Advertisement

Conservation Genetics Resources

, Volume 3, Issue 1, pp 73–77 | Cite as

Characterisation and cross-amplification of polymorphic microsatellite loci in ant-associated root-aphids

  • A. B. F. IvensEmail author
  • D. J. C. Kronauer
  • J. J. Boomsma
Open Access
Technical Note

Abstract

Twenty-six polymorphic microsatellite loci were developed for four species of ant-associated root-aphids: Geoica utricularia, Forda marginata, Tetraneura ulmi and Anoecia corni. We found up to 9 alleles per locus, with an average of 4.8. We also report polymorphic cross-amplification of eleven of these markers between different pairs of study species. Furthermore, we tested previously published aphid microsatellites and found one locus developed for Pemphigus bursarius to be polymorphic in G. utricularia. These microsatellite markers will be useful to study the population structure of aphids associated with the ant Lasius flavus and possibly other ants. Such studies are relevant because: 1. L. flavus mounds and their associated flora and fauna are often key components in protected temperate grasslands, and 2. L. flavus and its diverse community of root-aphids provide an interesting model system for studying the long-term stability of mutualistic interactions.

Keywords

Microsatellites Root-aphids Mutualism Aphidoidea (Hemiptera) Pemphigidae Anoeciidae 

Mutualistic interactions between species are widespread and play key roles in ecosystem stability and diversity (Stachowicz 2001; Bastolla et al. 2009). In Northwest Europe, the yellow meadow ant Lasius flavus keeps up to fourteen species of mutualistic root-aphids in its nests (Pontin 1978; Heie 1980; Godske 1991). The ants actively tend the aphids, which provide them with honeydew (Pontin 1978). The nest mounds are markers of high grassland biodiversity and long-term habitat stability (Dean et al. 1997; Blomqvist et al. 2000; Lenoir 2009). However, despite the decline of European temperate grasslands in recent decades and the associated losses in plant and invertebrate biodiversity (WallisDeVries et al. 2002), neither the sociobiology of the ants (but see Boomsma et al. 1993), nor the biology of the root-aphids (Pontin 1978; Godske 1991, 1992) have been extensively studied. To facilitate molecular ecological approaches in the study of this mutualism, we developed DNA microsatellite markers for the four commonest species: Forda marginata, Tetraneura ulmi, Geoica utricularia and Anoecia corni.

Samples for genomic library construction for Forda marginata, Tetraneura ulmi, and Anoecia corni were collected in 2007 from an ant-nest on the Dutch island of Schiermonnikoog (53°29′03.5″N; 6°13′46.1″E) whereas Geoica utricularia was collected near Dejret, Denmark (56°12′54.2″N; 10°24′48.2″E). All samples for molecular analysis were preserved in 96% ethanol.

Genomic DNA was extracted using the QIAGEN DNeasy Blood & Tissue kit and enriched for poly-CA and poly-CT microsatellite containing fragments using the protocol by Rütten et al. (2001). We designed PCR primers for the flanking regions of repetitive motifs using the web-based software Primer 3 (Rozen et al. 2000).

Primers were tested on Schiermonnikoog samples collected in 2007, 2008 and 2009 and on samples collected near Dejret in 2007 (Anoecia spp.). DNA for microsatellite screening was extracted using 200 μl 20%-Chelex® 100 resin (Fluka) (Walsh et al. 1991). PCR-cocktails had a total volume of 10 μl, consisting of 0.8 mM dNTPs, 2 mM MgCl2, 1× PCR buffer, 0.25 U AmpliTaq Gold® DNA Polymerase (Applied Biosystems), 1 μl of DNA template and a varying concentration of primers (Table 1). Several primer pairs were multiplexed in PCR (Table 1). The amplification conditions were 95°C for 5 min, x number of cycles of 95°C for 30 s., T a for 30 s and 72°C for 30 s (1 min for Gu3, Gu8, Gu9, Gu10 and Gu13) and a final extension of 15 min at 72°C. The respective x and T a for each primer are listed in Tables 1 and 2.
Table 1

Characteristics of 26 polymorphic microsatellite loci in different species of ant-associated root-aphids

Locus

Species

Primer sequence (5′–3′) (F: forward. R: reverse)

