Alphasatellites, members of the Alphasatellitidae family, are commonly associated with single-stranded (ss) DNA viruses infecting plants, particularly those belonging to the Geminiviridae, Metaxyviridae, and Nanoviridae families. These alphasatellites encode a replication-initiator protein (Rep) similar to that encoded by banana bunchy top virus (BBTV), enabling their autonomous replication (Guyot et al. 2022, 2023). Isolates of BBTV cluster into two phylogenetic groups, one consisting of Pacific-Indian Oceans (PIO) isolates and another with Southeast Asia (SEA) isolates (Adil and Quraishi 2023). In SEA, BBTV isolates are frequently associated with one or more circular ssDNA alphasatellites. Recently BBTV associated alphasatellites from the PIO group has also been reported from the Democratic Republic of Congo (Guyot et al. 2022, 2023).

Samples of a local banana cultivar ‘Alpan’ from Motihari, Bihar, India, showing typical symptoms of BBTV (dwarfed plants with rosette top appearance ) was collected in January, 2023. To test the occurrence of BBTV alphasatellite, total DNA was extracted from eight BBTV-infected banana samples and used in PCR with primers Sat F 1056 5’GGCCCGTTAAAATGATCGGACGG3’ and Sat R 1029 5’ GCCCTTATTCGGTTCTAAAGCCC 3’ designed in this study. Amplicons of the expected 1.1 kb in size were obtained from five samples. Sequencing the PCR products from a single plant sample at Barcode Bioscience Pvt Ltd (Bangalore, India) generated a consensus sequence that was submitted to GenBank as accession number OR581162.1. BLASTn analyses of the consensus nucleotide sequence from this study showed 80.34 to 86.26% identity with other alphasatellite sequences. Phylogenetic analysis with other alphasatellites placed this isolate within the subfamily Petromoalphasatellitinae and genus Muscarsatellite. To the best of our knowledge, this is the first report of the association of an alphasatellite with BBTV from India.