1 Introduction

Dried Syzygium aromaticum buds are common type of spice and in traditional Indian and Chinese medicine. It contains chavicol, humulene, alpha-ylangen, beta-caryophyllene, methyl salicylate, eugenone, and eugenol, flavonoids triterpenoids such as eugenin, rhamnetin, eugenitin, kaempferol, oleanolic acid, stigmasterol, campesterol, and some sesquiterpenes [1]. In addition to its primitive role as a spice in classical Indian cuisine, it is also used in Ayurvedic medicine as a chemo preventive agent [2]. The main component is eugenol, which accounts for 81.1% of the oil. It is used in traditional medicine as an analgesic, antiseptic, and antibacterial agent. Previous results were reported eugenol’s role in its anti-inflammatory and photochemical reactions, antiviral, insecticidal, and antioxidant properties, making it one of promising competitors in Pharmaceutical Chemistry [3,4,5,6,7,8,9,10]. The progressive spreading and increasing of multidrug-resistant pathogens to antibiotics limits effective treatment options availability [11]. This aspect take attention after the published report in 2014 by World Health Organization focused on antimicrobial resistance (AMR) Staphylococcus aureus, a Gram-positive bacterium a mostly found in the skin and respiratory tract, it achieved about 3% increase in resistance over the past 5 years [12]. Therefore, demonstrating the antimicrobial essential oils’ efficiency promised to be a major step towards the treatment of related organisms’ infections [13]. By damaging the cell wall of bacteria, essential oils increase cell permeability and induce bacteriostatic [14]. Studies on antibacterial activity of eugenol are positive [15]. The second leading cause of death is cancer that leads to death of over 6 million lives annually [16]. Its multifactorial nature and complexity were gaining increased attention in the pharmaceutical industry. In 2018, approximately 1,157,900 cancer cases were reported and 784,000 died from the disease [17]. Mortality among tumor patients in developing countries was higher because of diminished standard care, periodic diagnosis, and inexpensive treatment. This has attracted the researchers’ focus to develop new medicine which can arrest the proliferation of logarithmic dividing cells, but these also have side effects that lightly diminish the drug's overall effectiveness. Chemotherapy has become a popular treatment for cancer patients as it stimulates multidrug resistance in humans [18, 19].

Natural products playing a significant role as a potent source of anti-tumor drugs, nearly 30 to 40% of anticancer drugs were universally used extracted from plant origin [20]. Therefore, medical therapy has come to a point where researchers must look for alternative therapeutic methods and different chemical methods. Although thyroid tumor was noted by the National Cancer Institute as the most common cancer of endocrine system, various studies have evaluated the antibacterial properties of plant essential oils (EO) and their effectiveness in pharmaceutical applications. Therefore, research on their antibacterial and anticancer properties is gaining momentum again [21,22,23,24,25,26]. EO is a lipophilic, concentrated hydrophobic liquid that readily crosses cell membranes. Although EO therapy cannot completely replace chemotherapy and synthetic drugs, it can reduce accompanied side effects and for that reduce mortality in the cancer patients [27, 28]. EO has been considered useful due to its synergistic and selective effects. Research on anticancer properties dates to 1960s, but more than 85% of research has been published since his 2006, indicating a growing interest in the topic. EO and its components have been shown to have cytotoxic effects on oral cancer, prostate cancer, lung cancer, brain cancer, breast cancer, and liver tumor cell lines [29,30,31,32,33,34]. They stimulate apoptosis or arresting of cell cycle remarked by multiple signaling pathways, detoxification enzymes activation, oxidative stress-induced DNA disruption, and anti-metastasis [35]. Detection of anti-proliferative compounds may require the use of multiple cell lines, as different cell lines may have different sensitivities to anti-proliferative compounds. Breast tumors can occur in different parts of the breast. Most breast cancers arise from the ducts that carry milk to the nipple (ductal carcinoma). Some begin in the glands that produce milk (lobular carcinoma). Additionally, other types of breast cancer are less common. A few tumors derived from other tissues of the breast were called lymphomas, and sarcomas were not actually considered breast cancer. Many types of breast tumors cause lumps in the breast, but not all [36]. Liver cancer starts in the liver. Approximately 80% of primary liver cancers are hepatocellular carcinoma (HCC). Additional subtypes of primary liver cancer are cholangiocarcinoma and angiosarcoma, cancer of the blood vessels of the liver [37]. In a the current study, clove buds (S. aromatic) extract, in addition to its antibacterial properties, is an anticancer agent in several human cancer cell lines, liver cancer cell lines (HePG2), and breast cancer cell lines (MCF7), and this is a safe and environmentally friendly way to treat cancer and bacterial infections, especially those that are resistant to many antibiotics.

