was purchased in lyophilized form from Helix Biosciences. Using the same spectrophotometer, the concentration of peptide was determined by measuring the absorbance at 280 nm of the tryptophan present at the C-terminus.

2.3 Sample preparation

DNA samples were prepared by diluting the oligonucleotide with 30 mM sodium cacodylate buffer (pH 7.4) in 100 mM NaCl, 100 mM KCl with and without 40 wt% PEG200 and 0.5 mM EDTA. The sample was heated to 95 °C for 5 min, slowly cooled to room temperature overnight, and incubated at 4 °C for 24 h.

2.4 Circular dichroism spectroscopy

CD Spectra were captured using a quartz cuvette with 1 mL volume capacity and a 1 cm path length on a JASCO-715 spectropolarimeter. The CD spectra were recorded at wavelength steps of 100 nm min−1 in the range of 200–350 nm. Each scan was recorded because of an average of three scans and average scans of the oligonucleotide samples were subtracted from the buffer scan. The data was obtained in units of millidegrees versus wavelength and further a normalized curve as a function of DNA strand concentration and path length of the cuvette is obtained to note the binding parameters.

2.5 Thermal melting analysis

Using a Shimadzu 2600 spectrophotometer (Shimadzu, Tokyo, Japan) equipped with a Peltier thermoprogrammer TMSPC-8(E)-200, UV absorbance spectra of all the different samples were recorded. The UV absorbance of the oligonucleotides at 260 nm and 295 nm were recorded in order to obtain the Thermal melting curves in solution condition containing 30 mM sodium cacodylate buffer (pH 7.4) in 100 mM NaCl, 100 mM KCl with and without 40 wt% PEG200 and 0.5 mM EDTA in the presence and absence of QW10 peptide. Peptide was added as DNA: Peptide in different ratios as mentioned- (1:0), (1:2), (1:5), (1:10), (1:50) and (1:80). Thermal melting curves of 4 µM DNA samples were recorded using 8-cell stoppered quartz cuvette of 1 cm path length at a heating rate of 0.5 °C min−1 and Tm values were obtained as previously described [22, 23].

2.6 Fluorescence spectroscopy

Fluorescence titration experiments were performed in a 1 cm path-length quartz cuvette at room temperature on JASCO FP 8300 Spectrofluorometer (JASCO, Tokyo, Japan). Peptide in the concentration of 4 µM taken in 30 mM sodium cacodylate buffer (pH 7.4) in 100 mM NaCl, 100 mM KCl with and without 40 wt% PEG200 and 0.5 mM EDTA was titrated with oligonucleotide sample prepared in the same buffer condition. JASCO ETC-273 T temperature controller was used to regulate the temperature of the cell holder. The samples were excited at 275 nm, and the emission spectra were obtained in the 270–300 nm region. The excitation and emission slit widths were each 5 nm. To replicate the data, the experiment was carried out three times, and after normalization, the following equation was used to fit the data [20, 21].

$$Y = \frac{{\left[ {{\text{peptide}}} \right]^{n} }}{{\left\{ {K_{d}^{n} + \, \left[ {{\text{peptide}}} \right]^{n} } \right\}}}$$

2.7 Electrophoretic mobility shift assay (EMSA)

A native gel experiment was performed using 15% (w/v) polyacrylamide gel. Samples were prepared in 30 mM sodium cacodylate buffer (pH 7.4) in 100 mM NaCl, 100 mM KCl with and without 40 wt% PEG200 and 0.5 mM EDTA. The same amount of salt and EDTA as found in the oligonucleotide sample was present in the running buffer TBE (pH 7.4). The EMSA experiment was performed in a cold room at a constant 50 V voltage. The mixture of glycerol and orange-G in a 1:1 ratio was used to track the movement of DNA oligonucleotide in the gel. Finally, the gel was imaged using the Gel-Doc System (Bio-Rad, Gurgaon, Haryana, India) after staining using the standard protocol of the silver nitrate staining process.