Repeat motif

Size range (bp)

N

N a

H E

H O

Ta (°C)

Nr. of cycles x

Primer concentration (μM)

Multiplex mix

Genbank accession number

Gu1

Geoica utricularia

F: ATCAAACGAACGAACCGAAT

(GT)8

113–118

5

4

0.740

1.000

50

40

0.35

Gu-3

HM582813

R: GCGAAAGTTATGGCGTTTGT

Gu2

Geoica utricularia

F: CGCGATTAGATCTCGGAATG

(GT)11

158–177

227

5

0.613

0.361

50

40

0.15

Gu-2

HM582814

R: AAATCGTATAAAAGTAAAGGCGTTAT

Gu3

Geoica utricularia

F: TATCGTGCGGACACAGACAT

(TA)9

192–208

169

7

0.665

1.000

50

40

0.15

Gu-1

HM582815

R: CGGGCTATACCGCATACACT

Gu4

Geoica utricularia

F: CTGCTGCTCGTCCGACTTA

(TG)6 C (AT)12

206–222

8

4

0.602

0.125

50

35

0.35

Gu-3

HM582816

R: GCAGATAAAAACTGTTAGCCTTGA

Gu5

Geoica utricularia

F: CACAGGACGCGTAACTTAATATAG

(GT)15

164–214

214

6

0.569

0.145

50

40

0.15

Gu-2

HM582817

R: ACACTTTTCGGCAATTTCGT

Gu6

Geoica utricularia

F: ATCAAACGGTCTGGCATGTA

(TG)3 CG (GT)8

151–200

199

7

0.539

0.337

50

40

0.15

Gu-2

HM582818

R: CAATATCTCATCTGCCAGCAA

Gu7

Geoica utricularia

F: GTTAAAGGAACTCTTACGCTCTACG

(CA)3 TA (CA)5

87–103

13

4

0.698

0.000

50

40

0.35

Gu-3

HM582819

R: CATATAAATAAAAACGTCCTGTAGGC

Gu8

Geoica utricularia

F: TATACACGTCCGCGCAGATA

(AC)10

233–237

199

3

0.479

0.060

50

40

0.15

Gu-1

HM582820

R: GTTCGTTGCTCGTCGACTTT

Gu9

Geoica utricularia

F: CGCGCGTTATGAAAAATGTA

(CA)13

223–250

184

8

0.800

0.799

50

40

0.15

Gu-1

HM582821

R: CTCGCTGTGTGTGACACCTT

Gu10

Geoica utricularia

F: CGCCGCTAAAGAAGTTTTCA

(GT)19

228–261

14

8

0.763

0.786

50

40

0.35

 

HM582822

R: TTACGTTAAACA(AC)ACGAGGATTTAT

Gu11

Geoica utricularia

F: CGGTTACCCGTAAAAGGCTTA

(CA)11

145–153

223

6

0.729

0.677

50

40

0.15

Gu-2

HM582823

R: AAATCGCAATGACAGTCACG

Gu12

Geoica utricularia

F: GAGCCAACTGCCCGTTATAG

(GT)12 GC (GT)25 A (GT)4

106–138

10

3

0.460

0.000

60

45

0.15

 

HM582824

R: CGGTTTTATTTAAGGTCTCGAA

Gu13

Geoica utricularia

F: TCGCCGTCGACTATTTTACA

(CAG)7 (N)21 (TC)10

202–218

188

7

0.754

1.000

50

40

0.15

Gu-1

HM582825

R: AGTTACGTCCGGGGAGAAAT

Gu15

Geoica utricularia

F: TTTTTACGGGCTAAACCCTATTT

(GA)15 (A)4 (GA)3 (A)9

165–167

10

2

0.180

0.200

50

40

0.25

 

HM582826

R: CCAATACGGATCCCAACTTTT

Fm1

Forda marginata

F: CCTCCAATTACCGTTCAACC

(TG)22 CG (TG)5

182–259

154

9

0.458

0.253

53

37

0.15

 

HM582827

R: GAAGAACGTGACACGCGATA

Fm3

Forda marginata

F: TCTGATTTTTCGTTCGTCCA

(AT)10

225–349

138

6

0.494

0.246

50

40

0.15

 