2 Materials and methods

2.1 Materials

Methanol, Whatman filter paper, and chemicals used for this study pursued purchased from Sigma-Aldrich Company, USA. Before usage, all glassware was thoroughly cleaned with sterile distilled water and dried in an oven to remove any residual impurities. Fresh clove (S. aromaticum) buds were purchased from local market in Nasr City, Cairo, Egypt.

2.2 Preparation of methanolic (80%) plant extract

Dry the cloves in an incubator at 37 °C for 3–4 days and grind to a fine powder. Now, the plant material has been dissolved in 80% methyl alcohol (2: 15 m/v). Two separate mixtures were prepared, one of them was stored in the dark for 3 days in a refrigerator coded (DC), and the other was stored in sunlight for 3 days at room temperature was noted as (RS) in a sterilized cup covered with aluminum foil to avoid evaporation. Three days later, the mixture was filtered through Whatman #1 filter paper and maintained in a 37 °C incubator until the methanol was completely evaporated from the mixture [38].

2.3 Antimicrobial property

2.3.1 Microorganisms tested

Five isolates of Escherichia coli (E. coli), Klebsiella pneumoniae (K. pneumoniae), Pseudomonas aeruginosa (P. aeruginosa), Staphylococcus aureus (S. aureus), and Staphylococcus epidermidis (S. epidermidis) were obtained from several clinical samples then mainly determined by culture, morphology, along with biochemical analysis as described by Bergey’s guidelines [39]. Identification is confirmed with the Vitek2 system.

2.4 Agar well diffusion method

Purified test isolates cultures were sub-cultured within nutrient broth through uniformly spreading on Muller Hinton agar sterile petri plates [40]. A well of a 6-mm diameter was made using a sterile cork-borer. The well was filled by (100 µl) of clove extract to determine antibacterial activity and the plates were incubated at 37 °C/24 h. After that, the inhibition zones diameters recorded [41].

2.5 Preparation of resazurin solution

A solution of resazurin was prepared at 0.02% (Wt/Vol) [42]. Resazurin salt powder (0.002 g) was dissolved in 10 mL of distilled water with vortexing. The prepared mixture filtered through a millipore membrane filter (0.2 μm). The solution kept at 4 °C for 15 days.

2.6 Determination of minimum inhibitory concentration (MICs) for bacteria

The MIC carried out through the described method in the guideline [43]. The MIC assay was performed in a 96-well round bottom microtiter dish using standard broth microbiological dilution methods. The inoculum was used at a concentration of 106 CFU/ml. For the MICs test, 100 μl of the clove extract stock solution (8000 μg/mL) was added and 2 times diluted with bacterial inoculum in 100 μl of Muller Hinton Broth (MHB) starting from column 4 to column 12, 4th column of microtiter plate filled with the maximum concentration of clove extract, while column 12 contained the minimum concentration. Column 1 is a positive control sample (cultures and medium) and column 2 as a negative control sample (medium only) [44]. Each microplate well filled with 30 μl of resazurin solution and incubated at 37 °C for 24 h. All color changes were observed. Blue/purple indicates no bacterial growth while pink/colorless refers to bacterial growth.

2.7 Determination of minimum bactericidal concentrations (MBCs)

The MBCs of clove extract against tested pathogenic isolates was assessed by macro broth dilution assay according to [45] with few modifications. All cultures were grown in media include clove extract. Twofold dilution of varying concentrations (clove extract 4000–1000 μg/ml) were selected for the treatment to determine the MBCs. The overnight-grown cultures were then streaked on agar plates from each treated concentration to determine the MBCs.

