Advertisement

Conservation Genetics Resources

, Volume 5, Issue 2, pp 561–563 | Cite as

Characterization of new microsatellite loci for population genetic studies in the Smooth Cauliflower Coral (Stylophora sp.)

  • Eulalia Banguera-Hinestroza
  • Pablo Saenz-Agudelo
  • Till Bayer
  • Michael L. Berumen
  • Christian R. Voolstra
Open Access
Technical Note

Abstract

A total of one hundred microsatellites loci were selected from the draft genome of Stylophora pistillata and evaluated in previously characterized samples of Stylophora cf pistillata from the Red Sea. 17 loci were amplified successfully and tested in 24 individuals from samples belonging to a single population from the central region of the Red Sea. The number of alleles ranged from 3 to 15 alleles per locus, while observed heterozygosity ranged from 0.292 to 0.95. Six of these loci showed significant deviations from Hardy–Weinberg equilibrium (HWE) expectations, and 4/136 paired loci comparisons suggested linkage disequilibrium after Bonferroni corrections. After excluding loci with significant HWE deviation and evidence of null alleles, average genetic diversity over loci in the population studied (N = 24, Nloci = 11) was 0.701 ± 0.380. This indicates that these loci can be used effectively to evaluate genetic diversity and undertake population genetics studies in Stylophora sp. populations.

Keywords

Stylophora Tetra and dinucleotide microsatellites Red Sea Coral 

Reef building corals of the genus Stylophora (Schweigger 1819) have a widespread distribution in the Indo-pacific with the highest diversity being recorded in the Indian Ocean and the Red Sea (Veron 2000). However, it is unclear whether this diversity is due to the presence of several cryptic species in the region or simply a reflection of well-differentiated populations with high phenotypic plasticity. The lack of taxonomic and molecular information in this regard has led to confusion in terms of the real delineation between populations and species in this group (see Obura 2012). Recent studies have raised important and controversial questions about the delineation of species within the genus and highlighted the need for a clear assessment of the levels of population differentiation within cryptic species (i.e. Flot et al. 2011; Stefani et al. 2011).

In contrast to other well-studied taxa in the region (see Carpenter et al. 2011), phylogeographic and population genetics studies in species of the genus Stylophora are scarce. Only a few studies have investigated the level of genetic diversity within and among closely related populations (Ayre and Hughes 2000; Nishikawa et al. 2003; Zvuloni et al. 2008; Douek et al. 2011) and only one has investigated genetic connectivity at local and interoceanic spatial scales (Takabayashi et al. 2003). Here, we developed a panel of 17 specific microsatellites loci for population and phylogeographic studies in Stylophora spp. We expect that these markers will contribute to a better assessment of population structure, connectivity, and evolutionary history of these species throughout their range. In the long term, their use will provide a better understanding of the evolutionary mechanisms promoting the long-term survival of coral reefs populations, identify vulnerable populations, and promote conservation policies.

Di- and tretranucleotide repeats were identified in the draft genome of Stylophora pistillata (Voolstra and Aranda, unpublished data) using the software Tandem Repeats Finder (Benson 1999) and primers flanking suitable repeats were designed using the software Primer3 (Rozen and Skaletsky 2000). A total of one hundred loci were tested for positive amplification and polymorphism in 24 individuals from a single population from Shi’b Nazar reef, central Red Sea (22°19.142′N, 38°51.263′E). These individuals were morphologically identified as S. pistillata although subsequent mtDNA analyses showed that they cluster together in a single clade, well-differentiated from those previously reported by other studies (see Flot et al. 2011). For the purpose of this study we will subsequently refer to our samples as coming from Stylophora cf pistillata.

Approximately 1 cm of each coral colony was disrupted using a TissueLyser II (Qiagen) in presence of lysis buffer (Qiagen) to release high-quality DNA. All DNA extractions were performed following the protocols from Qiagen DNeasy Plant Mini Kit (Qiagen). Multiplex PCRs were performed using 20–50 ng of DNA template using the Qiagen Multiplex PCR kit according to the manufacturer’s recommendations. The final volume for all reactions was fixed at 10 μl, final concentration of primers was set at 0.1 μM, and primers mixes were selected according to the expected sizes (Table 1). Samples were amplified using the following thermal cycle profile: A first denaturation step at 95 °C for 15 min (for hot start Taq DNA polymerase, Qiagen), followed by 25 cycles at 94 °C for 30 s, annealing at a locus-specific temperature (60 °C for all primer mixes) for 90 s, and an extension at 72 °C for 60 s. The final extension was set at 60 °C for 30 min. Screening was performed using fluorescent-labeled primers (6-FAM, PET, VIC and NED, Table 1), fragment sizes were analyzed using an Applied Biosystems 3730 XL genetic analyzer, and allele sizes were scored using GeneMapper® 4.0 software (Applied Biosystems).
Table 1

Primer sequences and general description of 17 new microsatellites loci for population and phylogeographic studies in Stylophora sp.