3 Results and discussion

3.1 Structural changes in human cancer stem cell marker G-quadruplexes in different ionic conditions with and without peptide using CD Spectroscopy

CD spectroscopy was used to determine the structure of different cancer stem cell markers (CD13, CD19, CD24 and CD38) used for this study. Samples were prepared in the same manner mentioned above. Firstly, the structure was recorded under dilute conditions for all cancer stem cell markers in the presence of 30 mM sodium cacodylate buffer (pH 7.4) containing 100 mM Na+ (Fig. 1A, D, G, J) or K+ (Fig. 1B, E, H, K) and then finally in 100 mM K+ with 40% wt PEG 200 (Fig. 1C, F, I, L).

Fig. 1
figure 1

CD Spectra of 6 µM CD13 (A, B & C); CD19 (D, E & F); CD24 (G, H & I) and CD38 (J, K & L) in 30 mM sodium cacodylate buffer (pH 7.4) containing 0.5 mM EDTA, 100 mM NaCl (A, D, G & J); 100 mM KCl (B, E, H & K) and 100 mM KCl and 40 wt% PEG 200 (C, F, I & L) without any additive (black) and titrated with an increasing concentration of QW10 peptide

Full size image

We found that the CD spectrum of CD13 in 100 mM Na+ (Fig. 1A) was characterized by a positive peak at 263 nm and a minor hump at 295 nm along with a negative peak at 238 nm while in the presence of 100 mM K+ (Fig. 1B), it showed a positive peak at 250 nm, a strong shoulder at 293 nm, and a negative peak at 233 nm. Next, we recorded CD spectra in cell mimicking molecular crowding conditions having 100 mM K+ with 40 wt% PEG200 (Fig. 1C). CD spectra were characterized by a positive peak at 262 nm, a weak shoulder at 293 nm and a negative peak at 232 nm. These CD signatures signify the formation of mixed G-quadruplex consistent with the previous reports in all solution conditions used in this study [26]. Next, the samples were titrated with increasing concentrations of QW10 peptide to determine the structural changes upon peptide binding. We observed a significant decrease in the CD intensity with the complete disappearance of G-quadruplex signatures along with isodichoric points at 252 nm and 250 nm and at 251 nm in 100 mM Na+, 100 mM K+ and 100 mM K+ with 40 wt% PEG200 respectively indicating the destabilization of G-quadruplex structure upon peptide binding. Similarly, the CD spectrum for CD19 was characterized by a positive peak at 248nm, 294nm and a negative peak at 230 nm in 100 mM Na+ (Fig. 1D). CD spectra for CD19 had a major positive peak at 263 nm, a minor peak at 293 nm and a negative peak at 233 nm in 100 mM K+ (Fig. 1E). This showed the formation of mixed G4 quadruplex with more proportion of parallel topology in K+ and this structure is distinct from the structure formed in the presence of Na+. We also propose the formation of a new topology of G-quadruplex structure in Na+ as published in our recently published manuscript [1]. Interestingly, a single prominent positive peak at 263 nm and a negative peak at 235nm was observed in molecular crowding conditions (Fig. 1F), indicating the parallel topology of the G-quadruplex formed by CD19 [27]. On titrating these G4 structures with increasing concentration of QW10 peptide, there was significant decrease in the CD intensity in all three ionic conditions with complete disappearance of G-quadruplex signatures and isodichoric points at 281 nm, 250 nm, 251 nm for 100 mM Na+, 100 mM K+ and 100 mM K+ with 40 wt% PEG200 respectively indicating the complete destabilization of G4 structures not only under dilute conditions of ions rather under molecular crowding conditions.