HM582828

R: CGCGGCTCGTTACCTATTTA

Fm4

Forda marginata

F: CATTACGTGTGAGTGTAATATAGTTTT

(AC)14

178–200

162

7

0.465

0.167

50

35

0.15

 

HM582829

R: TGGTTTAAACGACGGATTTTC

Fm6

Forda marginata

F: TCACTCGCCTAGCGTTATTC

(T)11 ATGA (T)23

250–280

125

4

0.709

0.920

50

45

0.15

 

HM582830

R: GTGGCCGTAGCATGTCACTA

Tu1

Tetraneura ulmi

F: CGGGTGCGTGGGTACATTAT

(GT)4 GAT(AG)5 T-

218–241

89

2

0.164

0.000

50

35

0.25

 

HM582831

R: ATACGTTGAGCCAACTACCG

(GA)10 (A)6 (N)6 (T)17

Tu2

Tetraneura ulmi

F: TCCGACATACGTTTAACCAAAA

(TA)7 (TG)8

157–159

60

2

0.180

0.000

50

40

0.25

Tu-1

HM582832

R: ATGACACCCCTGCCACTATC

Tu3

Tetraneura ulmi

F: CGCCGTAAATAATAATAACAACAA

(A)11 (AT)6 (TA)2 (C)3 (GT)9

234–264

89

5

0.702

0.921

50

35

0.25

 

HM582833

R: CACGAGACCAAGAGATAAGGAAA

Tu4

Tetraneura ulmi

F: TTATTCGCAACCACACCTTG

(GT)26 G (GT)3

182–203

94

6

0.636

0.904

50

40

0.25

Tu-1

HM582834

R: ACGCGACGGATAGAAATACG

Tu10

Tetraneura ulmi

F: AGTATACGCGTCTCGCCAAC

(TAA)3 TGA (TAA)7

233–248

87

3

0.226

0.253

50

40

0.25

 

HM582835

R: GGAGCAAGTCCGATCGTTAT

Tu11

Tetraneura ulmi

F: CGGAGAACGCGTATTGATTT

(GT)9 (TA)5

194–200

89

4

0.396

0.393

50

35

0.25

 

HM582836

R: CGTGCGCGTGTCAAAGTAT

Ac6

Anoecia corni

F: CGAGGCATATTCAAAATGTAAGA

(AT)3 G (TA)9 C (AT)2

148–164

6

2

45

45

0.25

 

HM582837

R: CAGCATTAAACACGAATGCAA

Ac8

Anoecia corni

F: AATAATAATTCGTGGCGTTGC

(ATT)10

160

4

1

45

45

0.25

 

HM582838

R: CGCCGTAGAAGCAAATAATATC

N number of tested samples, Na number of alleles, HE expected heterozygosity, HO observed heterozygosity, Ta annealing temperature

Table 2

Cross-amplifications of microsatellite markers in different species of ant-associated root-aphids

Locus

Cross-amplified species

Size range (bp)

N

N a

H E

H O

Ta (°C)

Nr. of cycles x

Primer concentration (μM)

Genbank accession number

Gu6

Forda marginata

151–176

159

5

0.681

0.672

49

40

0.15

HM582818

Gu11

Forda marginata

135–147

162

6

0.489

0.234

49

40

0.15

HM582823

Gu13

Forda marginata

143–178

159

5

0.430

0.000

45

45

0.15

HM582825

Tu11

Forda marginata

2

49

40

0.15

HM582836

Fm3

Forda formicaria

121

18

1

0.000

0.000

50

40

0.15

HM582828

Fm4

Forda formicaria

174–178

18

3

0.495

0.777

50

35

0.15

HM582829

Fm6

Forda formicaria

206–291

18

2

0.500

1.000

50

45

0.15

HM582830

Gu6

Forda formicaria

151–152

17

2

0.110

0.000

49

40

0.15

HM582818

Gu11

Forda formicaria

142–146

18

3

0.439

0.277

49

40

0.15

HM582823

Gu13

Forda formicaria

156

19

1

0.000

0.000

45

45

0.15

HM582825

Fm1

Anoecia corni, A. zirnitsi

110–134

7

3

45

45

0.25

HM582827

Tu2

Anoecia corni, A. zirnitsi

137–148

3

2

45

45

0.25

HM582832

Tu11

Anoecia corni, A. zirnitsi

69–126

7

5

45

45

0.25

HM582836

Ac 8

Anoecia zirnitsi, A. major

130–146

2

2

45

45

0.25

HM582838

Pb02a

Geoica utricularia

118–124

8

2

50

40

0.20

AF267192

N number of tested samples, Na number of alleles, HE expected heterozygosity, HO observed heterozygosity, Ta annealing temperature

