Advertisement

Conservation Genetics Resources

, Volume 7, Issue 4, pp 887–894 | Cite as

A multiplex microsatellite set for non-invasive genotyping and sexing of the osprey (Pandion haliaetus)

  • Deborah A. Dawson
  • Oddmund Kleven
  • Natalie dos Remedios
  • Gavin J. Horsburgh
  • Rolf T. Kroglund
  • Teresa Santos
  • Colin R. A. Hewitt
Open Access
Microsatellite Letters

Abstract

During the 1950s and 1970s the osprey (Pandion haliaetus) experienced a dramatic population crash and remains of conservation concern in several parts of the world. We isolated 37 microsatellite loci and assessed these in ospreys sampled in the UK and Norway (using mouth swabs/feathers). From 26 loci variable in four ospreys, we selected 13, combined these into two multiplex-PCR sets and included a sex-typing marker. Additional markers confirmed sexes. In 17 ospreys, feather-sampled in central Norway, we found 3–10 alleles per locus. The 13 loci are autosomal (heterozygotes were present in both sexes) and observed heterozygosities ranged from 0.24 to 0.94. The combined probability of identity for the 13 loci was 8.0 × 10−12. These microsatellite loci will be useful for genetic monitoring, parentage analysis and population genetic studies of the osprey.

Keywords

Birds of prey Feather Raptor Sex-typing Simple Tandem Repeat (STR) Swabs Western osprey 

Introduction

The osprey (Pandion haliaetus) is a fish-eating raptor with an almost worldwide distribution. It experienced a dramatic decline in population size in the 1950s–1970s primarily due to the use of pesticides and is studied as a sentinel species to detect pollution (Grove et al. 2009). European populations of ospreys are migratory, spending the summer in Europe and winter in Africa, whereas other populations are resident. Although the osprey has recovered to some degree and is no longer threatened globally, it is still of conservation concern in some areas (BirdLife International 2013). To facilitate genetic monitoring through non-invasive sampling of shed feathers, and to enable analyses of genetic diversity, parentage and population structure, we isolated and characterized novel microsatellite loci for the osprey.

Methods

Microsatellite sequences were isolated from a male osprey (02/09). This individual hatched at Rutland Water Nature Reserve, near Oakham, UK in 2009 but died of an infection at 6 weeks old. Genomic DNA was extracted from liver tissue, digested with MboI, enriched for dinucleotide/tetranucleotide sequences, cloned and Sanger-sequenced bidirectionally, identifying 96 unique osprey microsatellites (following Armour et al. 1994). In addition, an Illumina paired-end library was created from the dinucleotide + tetranucleotide-enriched DNA (~1 + 1 µg) and MiSeq-sequenced. This allowed more (tetranucleotide) marker choices for multiplexing. Primer sets were designed from 37 sequences (26 Sanger and 11 MiSeqs) using Primer3 v0.4.0.

Samples were collected from wild ospreys including: (1) 17 feathers from nine nests in central Norway (two plucked from unrelated nestlings and 15 shed from adults); (2) six feathers from two nests in Scotland; and 3) mouth-swabs from 48 osprey chicks at Rutland Water Nature Reserve, England. For genotyping, DNA was extracted from feather calamus (‘Norwegian’ ospreys) using the Maxwell®16 Research System (Promega), and from feathers (‘Scottish’ ospreys) or mouth swabs (‘English’ chicks) using ammonium acetate. We sexed the chick and feather samples using the Z-002A, Z-002D (Dawson 2007) and Z43B markers (DAD et al. unpublished data). Initially, each locus was amplified in ospreys sampled in Norway (n = 4), Scotland (n = 6) and England (n = 48; Table 1). PCR was performed with fluorescently-labeled forward primers using QIAGEN’s Multiplex PCR kit and protocol [annealing temperature = 56/57 °C (Table 1); 2/10-µl reactions]. Multiplex-PCR was used to genotype/sex-type the 17 presumably unrelated ospreys, sampled in Nord-Trondelag county (64°06′N, 12°50′E), central Norway (Table 2). PCR products were separated on an ABI Genetic Analyzer and allele sizes assigned using Genemapper software.
Table 1

Assessment of 37 osprey (Pandion haliaetus) microsatellite loci in three populations

Locusa

Clone name and ENA sequence accession no.