Similarly, the CD spectra for CD24 were observed to be characterized with major positive maxima at 261 nm, 266 nm and 264 nm and minor positive hump at 299 nm and negative peak at 234 nm in 100 mM Na+ (Fig. 1G), 100 mM K+ (Fig. 1H) and 100 mM K+ with 40 wt% PEG200 (Fig. 1I). This indicated the formation of a mixed G-quadruplex with a maximum population of parallel topology. A significant drop in the CD intensity as well as isodichoric points at 248nm and 249 nm in K+ with and without 40 wt% PEG200 respectively were observed when these G4 structures were titrated with an increasing concentration of QW10. Next, the CD spectra of the CD38 marker were recorded in similar ionic conditions. CD spectra were characterized by two prominent positive peaks at 259 nm, and 296 nm and a negative peak at 236 nm in 100 mM Na+ (Fig. 1J) signifying the formation of a mixed new topology of parallel and antiparallel structure G-quadruplex structure. Samples prepared in 100 mM K+ (Fig. 1K) and 100 mM K+ with 40 wt% PEG200 (Fig. 1L) showed a prominent major positive peak at 266 nm and at 295 nm along with a negative peak at 236 nm signifying the formation of mixed G-quadruplex with more population of a parallel type of G-quadruplex and less antiparallel topology. Upon titrating the G4 structure with an increasing concentration of QW10 peptide, a significant decrease in CD intensity along with the disappearance of G4 structures and isodichoric points at 248 nm in 100 mM Na+, 100mM K+ and 100 mM K+ with 40 wt% PEG200 respectively was observed indicating the destabilization of G4 structures of CD38. The apparent binding constant values (Kb) of all of these cancers' stem cell markers in 100mM Na+ (Additional file 1: Fig. 1A, D, G & J); 100 mM K+ (Additional file 1: Fig. 1B, E, H & K) and 100 mM K+ with 40 wt% PEG 200 (Additional file 1: Fig. 1C, F, I & L) was given in Table 1 respectively. So, we conclude that G4 motifs selected in this study from different cancer stem cell markers formed G-quadruplex structures mainly having mixed topology. Possible topological structures we have recently published in the scheme of our paper [1]. Interestingly, the QW10 peptide showed the unique ability to bind with all polymorphic G4 structures and able to destabilize them not only in ionic conditions but also in cell-mimicking molecular crowding conditions also reported earlier [20, 21]. In Fig. 2, the destabilization of the G4 molecule upon peptide binding has been shown schematically. This figure shows how the G4 structure when bound to the QW10 peptide first stabilizes into a dimeric structure which will be discussed in subsequent sections and then completely destabilizes.

Table 1 CD Binding constant (Kb) values (mmol−1 cm−1) of all the cancer stem cell marker G-quadruplexes with QW10 designed peptide
Full size table
Fig. 2
figure 2

Schematic representation of formation of G-quadruplex structure (A); G-quadruplex- QW10 Peptide binding glutamine residue via H-bonding with G-bases followed by intercalation of tryptophan residues into the G-quartet plane (B); partial dissociation of G-quadruplex upon peptide binding with increasing stacking and stabilizing dimeric structure (C) and complete destabilization of G-quadruplex structure upon peptide binding (D)