aDeveloped by Miller et al. 2000 for the lettuce root-aphid Pemphigus bursarius

Amplified fluorescent labeled PCR-products were run on an ABI-PRISM 3130XL (Applied Biosystems) sequencer and chromatograms were analyzed in Genemapper (Applied Biosystems). Expected and observed heterozygosities and deviations from Hardy–Weinberg Equilibrium (HWE) were determined using GENALEX 6.2 (Peakall and Smouse 2006). Occurrence of Linkage Disequilibrium (LD) was assessed using Genepop 4.0 (Rousset 2008).

The fourteen markers developed for Geoica utricularia were tested on 5–227 aphids. All markers were polymorphic, with 5.3 alleles per locus on average (Table 1). The four polymorphic markers for Forda marginata were tested together with three cross-amplifying markers (Gu6, Gu11, Gu13) on 125–162 aphids yielding 6.0 alleles on average (Tables 1 and 2). The six microsatellite markers for Tetraneura ulmi had 3.7 alleles on average in 60–94 tested aphids (Table 1). Observed and expected heterozygosities are given in Tables 1 and 2. Since all species reproduce asexually, deviations from HWE and presence of LD are expected (Ivens et al., in preparation). All loci indeed showed significant deviation from HWE, except for Gu15 in Geoica utricularia, Fm4 and Gu11 in Forda formicaria, and Tu10 in Tetraneura ulmi. In G. utricularia the majority of the loci pairs (65%) had significant LD, with most pairs not in LD involving Gu1 and Gu15. All pairs of T. ulmi were in LD, except for Tu10-Tu2, Tu10-Tu1, Tu2-Tu11 and Tu1-Tu11. In F. marginata, all loci pairs were in LD.

The two primer pairs developed for the genus Anoecia amplified across Anoecia species but were not extensively tested. We merely report these loci here for future reference.

Cross-amplification was tested for all markers except Gu12 and Fm5 (Table 2), yielding eleven markers that amplified in one or more additional species. Moreover, most markers used (species specific and cross-amplified) for Forda marginata were also suitable for the sibling species Forda formicaria. The loci Fm3, Fm4, Fm6 and Gu13 proved to be diagnostic for distinguishing between F. marginata and F. formicaria (Table 2). Three markers from Pemphigus bursarius (Pb02 (Miller et al. 2000)) and P. spyrothecae (97PS12 and 98PS8 (Johnson et al. 2000)) were tested for cross-amplification in our focal species, but only Pb02 reliably cross-amplified in Geoica utricularia (Table 2).

Although we enriched specifically for (CA)n and (CT)n repeats, the aphid DNA appeared to be especially AT-rich, including repeats that were suitable for microsatellite design. This observation is in accordance with earlier findings (Weng et al. 2007).

In conclusion, the 26 newly developed microsatellite markers presented here cover a large proportion of the known root-aphid fauna associated with L. flavus and other ant species (Heie 1980), and will be useful for detailed studies of the ecology and evolution of this mutualistic association.

Notes

Acknowledgments

This study was supported by a PhD-Grant from the Centre for Ecological and Evolutionary Studies, University of Groningen and grants from the Pieter Langerhuizen Fund and the Nicolaas Mulerius Foundation, awarded to A.B.F.I., as well as a grant from the Danish National Research Foundation to J.J.B. that funded D.J.C.K.’s postdoctoral work in Copenhagen. The authors would like to thank Sylvia Mathiasen, Thijs Janzen and Elzemiek Geuverink for help in the laboratory and in the field, Ole E. Heie and Maurice Jansen for help with aphid taxonomy and Franz J. Weissing and Ido Pen for discussion.