Locus

Motif

Label

Forward primer (5′–3′)

Reverse primer (5′–3′)

Size range

NA

Stylo_17

(TA)10

6-FAM

CAAGTATTTTCACAGGGCGG

TCAAAACCTGAAGCAATCCC

161–179

8

Stylo_19

(AG)11

PET

ATCTTTCGTTCTCACGACGG

AGTCAGAACCTCCAGCAACG

165–179

3

Stylo_26

(CA)14

VIC

AACACTGCTGGTTAAAGGCG

TCACGCTTCTCGAAAGACAG

179–203

6

Stylo_32

(TC)10

NED

AAAGACCAAAGCAATGCGAG

ACTTTCTTTAACCGCCCCAC

197–209

7

Stylo_39

(TC)19

6-FAM

GCCAAGGGATCACTGACTTC

AAAATCCAGCGGTGTTATCG

232–244

8

Stylo_41

(TA)10

6-FAM

CGTCTGTTGAGACATACCCG

ATTCTGGCAGTTGCCTAACG

254–258

4

Stylo_43

(GA)12

6-FAM

GACTCACAAGGCAGCTGGAG

TTCGACTTCCAACCAAAAGG

253–263

7

Stylo_45

(AT)12

PET

TGATCCTTTTCAACAGTGCG

TAACCTTGCTGATCTCTGCG

260–290

15

Stylo_48

(TA)13

PET

ATGAGCCAAGGCCTACTTTG

CATCCTGAACAACACATGCC

261–283

8

Stylo_55

(CA)11

VIC

ACCCACGCATAGTTGAAAGC

TTCTGCACCAATACCAAGGG

286–302

8

Stylo_59

(TC)11

NED

CACACTAGCCATGAGACCCC

TGACCTCAGGAAAGGACCTG

284–288

3

Stylo_72

(TACA)11

6-FAM

CTCGGTTCTTCGCACTTAGG

AACGTATGTATGGACGCACG

89–137

12

Stylo_73

(CATA)10

6-FAM

ACGCACTCACGCACTGATAC

TGCCTTTTATCGACCTACGTG

154–226

12

Stylo_78

(ATGT)10

PET

GTATTGGCCCAGTGTTCCAC

GCCATTCACTTACGAATGCAG

165–177

4

Stylo_80

(AGAT)10

VIC

GCAAAGCGCAACCAATAAAC

TAGCGCTATCTACTGCGAGG

190–214

9

Stylo_82

(ACAT)19

6-FAM

GGCATTTTGTGCACTCTTTG

TCCCCATTTTCATCAAGCTC

228–240

9

Stylo_95

(GATG)10

VIC

TAATACCCAGTGCCCCAATC

CTGAAAAGCTTCATGGGGAG

284–308

7

After scoring the alleles, the program MicroChecker v2.2.3 (Van Oosterhout et al. 2004) was used to test for the presence of null alleles and error due to stuttering. Departure from Hardy–Weinberg Equilibrium (HWE) and linkage disequilibrium were evaluated using Arlequin ver 3.5 (Excoffier and Lischer 2010) and basic statistics were estimated using Genalex v6.5 (Peakall and Smouse 2012).

In the sample analyzed (N = 24), seventeen microsatellite loci showed moderate-to-high levels of polymorphism; the number of alleles ranged from 3 to 15. Observed heterozygosity ranged from 0.292 to 0.95, while expected heterozygosity ranged from 0.49 to 0.891. Six loci showed significant deviation from HWE expectations (alpha = 0.05), and 4 of them showed significant deviations after Bonferroni corrections (Stylo_26, Stylo_39, Stylo_72, Stylo_95; P < 0.001). Results from Micro Checker suggested the presence of null alleles for all six loci. Linkage disequilibrium was significant in 4/136 paired loci comparisons after Bonferroni correction (Table 2). After excluding loci with significant HWE deviation and evidence of null alleles, the average genetic diversity over loci in this population was 0.701 ± 0.380, while the mean observed and expected heterozygosities were 0.645 ± 0.159 and 0.681 ± 0.124 respectively. Ongoing studies will use these new markers in conjunction with mitochondrial markers to determine the degree of genetic differentiation and level of genetic flow on small and large scales from a North–South gradient in the Red Sea.
Table 2

Statistical analyses in a population of 24 individuals of Stylophora sp. in the Red Sea using 17 microsatellite loci