Full size image

3.2 UV Thermal melting studies of human cancer stem cell marker G-quadruplexes with and without peptide

As reported earlier the DNA G-quadruplex structures show greater signals at 295 nm rather than show little change in absorbance when noted at their UV maximum of 260 nm [27]. So, at 295 nm, we investigated the heat stability of the G4 structures both with and without peptide. Figure 3 shows a normalized UV melting profile of 4 µM G4 sequence of CD13, CD19, CD24 and CD38 in buffer containing 100 mM NaCl, (Fig. 3A, D, G & J), 100 mM KCl (Fig. 3B, E, H & K), and 100 mM KCl + 40 wt% PEG 200 (Fig. 3C, F, I & L) in the absence and presence of QW10 peptide. The ratios of G4 and QW10 peptide were (1: 0), (1: 2), (1: 5), (1: 10), (1: 50) and (1: 80). Using a method of curve-fitting that has been previously described, the melting temperatures (Tm) were assessed [22, 23]. Under all conditions, melting curves with a single transition were obtained. The Tm values for CD13 were recorded as 48.1 °C, 59.1 °C and 68.8 °C for the control, which decreased to 43.1 °C, 41.1 °C and 39.1 °C in 100 mM NaCl (Fig. 3A), 100 mM KCl (Fig. 3B) and 100 mM KCl + 40 wt% PEG 200 (Fig. 3C) on increasing the DNA: peptide concentration from 1:0 to 1:80 respectively. The Tm values for CD19 were recorded as 60.1 °C, 67.2 °C and 80.1 oC for the control, which decreased to 42.1 °C, 37.1 °C and 40.2 °C in 100 mM NaCl (Fig. 3D), 100 mM KCl (Fig. 3E) and 100 mM KCl + 40 wt% PEG200 (Fig. 3F) on increasing the DNA: peptide concentration from 1:0 to 1:80 respectively. CD24 melted with the biphasic transition with Tm values 38.1 °C and 71.1 °C; 38.5 oC and 81.3 °C and 48.2 oC and 91.2 oC for the control, which decreased to 33.1 °C, 38.5 °C and 37.1 °C in 100 mM NaCl (Fig. 3G), 100 mM KCl (Fig. 3H) and 100 mM KCl + 40 wt% PEG 200 (Fig. 3I) on increasing the DNA: peptide concentration from 1:0 to 1:80 respectively. These Tm results clearly indicated that peptide was binding to stem cell marker G4 structures which possibly could be dimeric and tetrameric which destabilized into dimeric structure. The Tm values for CD38 were recorded as 73.1 °C, 72.0 °C and 86.1 °C for the control, which decreased to 30.1 °C, 23.9 °C and 40.1 °C in 100 mM NaCl (Fig. 3J), 100 mM KCl (Fig. 3K) and 100 mM KCl + 40 wt% PEG 200 (Fig. 3L) on increasing the DNA: peptide concentration from 1:0 to 1:80 respectively. Gradual changes in Tm values of all stem cell markers with an increasing concentration of DNA: Peptide was given in Table 2. These Tm results clearly showed that QW10 bound with all G4 structures formed by stem cell markers used in this study and destabilized the G4 structures not only in all ionic conditions but also in cell-mimicking molecular crowding conditions. It is important to note that with our Tm results, we have confirmed the structural transition from G4-quadruplex to dimeric structure with CD24 stem cell marker in K+ in both dilute and cell-mimicking molecular crowding conditions. It is important to note that we have observed the complete disappearance of G4 signatures on titrating with increasing concentration of QW10 peptide using CD spectroscopy while our thermal melting results confirmed the destabilization of G4 structures into dimer. This difference might be due to the differences in the DNA: Peptide ratio used in both studies.

Fig. 3
figure 3

Normalized UV Melting Curve of 4 µM CD13 (A, B & C); CD19 (D, E & F); CD24 (G, H & I) and CD38 (J, K & L) in G-quadruplex: QW10 Peptide ratio (1:0) (black); (1:2) (red); (1:5) (green); (1:10) (blue); (1:50) (turquoise); (1:80) (pink) in 30 mM sodium cacodylate buffer (pH 7.4) containing 0.5 mM EDTA, 100 mM NaCl (A, D, G & J); 100 mM KCl (B, E, H & K) and 100 mM KCl and 40 wt% PEG 200 (C, F, I & L) respectively

Full size image
Table 2 UV Melting curve derived thermal melting temperature values for all the stem cell markers with and without QW10 peptide at pH 7.4
Full size table