Chromosome locationb

Primer sequences (5′–3′)

Primer Tm (°C)c

Repeat motif

Country where sampled

n

A

Expected allele size (bp)d

Observed allele size range (bp)

Pha01

Osp107_A01WZ

Gga and Tgu,

F:

[HEX]GTCAACAGTGTGCCCTAGCAG

60.90

(TG)10

NOR

4

0

195

No amp.

Unreliable

LN829364

Multiple copies

R:

TACCCGGGAAGCTTGGAC

61.00

 

SCOT

6

0

Unreliable

Poor amp.

  

NCBI: GgaW & Z

    

ENG

48

0

 

No amp.

Pha02

Osp107_A08

Gga6, 26441864

F:

Set 1 = [PET]TTATCTGCAAGGCCTGGTGG

63.37

(CA)15

NOR

4

5

200

196–208

 

LN829365

Tgu6, 24709071

R:

ACAGGAGTGGAGGAGGTAGT

55.22

      
   

F:

Set 2 (UK) = [6FAM]ATTATCTGCAAGGCCTGGTG

60.10

 

SCOT

4

3

256

253–259

   

R:

CTGCTGCTTGGAAATGCTC

59.69

 

ENG

48

4

 

253–261

Pha03

Osp107_C03

Gga17, 5182075

F:

[6FAM]TCTAGCCCATCTCCAGTGAATC

59.03

(TG)9

NOR

4

2

112

105–111

 

LN829366

Tgu17, 5717909

R:

AATTAGAAAGTTGGTGCAGTCCC

59.17

 

SCOT

6

1

 

111

       

ENG

48

1

 

111

Pha04

Osp107_C09

Gga3, 45456042

F:

[VIC]ATGACCAGTCTGATGCCTTG

58.67

(CA)12

NOR

4

4

160

158–168

 

LN829367

Tgu3, 39010319

R:

ACATTTGGAGGGTTTCTTGC

59.03

      
   

F:

[HEX] used for UK samples

  

SCOT

6

5

160

143–167

       

ENG

48

6

 

143–165

Pha05

Osp107_C10

Gga3, 21714508

F:

[HEX]CATTTAACGGTTTAGAAAGTGAAGG

59.54

(GT)12

NOR

4

2

259

259–261

 

LN829368

Tgu3, 11588718

R:

TGTAGTGAAATGAATAACAAATGAAGC

59.87

 

SCOT

6

2

 

248–261

       

ENG

48

2

 

259–261

Pha06

Osp107_D06

Gga1, 182509839

F:

[HEX]CAAGCTTGTAGCAGTCTTGCAG

60.38

(CA)19

NOR

4

0

117

No amp.

 

LN829369

Tgu1, 4702446

R:

TGCCTGTACAGAAGCAGCAG

60.35

 

SCOT

6

3

 

108–113

       

ENG

48

2

 

108–112

Pha07

Osp107_D07

Gga9, 5205116

F:

[6FAM]GATCACCTCGCTCATCTAG

54.30

(AC)9

NOR

4

1

125

122

 

LN829370

Tgu9, 841456

R:

ACGTAACTAAAGAGAGCCTC

54.25

 

SCOT

6

1

 

121

       

ENG

47

1

 

121

Pha08

Osp107_D08

Gga7, 27710560

F:

[HEX]TACAGGGAGGTCAGCCAATC

60.07

(AC)12

NOR

4

0

209

No amp.

Unreliable

LN829371

Tgu7, 6096203

R:

GGGTTTGCCTACATGGGTATC

60.45

 

SCOT

4

3

Unreliable

(201–211)

       

ENG

48

0

 

No amp.