2.8 Molecular identification of most resistant bacterial isolate

Isolation DNA and designing of primers by extracted genomic DNA of selected isolates according to Pérez-Brocal et al. [46] using “Easy Pure bacteria genomic DNA kit.” To detect these isolates genetically; were selected two primers via “NCBI primer design tool” and named rward primer (5′- AGAGTTTGATCCTGGCTCAG -3′ and reverse primer 5′ CTTGTGCGGGCCCCCGTCAATTC-3′) For this objective, information was derived on conserved sequences around coding nucleotide sequences of the complete alkaline protease genes of three Bacillus sp. on Gene Bank. The individual nucleotide sequences for identify the conserved sequences were accomplished by CLUSTALW online software (Kyoto University Bioinformatics Center).

2.9 Determination of clove methanolic extract (80%) cytotoxicity on cells using (MTT protocol)

A 96-well plate of tissue culture was incubated at 1 × 105 cells/mL (100 µL/well) then incubated around 37 °C/24 h for forming a complete monolayer. After the formation of the confluent cell layer, the growth medium was decanted from the 96-well microplate and the cell monolayer was washed twice with wash medium. 1/2 dilution of the test sample was made in RPMI (maintenance medium) containing 2% serum. A 0.1 ml of each dilution was tested in different wells, 3 wells were marked as a control, and only maintenance medium was added. Plates were incubated at 37 °C and examined. The cells were examined for physical marks of toxicity. Partial or complete loss of monolayer, round, shrinking or granular cells. An MTT solution was prepared (5 mg/ml in PBS) (BIO BASIC CANADA INC). Of MTT solution, 20 μl was added to each well. Place on a shaker at 150 rpm for 5 min to completely mix the MTT into the medium. Incubate for 1 to 5 h (37 °C, 5% Co2) to metabolize MTT. Empty the media. Dry the plate with a paper towel to remove any residue. Re-insert the formazan (MTT metabolite) in 200 µl of DMSO. Place on the shaker for 5 min at 150 rpm so that the formazan is fully wetted with solvent. Read optical density at 560 nm background subtraction at 620 nm optical density should be directly correlated with the number of cells [47].

2.10 DNA fragmentation induced by clove extract

To analyze DNA fragmentation, MCF-7 and HepG-2 cells were induced apoptosis by treating with DC and RS clove extract at IC50. DNA purification kit was used for extracting DNA, methodology was illustrated within the manufacturer’s pamphlet (Thermo Fisher Scientific, CA, USA). After quantification, about 4 µg of each DNA sample was loaded to electrophoresis on a 1.6% agarose gel with ethidium bromide (5 µg/mL) followed by illumination under U.V [48].

2.11 Statistical analysis

All experiments were carried out in triplicate. All data are represented as mean ± standard deviation. Statistical analysis of differences was performed through t-test variance of correlations and Pearson r-test using Graphd Prism edition 6, values P < 0.05 were indicator for a statistically remarkable variances [49]

3 Results and discussion

The primary ingredient in clove, eugenol, accounts for at least 50% of the at least 30 identified chemicals, according to earlier studies. Eugenyl acetate, -humulene, and -caryophyllene make up the final 10–40%. Less than 10% correspond to insignificant or trace elements, including chavicol, diethyl phthalate, caryophyllene oxide, cadinene, -copaene, 4-(2-propenyl)-phenol, and -cubebene, among others [50].