3.3 Study of molecularity of human cancer stem cell marker G-quadruplexes using electrophoretic mobility shift assay

To understand the changes in the molecularity of the G4 structures formed by CD stem cell markers upon the binding of QW10 peptide, we performed the electrophoretic mobility shift assay (EMSA). We investigated the complex in the presence of K+ with and without 40 wt% PEG200 using non-denaturing polyacrylamide gel electrophoresis (Native PAGE). The electrophoretogram (Additional file 1: Fig. S2A and B) shows the structural status of CD13 with two different ratios of QW10 prepared in K+ alone and with 40 wt% PEG200 respectively in two gels. In lane 1, a 10-base pair (bp) ladder was used for comparing the electrophoretic mobility of each band. In (Additional file 1: Fig. S2A) lane 2 shows the migration of a single band corresponding to 10 bp band, indicating that CD13 in K+ alone folded into an unimolecular G4 structure. Lanes 3 and 4 contained a G4-peptide complex in two different ratios 1:10 and 1:50 respectively. Here, again we observed single bands equivalent to 10bp. It was found to be quite difficult to discriminate the band intensity or band position because of the reason that a single purine-rich strand and unimolecular G4 both migrate at similar positions in the gel. Similarly, we observed two bands in K+ with 40 wt% PEG200 migrated equivalent to 10-20bp and 20–30 bp (Additional file 1: Fig. S2B). Again, it was found to be difficult to know the molecularity of the structure as a single G-rich strand and uni-molecular G-quadruplex will migrate at the same position so the mobility cannot be distinguished in the gel based on similar band position and band intensity.

Hence, another experiment was designed to better understand and confirm the effect of binding of QW10 to the G4 structure and discriminate the unimolecular G4 and single purine-rich strand generated after peptide binding. EMSA was performed in K+ alone. In the electrophoretogram (Fig. 4) a 10 bp DNA ladder (lane 1) was used to compare the electrophoretic mobility. Lane 2 displayed a single band near 10 bp formed by human telomeric sequence indicating the formation of unimolecular G4 structure. Lane 3 and 4 contained G4- peptide complex in different ratios 1:10 and 1:50 respectively and again displayed a single band near 10 bp, similar to that of the G4 structure in lane 2. Next, a set was prepared in which after the G4-peptide complex in the same ratio was incubated overnight, and a double concentration of pyrimidine-rich strand was added the next day to it (lanes 5 and 6). Interestingly, we observed two bands, and we compared their mobility with two controls, one was a DNA double helix, and another was a dimeric c-quadruplex structure which we discussed in the following section. Hence, we loaded DNA duplex (lane7), prepared by mixing an equal ratio of purine and pyrimidine-rich strands, three bands appeared between 20 and 30 bp, between 10 bp and 20 bp and near 10 bp. We will discuss their structures with other controls formed by pyrimidine-rich strands. Lane 8 displayed a single sharp band migrated between 10 and 20 bp, indicating the formation of a dimeric i-motif structure at pH 7.4. Based on the mobility of dimeric i-motif as control, we assigned the upper band in lane 7 to DNA duplex between 20 and 30 bp, a light middle band between 10 and 20 bp to dimeric i-motif (lane 7) and a very faint band near 10 bp to free single strand. It was interesting to observe that in lanes 5 and 6 two bands appeared between 10–20 bp and 20–30 bp but nearly no band appeared corresponding to 10 bp. We assigned the upper band as duplex (compared to the control duplex in lane 7) and the lower band as i-motif again (compared to the control i-motif structure in lane 8). With these results, we confirmed that the peptide was binding to the G4 structure and unfolding it. Free G-rich stands that formed after G4 unfolding, when provided with double concentration of pyrimidine-rich strand subsequently preferred to form DNA duplex and the rest of the pyrimidine-rich strand formed dimeric i-motif band. The electrophoretic results demonstrated a clear ability of QW10 peptide to bind to human telomeric G4 structure and eventually unfold the structure.

Fig. 4
figure 4

Electrophoretogram for electrophoretic mobility shift assay of 6 µM human telomeric G-quadruplex sequence in 30 mM sodium cacodylate buffer (pH 7.4) containing 0.5 mM EDTA, 100 mM KCl. Lane 1: 10-bp DNA ladder; Lane 2: preformed telomeric G-quadruplex; Lane 3: telomeric G-quadruplex: QW10 Peptide (1:10) complex; Lane 4: telomeric G-quadruplex: QW10 Peptide (1:50) complex; Lane 5: G-quadruplex: QW10 Peptide (1:10) complex incubated with double concentration of pyrimidine rich sequence; Lane 6: G-quadruplex: QW10 Peptide (1:40) complex incubated with double concentration of pyrimidine rich sequence; Lane 7: preformed purine-pyrimidine rich complex (duplex); Lane 8: preformed i-Motif of pyrimidine rich sequence at (pH 7.4) respectively