Pha09

Osp107_F09

Gga4, 60184616

F:

[6FAM]CTTGCTGCCAGTTGCTAGG

59.75

(TG)11

NOR

4

2

248

258–261

 

LN829372

Tgu4, 19049909

R:

TTAGGGAAGGCAGTTGATGAG

59.32

 

SCOT

6

2

 

250–252

       

ENG

48

2

 

250–252

Pha10

Osp107_F12

Gga—no hits

F:

Set 1 = [PET]TGGTGAGAAGCCCAGTGAAA

61.78

(GT)22

NOR

4

4

178

183–211

 

LN829373

Tgu3, 76487951

R:

ACATTACCCTTCACCTTGTTCA

58.49

      
   

F:

Set 2 (UK) = [6FAM]GAAGCCCAGTGAAAGTAAGATAGG

59.70

 

SCOT

6

5

299

300–332

   

R:

GTCAGTGAAGGTGGCACAAG

59.31

 

ENG

47

6

 

300–330

Pha11

Osp107_G04

Gga26, 3808355

F:

[HEX]ATCATTGTCTCCGTTGAAATACTC

58.59

(TG)12

NOR

4

4

369

362–374

 

LN829374

Tgu—no hits

R:

TGGCTTAAGGACATGAGCTG

59.02

 

SCOT

5

3

 

366–372

       

ENG

47

4

 

366–374

Pha12

Osp107_G05Z

Gga—no hits

F:

[HEX]TGCATCCTAATGAACCTTTGC

60.09

(CA)15

NOR

4

3

299

294–302

 

LN829375

TguZ, 23578707

R:

AGGCTGGTGGTTAAACATGG

59.85

 

SCOT

4

3

(females=

300–304

       

ENG

48

3

homozyg)

300–304

Pha13

Osp107_G06

Gga12, 12834746

F:

[6FAM]AGACAAATTACTTTCTGCCCTGC

59.49

(AC)9

NOR

4

5

193

184–194

 

LN829376

Tgu12, 13613680

R:

CATAGCTGCACATGACTTCCC

59.05

 

SCOT

6

5

 

185–195

       

ENG

48

7

 

181–195

Pha14

Osp107_G07

Gga6, 7231355

F:

[6FAM]CTGAGCCCTACAGGTCAAGG

59.86

(CA)14

NOR

4

3

163

155–163

 

LN829377

Tgu6random, 1131071

R:

GATCAAAGTATAAGCTTCTGGCACT

59.42

 

SCOT

6

2

 

155–163

       

ENG

48

4

 

155–163

Pha15

Osp107_H11

Gga—no hits

F:

[6FAM]AGGAGAACTGGGCTTGGTC

59.24

(GT)11

NOR

4

2

148

149–151

 

LN829378

TguLGE11random, 434714

R:

TTTGTCACTCTGAACCCAACTC

59.23

 

SCOT

6

2

 

149–151

       

ENG

48

3

 

147–151

Pha16

Osp108_C02

Gga4, 60893985

F:

[6FAM]TTTAGGACATGAAAGACCATCTAGC

60.04

(GT)11

NOR

4

3

300

296–302

 

LN829379

Tgu4, 19753992

R:

AGGCTCGAATCAAGGAATAGG

59.70

 

SCOT

6

4

 

296–302

       

ENG

48

3

 

298–302

Pha17

Osp108_D06

Gga3, 6186457

F:

[6FAM]GATCATTTGAGTCAGGGTTGTAGA

59.53

(GT)12

NOR

4

2

273

258–261

 

LN829380

Tgu3, 23071942

R:

CCCAGGCAATGTGTGATAGTAG

59.52

 

SCOT

6

4

 

258–263

       

ENG

48

2

 

257–260

Pha18

Osp108_D09

Gga14, 7369333

F:

[6FAM]TTGGTCACTTCTGTGGAACC

58.54

(CT)13

NOR

4

6

204

205–257

 

LN829381

Tgu14, 16292216

R:

GGACGCATGGTGTAAACTTC

58.08

 

