With the suitability of ecological conditions, figs are produced in almost all regions of Turkey, which is one of the most important gene sources for figs in the Middle East as hosting quite a number of varieties (Tanriver 2019). Turkey has been in the front line with the 56% of the world fig production. Iran (19%), USA (6%), Greece (5%), Spain (4%) and Italy (3%) follow Turkey, respectively in terms of fig production (Ozden et al. 2021). Recently, symptoms such as little leaf, shortening of the internodes, mottling and deformation have been observed in fig leaves similar to those of symptoms characterized by phytoplasma diseases (Fig. 1). Although phytoplasma infections in apples, pears, plums, apricots, peaches, cherries and almonds have been reported previously in the world (Fiore et al. 2018), reports of phytoplasma infections in fig trees are very few. Alsaheli et al. (2020) made a first report with those of Ca. P. asteris and Ca. P. solani in fig leaves exhibiting yellowing, mottling and shortening of internodes.

Fig. 1
figure 1

Symptoms of Candidatus Phyoplasma aurantifolia in fig leaves a little leaf formation and shortening of internodes, b healthy leaf, c mottling

Full size image

Total nucleic acid (TNA) isolation from symptomatic fig leaves was performed to detect the presence of phytoplasma using etiolated method (Dikilitas et al. 2019). The obtained TNAs were then subjected to PCR studies using R16F1/R16R0 (5’- AAGACGAGGATAACAGTTGG-3’/ 5’- GGATACCTTGTTACGACTTAACCCC-3’) primer pairs in the first round PCR followed by R16F2n/R16R2 (5’- GAAACGACTGCTAAGACTGG -3’/ 5’- TGACGGGCGGTGTGTACAAACCCCG) primers in the second PCR to amplify the 16S rRNA gene (Duduk et al. 2013). The PCR product (R16F1/R16R0; 1,400 kb) was diluted 1:50 with the sterile distilled water serving as a template for the nested PCR (R16F2n/R16R2) which amplifies a 1,200 bp fragment of the 16S rRNA gene. The PCR conditions followed those described by (Akkurak et al. 2021). As a result of the nested PCR, band at the expected length (~ 1,200 bp) was obtained from the symptomatic fig leaves (Fig. 2). The DNA fragments amplified with the use of primers R16F2n/R16R2 were purified using ExoSAP-IT™ 40 (ThermoFischer), and sequenced in both directions. Afterwards, the 16SrDNA partial sequences were aligned using MEGA 7 software programme and compared with BLASTn analysis through the NCBI (National Center of Biotechnology Information, USA) database. Two representative isolates (MG614 and MG615) used in this study showed 99.8% similarity with the lime witches’ broom 16SrII-B phytoplasma subgroup and the isolates were uploaded with ON009058 and ON009057 accession numbers to GenBank, respectively. Phylogenetic trees using the Maximum Likelihood method in MEGA 7 were constructed based on the available 16S rDNA sequences of “Candidatus Phytoplasmas” retrieved from the NCBI, and Acholeplasma laidlawii was used as the outgroup sequence (Fig. 3). Determination of subgroups of isolates was also performed with the online tool iPhyClassifier (Zhao et al. 2009). According to the analysis, the isolates shared 98.8% similarity with that of the ‘Ca. P. aurantifolia’ reference strain (GenBank accession: U15442, 16SrII-B group) (Fig. 4). Ortega-Acosta et al. (2022) reported the presence of Ca. P. asteris in fig leaves showing deformation and mosaic symptoms in Mexico. In Turkey, 'Candidatus Phytoplasma prunorum' was previously associated with the European stone fruit yellows (ESFY) disease in apricot, plum, peach and almond trees exhibiting chlorosis between the veins and off-season flowering (Caglayan et al. 2011). On the other hand, Ayvaci et al. (2021) reported the association of ‘Ca. P. aurantifolia' with cacti in Turkey. To the best of our knowledge, this is the first report of ‘Ca. P. aurantifolia'-related strain (16SrII-B subgroup) causing disease in fig trees. It is important to detect and verify the phytoplasma diseases to make phytoplasma-free fig production in mother and nursery plants as well as preventing the spread of diseases to other cultivations.

Fig. 2
figure 2

Agarose gel electrophoresis of DNA amplified by nested PCR with primers R16F2n/R2. Lane 1–4 symptomatic fig leaves, N; negative control, P; positive control, M; 1 kb DNA marker

Full size image
Fig. 3
figure 3

The phylogenetic tree constructed by the Maximum Likelihood method comparing partial 16S rDNA sequence (1,200 bp) of MG614and MG615 with 42 other ‘Ca. Phytoplasma species’. Numbers on branches are bootstrap values of 1000 replicates. Acholeplasma laidlawii was used as the outgroup

Full size image
Fig. 4
figure 4

Virtual-RFLP images constructed by iPhyClassifier online tool using 17 digestion enzymes of 16SrRNA genes of phytoplasma isolate infecting fig trees

Full size image