3.1 Antibacterial property

Joshi et al. [51] found that clove extract was the most effective against Salmonella typhi. Moreover, Jirovetz et al. [52] showed that the flower bud extract of clove showed antibacterial efficacy toward Bacillus and Serratia marcescens bacterial isolates. In addition, Oulkheir et al. [53] found that the clove extract produced an inhibition zone against E. coli of 16 mm and a higher inhibitory zone (20 mm) against Salmonella species, while no antibacterial effect on K. pneumoniae. Additionally, Nejad et al. [54] reported the antibacterial efficacy of several naturally occurring bioactive molecules, including thymol, eugenol, carvacrol, and cinnamaldehyde, against E. coli, and they found that eugenol had the lowest antibacterial efficacy, whereas a combination treatment using carvacrol and thymol, cinnamaldehyde, and eugenol. In the present study at the same concentrations 25 mg/ml, clove extract through two extraction methods showed antibacterial activity against five MDR bacterial isolates; these were S. epidermidis, S. aureus, P. aeruginosa, K. pneumonia, and E. coli (Fig. 1).

Fig. 1
figure 1

Inhibition zone diameter of (DC) and RS clove extract against five (MDR) isolates on Muller Hinton agar through agar well diffusion method

Full size image

As eco-friendly methods, plant extract, microorganisms, and some marine algae are used in the synthesis of nanoparticles, especially for those materials used for invasiveness applications in medicine [55,56,57,58,59,60].

DC Clove extract showed higher inhibition zone diameter more than RS with four isolates were S. aureus, P. aeruginosa, K. pneumonia, and E. coli which 13, 20, 20, and 21 mm respectively. On the other hand, RS clove extract gave higher inhibitory zone than DC with one isolate only S. epidermidis which 17 mm while DC gave with the same isolate 15 mm (Fig. 2).

Fig. 2
figure 2

Antibacterial activity of Clove extract through DC and RS methods against different five MDR isolates

Full size image

3.2 Minimum inhibitory and bactericidal concentrations MICs and MBCs

Minimum inhibitory concentrations MICs of DC were 12.5 mg/ml with four MDR isolates, while the 5th isolate S. aureus inhibited at a higher concentration 25 mg/ml. RS MICs were lower than DC one; it was 6.25 mg/ml with the same four MDR isolates while it was 12.5 mg/ml with S. aureus (Fig. 3), so this isolate considered the most resistant one among the tested five isolates, therefore more analysis studies required for it.

Fig. 3
figure 3

MIC of clove extract through two extraction methods; DC and RS against tested five MDR isolates

Full size image

In the current study, minimum bactericidal concentrations were 25 mg/ml. for all isolates. Clove oil bactericidal and bacteriostatic activities were evaluated by measuring MBC and MIC respectively. MBC 90 and MIC 90 at 0.1%, reflecting the effect of clove oil on MDR Streptococcus was bactericidal. The MIC/MBC values for clove oil extracted by Wongsawan et al. [61] were lower than those of past results of Perugini Biasi-Garbin et al. [62]; it reported 0.125–0.5% (v/v), but Baskaran et al. [63] noted that range 0.4/0.8% (v/v) the mastitis agent Streptococcus agalactiae. However, it should report start bacterial load, used medium, incubating period, and temperature are important variables that can affect the MIC determination of clove oil. Furthermore, it is reported that the increasing availability of bioactive plant extracts with antioxidant properties makes them interesting raw materials for the preparation of bioactive compounds study [64,65,66,67,68]. It is very likely that these phytochemicals will be introduced into the arsenal of prescription antimicrobial drugs and be heavily utilized in the creation of nanoparticles that are effective against antibiotic-resistant microorganisms, thus according clinical microbiologists who are interested in antimicrobial plant extracts [69,70,71,72,73].

3.3 Molecular identification of the highest resistance isolate

Bacterial isolate S. aureus was identified by 16S rDNA [74] as S. aureus KH2692022, its sequence was deposited in the gene bank under Accession Number OP522462. Sequence then analyzed versus other sequences on Gene bank database through online BLAST tool to determine the similarity score (http://www.blast.ncbi.nlm.nih.gov/Blast). The resulted tree confirmed a very close similarity of the 16S rDNA gene sequence with 98.15% homology of the isolate Staphylococcus aureus 16S ribosomal RNA gene with accession number MN508958.1. The phylogenetic tree was constructed using MEGA 11 program and neighbor-joining method (Fig. 4).