SCOT

6

5

 

205–261

       

ENG

47

7

 

205–285

Pha19

Osp108_E06

Gga2, 137582088

F:

[6FAM]ATGGTGTCGTGGTGACTGC

60.62

(GT)11

NOR

4

3

94

90–94

 

LN829382

Tgu2, 138654459

R:

AAGCGATTCACTCCATGCTC

60.37

 

SCOT

6

2

 

90–92

       

ENG

48

2

 

92–94

Pha20

Osp108_F01

Gga7, 32493856

F:

[HEX]CTTTGTGAGCCTGCAAGTACG

59.80

(TG)9

NOR

4

2

110

111–113

 

LN829383

Tgu7, 35798065

R:

CCACCTGAGGACTAAGCCTG

59.46

 

SCOT

6

3

 

110–113

       

ENG

38

2

 

110–112

Pha21

Osp108_F04

Gga2, 138399255

F:

[6FAM]CACAGCCTTAAAGTTCCAGCTG

59.77

(AC)9

NOR

4

1

146

149

 

LN829384

Tgu2, 145579947

R:

TTGAGAAGCCTTCCACGACC

59.97

 

SCOT

6

2

 

147–149

       

ENG

47

3

 

143–149

Pha22

Osp108_F05

Gga8, 19109998

F:

[HEX]CTGCAGGGAGCCGATG

60.02

[GA(CA)4]5

NOR

4

8

285

(266–452)

Unreliable

LN829385

Tgu—no hits

R:

ATTCGCCTGACCTATGTTGC

60.10

 

SCOT

6

3

Unreliable

(266–300)

       

ENG

25

9

Poor amp.

(236–336)

Pha23

Osp108_F09

Gga2, 64794670

F:

[6FAM]GCTCAGGACAGCGAACAAAC

59.76

(CA)9

NOR

4

2

180

179, 183

 

LN829386

Tgu—no hits

R:

CATGTAGAACTGCAGCACTCG

59.34

 

SCOT

6

2

 

179, 183

       

ENG

46

2

 

179, 183

Pha24

Osp108_G03

Gga—no hits

F:

[6FAM]GATCTTGTTCTAACCCTCTCACAATAC

59.87

(TG)15

NOR

4

1

217

(220)

Unreliable

LN829387

Tgu1, 38622635

R:

TGTCATTAAACAATTCAGAAAGATTACC

60.07

 

SCOT

6

3

Unreliable

(214–224)

       

ENG

11

3

Poor amp.

(220–224)

Pha25

Osp108_H01

Gga—no hits

F:

[HEX]CTGGGTTAAAGTCAGTGGGATTG

59.24

(GT)9

NOR

4

3

174

177–181

 

LN829388

Tgu24, 2050527

R:

TGTCCATGCACCTATCCATCC

59.58

 

SCOT

6

1

 

179

       

ENG

48

2

 

175–178

Pha26

Osp108_H08Z

GgaZ, 55975474

F:

[HEX]TTGAGTTGTTTTAGACTTTGACA

54.64

(TG)9

NOR

4

1

144

(144)

Unreliable

LN829389

TguZ, 68820524

R:

TCCTTATTTTCATCCTCACTGA

54.53

 

SCOT

6

2

Unreliable

(142–143)

       

ENG

33

6

Poor amp.

117–141

Pha27

Osp34

Gga13, 10093338

F:

[6FAM]TTTAACAGCTCCCACTCTGATG

59.38

(GATA)11

NOR

4

5

173

164–196

 

LN829390

Tgu13 4122045

R:

AGCATGCTTGTGGTGCAG

59.55

 

SCOT

6

6

 

164–192

       

ENG

48

6

 

164–196

Pha28

Osp222

Gga, no hit

F:

[6FAM]GGTGGAAAACTCCCTGAGC

59.65

(CTAA)11

NOR

4

5

130

117–133

 

LN829391

Tgu, no hit

R:

TGCTTTTGGGGTGAAAAGTC

60.09

 