Full size image

3.4 Exploration of peptide binding to human cancer stem cell marker G-quadruplexes by fluorescence spectroscopy

To study the binding affinities of the QW10 peptide with all cancer stem cell marker G-quadruplexes, fluorescence titration experiments were performed. The fluorescence emission spectrum of a particular fluorochrome is determined at the wavelength of maximum absorption (usually the excitation maxima) and the fluorochrome is thus excited at that wavelength. Tryptophan is present in the QW10 peptide, therefore its emission spectra was studied by excitation at 275 nm, with emission being recorded from 270 to 500 nm [20, 21, 23]. The preformed G-quadruplex samples of all different cancer stem cell markers were prepared in the presence of 100 mM Na+, 100 mM K+ and 100 mM K+ with 40 wt% PEG200 respectively and were added to the peptide (prepared in the same cationic condition) in small volumes until very minor changes in the fluorescence spectra were observed.

Upon excitation at 275 nm, QW10 produced an emission band with maxima centered at 349.5 nm in a buffer containing 100 mM Na+ (Fig. 5A). On the addition of preformed CD13 G-quadruplex to the peptide, a significant change in the fluorescence intensity was observed, which depicts the binding of QW10 with CD13 G4 and generation of the G-quadruplex-peptide complex. Quenching of fluorescence was observed with a slight shift in the peak to 352 nm along with the emergence of a new peak at 300 nm on increasing the DNA concentration, indicating the intercalation of tryptophan within the G-quadruplex plane during binding. The value of the binding constant (Kb) was evaluated as 3.38 \(\pm\) 0.23 µM. Further, the effect of cation and cell-mimicking molecular crowding on peptide-G-quadruplex binding was also studied. Following the same pattern, a fluorescence titration experiment in buffer containing 100 mM K+ (Fig. 5B) and 100 mM K+ with 40 wt% PEG200 (Fig. 5C) was also performed. Fluorescence maxima at 350.5 nm and 347.5 nm were observed in these two conditions. A major fluorescence quenching was seen with the emergence of a new peak at 302 nm and 301 nm respectively. These findings added to the body of evidence supporting the creation of a G-quadruplex-peptide complex with affinity for the G-4 structure in both diluted and cell-like molecular crowding conditions. Next, the same fluorescence titration with the other stem cell marker sequence CD19 was performed. Upon excitation at 275 nm, the peptide produced emission spectra with maxima centered at 350 nm (Fig. 5D), 350 nm (Fig. 5E) and 346.5 nm (Fig. 5F) respectively in three ionic conditions. On adding the increasing concentration of preformed G4 structure, we observed significant quenching with the emergence of new minima at 299.5 nm 301 nm and 304 nm in Na+, K+ and K+ with 40 wt% PEG200 respectively. The values for binding constant (Kb) were evaluated as 5.3 \(\pm\) 0.32 µM, 6.48 \(\pm\) 0.84 µM and 1.48 \(\pm\) 0.03 µM. Next CD24 was used to carry out the next fluorescence titration experiments. Upon excitation at 275 nm, the peptide produced an emission band with the maxima centered at 350.5 nm (Fig. 5G), 349 nm (Fig. 5H) and 346 nm in three buffer conditions (Fig. 5I). On addition of DNA prepared in the same buffer condition, a significant quenching of fluorescence intensity was observed with the emergence of new minima at 299 nm in Na+, 300 nm, 375.5 nm in K+ and 303.5 nm in K+ with 40 wt% PEG200. The values for the binding constants were evaluated as 7.95 \(\pm\) 1.27 µM, 2.80 \(\pm\) 0.15 µM and 3.91 \(\pm\) 0.14 µM. Lastly, the same fluorescence titration was performed with the CD38 stem cell marker sequence. Upon excitation at 275 nm, the peptide produced an emission band with maxima centered at 349.5 nm (Fig. 5J), 350.5 nm (Fig. 5K) and 345 nm (Fig. 5L). Upon DNA binding a significant change in the fluorescence intensity was observed with the emergence of new minima at 302 nm, 298.5 nm, and 302.5 nm respectively in all three buffer conditions. The Kb values were evaluated as 5.2 \(\pm\) 0.49 µM, 4.72 \(\pm\) 0.17 µM and 5.76 \(\pm\) 0.35 µM. The apparent binding constant values for all the cell marker sequences in 100 mM Na+ (Additional file 1: Fig. S3A, D, G, J), 100 mM K+ (Additional file 1: Fig. S3B, E, H, K), with 40 wt% PEG200 (Additional file 1: Fig. S3C, F, I, L) are given in Table 3 respectively. Overall, our findings support the formation of the G4-peptide complex under both dilute and cell-mimicking molecular crowding conditions and demonstrate the peptide’s strong affinity towards each of the four different human cancer stem cell marker sequences.