Fig. 4
figure 4

Phylogenetic tree of 16S rDNA partial gene sequencing of the extensive highest resistance isolate S. aureus and the highly similar sequences NCBI Gen Bank

Full size image

3.4 In vitro antineoplastic MCF-7 and HePG-2 characteristics of clove extract

In the process of developing novel anti-tumor agents as tumor drugs, one of the most fundamental aspects to know their cytotoxic activity is preclinical evaluation. This classification wasn’t used for cancer drugs only, but also for other cosmetics, pharmaceuticals, food additives, agrochemical, and others. Standard evaluation for ensuring whether a material includes biologically poisonous substances or not; the so-called cytotoxicity evaluation [75].

Recently, usage of plants for the prevention and intervention of different stages of carcinogenesis has get more attention. Plant polyphenols were a target among the most potent anticancer substances by blocking multiple intracellular signaling, metastasis, systemic effects, and angiogenesis [76, 77].

S. aromaticum (Myrtaceae) contains many compounds, including eugenol, which is considered one of the essential components of clove oil and is known to have antibacterial activity against numerous pathogens. The other chemical components are eugenol acetate 4-allyl-2-methoxyphenol acetate β-caryophyllene. From 60 to 90% of trans-(1R, 9S)-8-methylene-4,11,11-, trimethylbicycloundec-4-ene, bicycloundec-4-ene, and the other secondary compounds [68, 78].

Cytotoxicity test was applied as initial testing for determining the effect of the natural substances on terminating cell growth of tumors. Any compound was considered as active when it can terminate the proliferation of 50% of the tumor cell population at well-known concentration. The methodology should be able to generate reproducible dose–response curves with low variability, the response criteria should directly be proportioned with number of cells, and the obtained information from the dose–response curves should be consistent with appearance. A method for measuring cytotoxicity was MTT. Anticancer activity is attributed to a compound if it can inhibit the proliferation of 50% of the tumor cell population at concentrations below 200 μg/ml (IC50: 200 μg/ml) [75, 76].

In the current study, MTT assay results and microscopic images showed that the cytotoxicity of both extracts was dose-dependent. The DC and RS extracts selectively killed the mcf7 breast cancer cell line with little toxicity on normal human fibroblast HF within 24 h (Fig. 5A and B).

Fig. 5
figure 5

MTT assay of (A) of DC and (B) of RS at IC50 with different concentrations on MCF-7 cell line and MTT assay of (C) of DC and (D) of RS at IC50 with different concentrations on HepG-2 cell line

Full size image

The cytotoxicity assay is used as an elementary testing for determining natural substance’ effect in preventing tumor cell growth. A substance described as active when it can stop 50% of the tumor cell proliferation growth at a particular concentration. Cytotoxicity test system should be able to produce a reproducible dose–response curve with low variability, and the response criteria should show a relationship. Linear system with cell number and dose information—the response curve must be aligned with the appearance. A commonly used method to evaluate cytotoxic activity is the MTT assay. The compound was described as anti-tumor active agent in case of inhibiting 50% tumor cells population growth at concentrations lower than 200 μg/mL (IC50: 200 μg/mL) [75, 76].

MTT microscopic imaging of HepG2 which treated with both DC and RS extracts for 24 h in 96-well plates showed significant cytotoxic activity of two extracts on the tested HepG2 cell line (Fig. 5C and D).

Based on mcf7 cell culture curve in the current study, the cytotoxic concentration of the IC50 value of clove oil extract in dark and cold conditions was 1000 µg/ml, this indicated that this extract had a potent anticancer activity against metastatic adenocarcinoma of breast tissue, besides 100% viability against normal cells at a concentration of 125 μg/ml The same cytotoxic concentration of clove oils extract was achieved via extraction in sunlight and at room temperature conditions but viability concentration was at 250 μg/ml.

HepG2 cancer cells also affected with clove extract through both extraction method; DC and RS with little change in MTC. DC clove extract showed MTC at 250 µg/ml and minimum concentration for Viability percentage at the 125 µg/ml concentration. RS clove extract exhibit minimum Toxicity percentage at 500 µg/ml, while viability about 82.6% and more was resulted at 500 µg/ml and lower concentrations of clove extract.