SCOT

6

5

 

116–129

       

ENG

48

5

 

117–137

Pha29

Osp354

Gga6, 22515994

F:

[NED]AAAGTCCAGGGCAGTTTGTC

59.19

(TATC)12

NOR

4

5

144

135–151

 

LN829392

Tgu6, 22351865

R:

GAACGCTGTGGGACCTTC

59.18

      
  

Plus Unknown chr 110289344

F:

[HEX] used for UK samples

  

SCOT

6

3

 

138–148

       

ENG

48

4

 

135–147

Pha30

Osp428

Gga3, 31915082

F:

[6FAM]CTCAACACAATTTCTATTGGAACAC

59.03

(TATC)13

NOR

4

3

247

247–255

 

LN829393

Tgu3, 35243746

R:

TGGTACTAAGGCTCCATATAGGATAAC

59.35

 

SCOT

6

3

 

239–251

       

ENG

48

5

 

231–255

Pha31

Osp537

Gga, no hit

F:

[HEX]AATTATGAGCCATTCTGCAACAG

60.50

(GA)13

NOR

4

1

197

197

 

LN829394

Tgu9, 15738938

R:

CATCCTGTGTTGCCAGTGAG

60.31

 

SCOT

6

2

 

197–220

  

And Un 58947724

    

ENG

48

2

 

197–219

Pha32

Osp742

Gga, no hit

F:

[6FAM]CTTGAGCGCCTGCCATAG

60.66

(CA)22

NOR

4

0

189

No amp.

Unreliable

LN829395

Tgu, no hit

R:

CACAAGCTAACAGGACCATTCTC

60.18

 

SCOT

6

4

Unreliable

(183–191)

       

ENG

48

0

 

No amp.

Pha33

Osp1639

Gga, no hit

F:

[VIC]AGGTCAATAGGCTACGTGAACAG

59.72

GATA GATG (GATA)12

NOR

4

3

130

129–137

 

LN829396

Tgu2, 95818547

R:

CACAGGCTACCTTAGACAACACC

60.10

      
   

F:

[HEX] used for UK samples

  

SCOT

5

3

 

129–137

       

ENG

48

5

 

124–140

Pha34

Osp2311

Gga and Tgu,

F:

[6FAM]CTGGGCTTGTCCATCCAG

60.20

(CA)11

NOR

4

1

148

145

 

LN829397

Multiple copies

R:

AGGTACGAATATACCCTGAAGCAC

59.83

 

SCOT

6

1

 

145

  

in genome

    

ENG

48

2

 

145–147

Pha35

Osp2323

Gga, no hits

F:

[PET]GAATCCACCCTCAGCAAGTC

59.66

(G)7 (GT)12

NOR

4

2

110

103–115

 

LN829398

Tgu, no hit

R:

ATAGCAGGATGCTGGAGGAG

59.41

      
   

F:

[HEX] used for UK samples

  

SCOT

6

2

 

109–111

       

ENG

46

4

 

109–115

Pha36

Osp3963

Gga, no hits

F:

[NED]TTTCAGGTGGGCTTCATCTC

60.20

(GATA)13 GATG (GATA)2

NOR

4

5

174

166–186

 

LN829399

Tgu, no hit

R:

GAATCATCCTGAAATGCTTATTTTTC

60.51

      
   

F:

[HEX] used for UK samples

  

SCOT

6

3

 

174–182

       

ENG

48

5

 

166–182

Pha37

Osp4029

Gga, no hits

F:

[6FAM]GCTAAGTGCATCCCTTCTGC

59.98

(GT)10

NOR

4

3

94

86–92

 

LN829400

Tgu, no hit

R:

GTGCAGCAGCCTTAGCATC

59.72

 

SCOT

4

2

 

86–88

       

ENG

48

3

 

86–92

 

Summary

  

Total numbers of loci polymorphic, monomorphic

   

L.

Poly.

Mono.