Locus

N

NA

Ne

Ho

He

uHe

Fis

Stylo_17

24

8

2.636

0.5

0.621

0.634

0.194

Stylo_19

21

3

1.96

0.429

0.49

0.502

0.125

Stylo_26*

22

6

3.781

0.364

0.736

0.753

0.506

Stylo_32

21

7

3.419

0.667

0.707

0.725

0.058

Stylo_39*

24

8

4.056

0.292

0.753

0.77

0.613

Stylo_41

24

4

2.039

0.5

0.51

0.52

0.019

Stylo_43

24

7

3.918

0.583

0.745

0.761

0.217

Stylo_45

24

15

8.409

0.875

0.881

0.9

0.007

Stylo_48

24

8

5.284

0.875

0.811

0.828

−0.08

Stylo_55+

22

8

5.831

0.591

0.829

0.848

0.287

Stylo_59

24

3

2.395

0.625

0.582

0.595

−0.07

Stylo_72*

24

12

9.216

0.667

0.891

0.91

0.252

Stylo_73+

24

12

6.365

0.625

0.843

0.861

0.258

Stylo_78

24

4

2.554

0.75

0.609

0.621

−0.23

Stylo_80

24

9

3.728

0.792

0.732

0.747

−0.08

Stylo_82

20

9

2.867

0.5

0.651

0.668

0.232

Stylo_95*

23

7

4.876

0.565

0.795

0.813

0.289

Loci with significant deviation from HWE at alpha = 0.05 are labeled with (+) and loci with significant HWE deviations after Bonferroni correction (*P < 0.001) are labeled in italics and an asterisk. N sample size, NA number of alleles, Ne effective number of alleles, Fis Fixation index, Ho observed heterozygosity, He expected heterozygosity, uHe unbiased expected heterozygosity

Notes

Acknowledgments

This research was funded by King Abdullah University of Science and Technology (KAUST), Saudi Arabia. The authors wish to thank Jessica Bouwmeester for sample collection and the Bioscience Core Lab at KAUST.

Open Access

This article is distributed under the terms of the Creative Commons Attribution License which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.

References

  1. Ayre DJ, Hughes TP (2000) Geneotypic diversity and gene flow in brooding and spawning corals along the Great Barrier Reef, Australia. Evolution 54:1590–1605PubMedGoogle Scholar
  2. Benson G (1999) Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res 27:573–580PubMedCrossRefGoogle Scholar
  3. Carpenter KE, Barber PH, Crandall E, Ablan-Lagman MC, Ambariyanto A et al (2011) Comparative phylogeography of the coral triangle and implications for marine management. J Mar Biol 2011:14Google Scholar
  4. Douek J, Amar KO, Rinkevich B (2011) Maternal-larval population genetic traits in Stylophora pistillata, a hermaphroditic brooding coral species. Genetica 139:1531–1542PubMedCrossRefGoogle Scholar
  5. Excoffier L, Lischer H (2010) ARLEQUIN suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Res 10:564–567CrossRefGoogle Scholar
  6. Flot JF, Blanchot J, Charpy L, Cruaud C, Licuanan WY et al (2011) Incongruence between morphotypes and genetically delimited species in the coral genus Stylophora: phenotypic plasticity, morphological convergence, morphological stasis or interspecific hybridization. BMC Ecol 11:22PubMedCrossRefGoogle Scholar
  7. Nishikawa A, Katoh M, Sakai K (2003) Larval settlement rates and gene flow of broadcast-spawning (Acropora tenuis) and planula-brooding (Stylophora pistillata) corals. Mar Ecol Prog Ser 256:87–97CrossRefGoogle Scholar
  8. Obura D (2012) The diversity and biogeography of western Indian Ocean reef-building corals. PLoS ONE 7(9):e45013PubMedCrossRefGoogle Scholar
  9. Peakall R, Smouse P (2012) GenAlEx 6.5: genetic analysis in excel. Population genetic software for teaching and research–an update. Bioinformatics 28:2537–2539PubMedCrossRefGoogle Scholar
  10. Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132:365–386PubMedGoogle Scholar
  11. Stefani F, Benzoni F, Yang SY, Pichon M, Galli P, Chen CA (2011) Comparison of morphological and genetic analyses reveals cryptic divergence and morphological plasticity in Stylophora (Cnidaria, Scleractinia). Coral Reefs 30:1033–1049CrossRefGoogle Scholar
  12. Takabayashi M, Carter D, Lopez J, Hoegh-Guldberg O (2003) Genetic variation of the scleractinian coral Stylophora pistillata from western Pacific reefs. Coral Reefs 22:17–22Google Scholar
  13. Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004) MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes 4:535–538CrossRefGoogle Scholar
  14. Veron JEN (2000) Corals of the world. Australian Institute of Marine Science and CRR Qld Pty Ltd, Townsville MCGoogle Scholar
  15. Zvuloni A, Mokady O, Al-Zibdah M, Bernardi G, Gaines SD, Abelson A (2008) Local scale genetic structure in coral populations: a signature of selection. Mar Pollut Bull 56:430–438PubMedCrossRefGoogle Scholar

Copyright information

© The Author(s) 2013

Authors and Affiliations

  • Eulalia Banguera-Hinestroza
    • 1
  • Pablo Saenz-Agudelo
    • 1
  • Till Bayer
    • 1
  • Michael L. Berumen
    • 1
    • 2
  • Christian R. Voolstra
    • 1
  1. 1.Red Sea Research CenterKing Abdullah University of Science and TechnologyThuwalSaudi Arabia
  2. 2.Biology DepartmentWoods Hole Oceanographic InstitutionWoods HoleUSA

Personalised recommendations