It is clear that environmental conditions effect on the result of toxicity concentration of clove extract when tested on MCF-7 cell line which described in (Fig. 6), where plant extract through DC has toxicity activity more than extract through RS; DC minimum toxic concentration (MTC) was 250 µg/ml, while MTC of RS extract was 500 µg/ml.

Fig. 6
figure 6

Comparison of toxic activity of Clove extract though two methods; DC and RS in on MCF-7 cell line

Full size image

In comparison between DC and RS methods, DC extract gave MTC lower than RS at concentration 250 µg/ml, which resulted in 50.5% toxicity for HepG-2 cells, while RS MTC was 500 µg/ml and resulted in toxicity lower than one that obtained from DC with value 17.3% (Fig. 7). Upon this result, DC was the preferred method in HepG-2 treatment over RS method.

Fig. 7
figure 7

Comparison of toxic activity of Clove extract though two methods; DC and RS in on HepG2 cell line

Full size image

Cytotoxicity test of clover leaf oil (Epoxy) flavonoid compounds in HepG2 cell line hepatoma cell culture by MTT was accomplished by [79]. This method yielded an IC50 value of 50.620 μg/mL. From the IC50 values, it can be included flavonoids of clove oil were potent compounds with strong Cu potential, so they will later be used in clinical evaluations to study their anticancer potential, its mechanism of action can be analyzed. The test uses IC50-reference value at 57.53 μg/mL, which was more potent than that of green tea and isolated compounds from other studies with an IC50 value of concentration 65.7 μg/mL in HS579T breast cancer cells of human [79]. Components of medicinal plants is one of the main goals of cancer therapy. These components can kill cancer cells through the induction of apoptosis by various mechanisms [74, 80]. Because of medicinal properties of S. aromaticum, it corporates in gums and toothache’ drugs. The oil of S. aromaticum has inhibitor to bacteria, fungi, beside repellent for insect and it also promising an analgesic and a natural antiseptic agent in dentistry to decrease dental pain [33, 81].

3.5 DNA fragmentation induced by clove extract

Several substances that can cause apoptosis and prevent cell proliferation are now employed to treat cancer. The DNA fragmentation experiment was performed using Moyo et al. methodology [82]. DNA agarose gel electrophoresis of mcf7 and HepG2 cells which treated with clove extract DC and RS for 24 h showed remarkable DNA fragmentation against DNA ladder and untreated cell line as a control, DC, and RS clove extract effects seem to be equal on both types of cells.

4 Conclusion

It can be concluded that Both DC and RS methods showed antibacterial activity at MIC 12.5 mg/ml and 6.25 mg/ml respectively against five MDR isolates; DC clove has higher inhibition zone diameter more than RS with four isolates were S. aureus, P. aeruginosa, K. pneumonia, and E. coli which 13, 20, 20, and 21 mm respectively. On the other hand, RS has higher inhibitory zone than DC with one isolate only S. epidermidis which 17 mm while DC gave with the same isolate 15 mm. Both DC and RS have cytotoxic activity against two types of cell line mcf7 and HepG2 with remarkable DNA fragmentation as a prediction of cellular apoptosis. Cytotoxic concentration of DC of IC50 value on mcf7 was started at 250 µg/ml which reached 46.7%, but at 500 and1000ug/ml; toxicity reached 100%. RS cytotoxicity on mcf7 noted at concentration 500 µg/ml with value 48.25% and reached 100% toxicity at above concentration; 1000 µg/ml in case of HepG2 cell line; DC cytotoxicity was remarkable with 50.5% at concentration 250ug/ml, while RS has cytotoxic activity at 500 µ/ml with value 17.3%. These results indicated that methanolic (80℅) of clove extract might represent a novel and attractive therapeutic possibility for the treatment of bacterial infections and tumors in clinical practice because of its anti-proliferative capabilities, particularly because its IC50 value for malignant cells was lower than that for normal cells.