No amp./

    

or failing to amplify per region samples were taken

      

Unreliable

       

NOR

37

26

4

7

       

SCOT

37

28

3

6

       

ENG

37

29

2

6

aLoci in bold and underlined were selected for multiplexing; ENA European Nucleotide Archive: http://www.ebi.ac.uk/ena/data/view/LN829364-LN829400

bChromosome location in the chicken (Gga) and zebra finch (Tgu) genomes (see Supplementary File)

cTm, melting temperature, the PCR program used was Norwegian samples: 95 °C for 15 min, 30 cycles of [95 °C for 30 s, 57 °C for 90 s, 72 °C for 60 s] and a final extension step of 60 °C for 30 min. UK samples: 95 °C for 15 min, 35 cycles of [94 °C for 30 s, 56 °C for 90 s, 72 °C for 60 s], and a final extension of 60 °C for 30 min. Six loci were found to be unreliable in all populations, alternative primer sets could be designed if required. Pha07 was monomorphic in the three populations tested but may be variable in other populations/subspecies. Pha12 was homozygous in all 21 females genotyped supporting its suggested Z-linked status, n number of individuals tested, Country location where individuals were sampled, NOR Norway, SCOT Scotland, ENG England (see text), A number of alleles observed, No amp. no PCR amplification, L. number of loci tested, Poly. Polymorphic, Mono. monomorphic

dThe expected allele size was based on the sequence of the male osprey Pandion haliaetus individual (02/09; that hatched at the Rutland Water Nature Reserve, Oakham, England, UK) from which the primer sets were designed (see text)

Table 2

Multiplex microsatellite genotyping and sexing of the osprey (Pandion haliaetus)

Locus and primer set

Clone name/reference

Chr.

Fluoro–label

MP set

Final primer concentration (µM)a

Repeat type

Pop.

n

Allele size range (bp)

A

H O

H E

P HWE (GENEPOP)

F NULL (CERVUS)

Pha04

Osp107_C09

3

VIC

A

0.04

Di

NOR

17

152–168

6

0.71

0.69

0.3845

−0.0350

Pha10 set 1

Osp107_F12

3

PET

A

0.2

Di

NOR

17

165–195

10

0.88

0.87

0.6130

−0.0280

Pha27

Osp0034

13

6FAM

A

0.2

Tetra

NOR

17

164–192

7

0.53

0.63

0.0783

+0.0929

Pha28

Osp0222

Unk.

6FAM

A

0.2

Tetra

NOR

17

117–133

5

0.82

0.76

0.6762

−0.0508

Pha29

Osp0354

6

NED

A

0.04

Tetra

NOR

17

135–151

5

0.76

0.73

0.1537

−0.0427

Pha35

Osp2323

Unk.

PET

A

0.2

Di

NOR

17

115–119

3

0.24

0.36

0.0170

+0.2290

Pha37

Osp4029

Unk.

6FAM

A

0.2

Di

NOR

17

86–92

3

0.59

0.63

0.3211

+0.0294

Pha02 set 1

Osp107_A08

6

PET

B

0.2

Di

NOR

17

188–212

7

0.59

0.50

1.0000

−0.1483

Pha13

Osp107_G06

12

6FAM

B

0.2

Di

NOR

17

182–196

8

0.94

0.88

0.6118

−0.0494

Pha16

Osp108_C02

4

6FAM

B

0.2

Di

NOR

17

296–302

4

0.53

0.57

0.7551

+0.0367

Pha30

Osp0428

3

6FAM

B

0.2

Tetra

NOR

17

235–255

6

0.65

0.78

0.0323

+0.0568

Pha33

Osp1639

2

VIC

B

0.04

Tetra

NOR

17

125–137

4

0.71

0.70

0.9226

−0.0080

Pha36

Osp3963

Unk.