Fig. 5
figure 5

Emission spectra of 4 µM QW10 peptide (black) titrated with five times concentration of preformed cell marker G-quadruplex structure in increasing concentration with CD13 (A, B & C); CD19 (D, E & F); CD24 (G, H & I) and CD38 (J, K & L) in 30 mM sodium cacodylate buffer (pH 7.4) containing 0.5 mM EDTA, 100 mM NaCl (A, D, G & J); 100 mM KCl (B, E, H & K) and 100 mM KCl and 40 wt% PEG 200 (C, F, I & L) respectively

Full size image
Table 3 Fluorescence binding constant (Kb) values (µmol−1 cm−1) of all the cancer stem cell marker G-quadruplexes with QW10 designed peptide
Full size table

4 Conclusion

In the present study, we performed interaction studies with designed peptides with G-quadruplex motifs identified in these markers. We studied the interaction using spectroscopic techniques like (CD Spectroscopy, UV thermal denaturation, fluorescence spectroscopy) and Native PAGE to characterize the structure and stability in the presence of dilute (K+ and Na+ ions) and cell-mimicking molecular crowding conditions using 40 wt% PEG 200. In this manuscript, CD Spectroscopy has investigated the conformational polymorphism of G4 sequences of stem cell markers after the addition of peptides. Our CD results allowed us to see the complete destabilization of these G-quadruplex structures upon peptide binding in all solution conditions. UV thermal results confirmed the significant decrease in Tm at 295 nm, which has confirmed the structural transition from G4-quadruplex to dimeric structure. It is important to note that we have observed the complete disappearance of G4 signatures on titrating with increasing concentration of QW10 peptide using CD while our thermal melting results confirmed the destabilization of G4 structures into dimer. This difference might be due to the differences in the DNA:Peptide ratio used in both studies. Fluorescence data showed significant quenching on tryptophan upon titration with an increasing concentration of DNA. The apparent binding constant (Kb) values of peptide/G-quadruplex complexes were evaluated in the presence of 100 mM Na+, 100 mM K+ and 100 mM K+ + 40 wt% PEG 200 respectively. Our electrophoretic mobility shift assay confirmed that the free G-rich stands that formed after G4 unfolding, when provided with double concentration of pyrimidine-rich strand subsequently preferred to form DNA duplex and the rest of the pyrimidine-rich strand formed dimeric i-motif band and confirmed the peptide was binding to the G4 structure and destabilizing it. We anticipate that further investigation is required to know the detailed structure of G4: peptide complex to understand the detailed mode of its binding with G-quadruplex structure either using Nuclear Magnetic Resonance (NMR) or X-ray Crystallography and that work is under progress in my laboratory. This approach first time will shed light on identifying some lead peptides which can be targeted to destabilize the G4 structure in these stem cell markers. Hence, we propose that peptides might be good candidates for targeting the G-quadruplex as a next-generation molecule as they have easy design and synthesis, mimic natural protein–G-quadruplex interactions that can be easily modified chemically to develop them as a functional molecule to increase the cellular uptake and targeted delivery in future. Hence, this work holds much importance in the present scenario of biological chemistry.