NED

B

0.04

Tetra

NOR

17

166–186

6

0.71

0.77

0.3684

+0.0365

Z-002Db

Dawson (2007)

ZW

6FAM

B

0.2

n/a

NOR

5M

127

1

0

0

n/a

 
       

NOR

12F

118 and 127

2

1

1

n/a

 

Z-002Db

Dawson (2007)

ZW

6FAM

S-plex

0.2

n/a

UK

28M

127

1

0

0

n/a

 
       

UK

26F

118 and 127

2

1

1

n/a

 

Z-002A

Dawson (2007)

ZW

6FAM

S-plex

0.2

n/a

ENG

27M

210

1

0

0

n/a

 
       

ENG

21F

210 and 218

2

1

1

n/a

 

Z43B

DAD et al.

ZW

6FAM

S-plex

0.2

n/a

UK

28M

272

1

0

0

n/a

 
 

unpublished

 

Taa=

50 °C

  

UK

26F

268 and 272

2

1

1

n/a

 

aThe full PCR programs used are provided in the footnotes of Table 1. Chr. chromosome location (see Table 1 and Supplementary Figure), Unk. unknown, MP multiplex set, S-plex marker amplified separately in a single-plex, Pop population genotyped: NOR Norway, ENG England, UK individuals sampled in England and Scotland combined, n number of unrelated individuals genotyped, M Male, F Female, A number of different alleles observed, H O observed heterozygosity, H E expected heterozygosity, P HWE probability of deviation from Hardy–Weinberg equilibrium (data in bold indicates p > 0.05), F NULL estimated frequency of null alleles (data in bold indicates F NULL > 0.2)

bThe Z-002A and Z-002D (Dawson 2007) and Z43B (DAD et al. unpublished data) were used for identifying the sex of the individuals. Ta, PCR annealing temperature (50 °C for Z43B and 56/57 °C for all other markers, see Table 1 footnotes); M Male, F Female, n/a not applicable

Results

Genotyping revealed that all feathers were from different individuals. The genetic sexing revealed that ~10 % of osprey chicks were incorrectly sexed in the field (5/52 errors when based only on size/morphology). Microsatellite sequences were submitted to the EMBL-EBI European Nucleotide Archive (LN829364–LN829400; Table 1; S1). Of the 37 loci tested, 31 could be assigned a location in the chicken (Gallus gallus) and/or zebra finch (Taeniopygia guttata) genome based on sequence similarity (following Dawson et al. 2006) and 2–3 were Z-linked (Table 1, Supplementary Figure). From the 26 loci polymorphic in four individuals sampled in Norway, we selected 13 for multiplex-PCR that were placed into two sets based on fragment size, genetic variation and peak interpretation in the Norwegian samples. Multiplex genotyping of 17 ospreys sampled in Norway revealed a mean of 5.7 alleles per polymorphic locus (range 3–10; genotyping was performed in duplicate; Table 2). Heterozygotes were present in both sexes for these 13 loci indicating they are autosomal. Observed heterozygosity ranged from 0.24 to 0.94 per locus (Table 2). Two loci deviated from Hardy–Weinberg equilibrium in the Norwegian population (p < 0.05, Genepop v4.2; Table 2); possibly due to a Wahlund effect (Pha30) and/or allelic dropout/null alleles (Pha35, estimated null allele frequency >0.2, Cervus v3.0). Despite the source of DNA being feathers there was no evidence of dropout at any other loci (Cervus). No pairwise locus combinations displayed significant linkage disequilibrium (p < 0.01, Genepop). The combined probability of identity for the 13 loci was 8.0 × 10−12 (GenAlEx v6.501).

In conclusion, this multiplex set of novel microsatellite loci combined with the sex markers will be useful for genetic analyses of osprey, including typing non-invasive samples, such as shed feathers.

Notes

Acknowledgments

Roy Dennis (Highland Foundation for Wildlife) and Fiona Strachan kindly supplied the six feathers from Scotland and these were genotyped by Sarah Buckland and Filipa Martins. Rutland Water Nature Reserve is supported by The Leicestershire and Rutland Wildlife Trust in partnership with Anglian Water. We thank Tim Mackrill (Senior Reserve Officer at Rutland) for sampling permission and, along with Lloyd Park, for tree climbing, sampling assistance and providing morphometric sexing data. Børge Cato Moen, Pål Mølnvik, Torstein Myhre, Terje Gifstad and Ola Vedal kindly assisted with feather collection in Norway. Collection and genotyping of the samples from Central Norway was financially supported by the County administration in Nord-Trøndelag. MiSeq sequencing was performed by Jennifer Dawe and Darren Grafham of the Sheffield Diagnostics Genetics Service at The Children’s Hospital Sheffield supported by the Sheffield Children’s NHS Trust, UK. Marker isolation and genotyping was performed at the NERC Biomolecular Analysis Facility at the University of Sheffield (supported by the Natural Environment Research Council, UK) and multiplex development/typing was performed at the Norwegian Institute for Nature Research. TS was supported by an Erasmus Internship whilst at the University of Sheffield and CRAH is grateful to the University of Leicester for allowing a period of study leave to contribute to this work. We thank Douglas Ross for comments on the manuscript.

Funding

This study was funded by the Natural Environment Research Council, UK, coauthors institutions, an Erasmus Internship (TS) and the County administration in Nord-Trøndelag, Norway.

Compliance with ethical standards

Sampling

Visiting and observing osprey nests at Rutland Water Nature Reserve was performed under an English Schedule 1 Licence, issued by the British Trust for Ornithology on behalf of Natural England. Sampling permission was provided by Tim Mackrill, Senior Reserve Officer at Rutland Water Nature Reserve.

Conflict of interest

The authors declare that they have no conflict of interest.

Supplementary material

12686_2015_497_MOESM1_ESM.doc (154 kb)
Supplementary material 1 (DOC 154 kb)
12686_2015_497_MOESM2_ESM.doc (57 kb)
Supplementary material 2 (DOC 57 kb)

References

  1. Armour JAL, Neumann R, Gobert S, Jeffreys AJ (1994) Isolation of human simple repeat loci by hybridization selection. Hum Mol Genet 3(4):599–605. doi: 10.1093/hmg/3.4.599 CrossRefPubMedGoogle Scholar
  2. BirdLife International (2013) Pandion haliaetus. The IUCN Red List of Threatened Species. Version 2014.2. www.iucnredlist.org. Downloaded 30 Sept 2014
  3. Dawson DA (2007) Genomic analysis of passerine birds using conserved microsatellite loci. University of Sheffield, UKGoogle Scholar
  4. Dawson DA, Burke T, Hansson B, Pandhal J, Hale MC, Hinten GN, Slate J (2006) A predicted microsatellite map of the passerine genome based on chicken-passerine sequence similarity. Mol Ecol 15(5):1299–1320. doi: 10.1111/j.1365-294X.2006.02803.x CrossRefPubMedGoogle Scholar
  5. Grove RA, Henny CJ, Kaiser JL (2009) Osprey: worldwide sentinel species for assessing and monitoring environmental contamination in rivers, lakes, reservoirs, and estuaries. J Toxicol Environ Health B Crit Rev 12(1):25–44. doi: 10.1080/10937400802545078 CrossRefPubMedGoogle Scholar

Copyright information

© The Author(s) 2015

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  • Deborah A. Dawson
    • 1
  • Oddmund Kleven
    • 2
  • Natalie dos Remedios
    • 1
  • Gavin J. Horsburgh
    • 1
  • Rolf T. Kroglund
    • 3
  • Teresa Santos
    • 1
    • 4
  • Colin R. A. Hewitt
    • 5
  1. 1.Department of Animal and Plant SciencesUniversity of SheffieldSheffield, South YorkshireUK
  2. 2.Norwegian Institute for Nature Research (NINA)TrondheimNorway
  3. 3.Nord-Trøndelag University CollegeSteinkjerNorway
  4. 4.Department of BiologyUniversity of AveiroAveiroPortugal
  5. 5.Department of GeneticsUniversity of LeicesterLeicesterUK

Personalised recommendations