Open Access

This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

References

  1. Bastolla U, Fortuna MA, Pascual-Garcia A, Ferrera A, Luque B, Bascompte J (2009) The architecture of mutualistic networks minimizes competition and increases biodiversity. Nature 458(7241):1018–1091. doi: 10.1038/nature07950 CrossRefPubMedGoogle Scholar
  2. Blomqvist MM, Olff H, Blaauw MB, Bongers T, Van der Putten WH (2000) Interactions between above- and belowground biota: importance for small-scale vegetation mosaics in a grassland ecosystem. Oikos 90(3):582–598CrossRefGoogle Scholar
  3. Boomsma JJ, Wright PJ, Brouwer AH (1993) Social structure in the ant Lasius flavus—multi-queen nests or multi-nest mounds. Ecol Entomol 18(1):47–53CrossRefGoogle Scholar
  4. Dean WRJ, Milton SJ, Klotz S (1997) The role of ant nest-mounds in maintaining small-scale patchiness in dry grasslands in central Germany. Biodivers Conserv 6(9):1293–1307CrossRefGoogle Scholar
  5. Godske L (1991) Aphids in nests of Lasius flavus F. in Denmark I: faunistic description. Entomol Meddr 59(3):85–89Google Scholar
  6. Godske L (1992) Aphids in nests of Lasius flavus F. in Denmark II: population dynamics. Entomol Meddr 60(1):21–26Google Scholar
  7. Heie OE (1980) The Aphidoidea (Hemiptera) of Fennoscandia and Denmark. I. Fauna Entomol Scand 9:1–236Google Scholar
  8. Johnson PCD, Llewellyn KS, Amos W (2000) Microsatellite loci for studying clonal mixing, population structure and inbreeding in a social aphid, Pemphigus spyrothecae (Hemiptera: Pemphigidae). Mol Ecol 9(9):1445–1446CrossRefPubMedGoogle Scholar
  9. Lenoir L (2009) Effects of ants on plant diversity in semi-natural grasslands. Arthropod Plant Interact 3(3):163–172. doi: 10.1007/s11829-009-9066-7 CrossRefGoogle Scholar
  10. Miller NJ, Birley AJ, Tatchell GM (2000) Polymorphic microsatellite loci from the lettuce root aphid, Pemphigus bursarius. Mol Ecol 9(11):1951–1952CrossRefPubMedGoogle Scholar
  11. Peakall R, Smouse PE (2006) Genalex 6: genetic analysis in excel. Population genetic software for teaching and research. Mol Ecol Notes 6(1):288–295. doi: 10.1111/j.1471-8286.2005.01155.x CrossRefGoogle Scholar
  12. Pontin AJ (1978) Numbers and distribution of subterranean aphids and their exploitation by the ant Lasius flavus (Fabr.). Ecol Entomol 3(3):203–207CrossRefGoogle Scholar
  13. Rousset F (2008) GENEPOP ‘007: a complete re-implementation of the GENEPOP software for Windows and Linux. Mol Ecol Res 8:103–106CrossRefGoogle Scholar
  14. Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics methods and protocols: methods in molecular biology. Humana Press, Totowa, NJ, pp 365–386Google Scholar
  15. Rütten K, Schulz I, Olek K, Uhl G (2001) Polymorphic microsatellite markers in the spider Pholcus phalangioides isolated from a library enriched for CA repeats. Mol Ecol Notes 1(4):255–257CrossRefGoogle Scholar
  16. Stachowicz JJ (2001) Mutualism, facilitation, and the structure of ecological communities. Bioscience 51(3):235–246CrossRefGoogle Scholar
  17. WallisDeVries MF, Poschlod P, Willems JH (2002) Challenges for the conservation of calcareous grasslands in Northwestern Europe: integrating the requirements of flora and fauna. Biol Conserv 104(3):265–273CrossRefGoogle Scholar
  18. Walsh PS, Metzger DA, Higuchi R (1991) Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 10(4):506–513PubMedGoogle Scholar
  19. Weng Y, Azhaguvel P, Michels GJ, Rudd JC (2007) Cross-species transferability of microsatellite markers from six aphid (Hemiptera: Aphididae) species and their use for evaluating biotypic diversity in two cereal aphids. Insect Mol Biol 16(5):613–622. doi: 10.1111/j.1365-2583.2007.00757.x PubMedGoogle Scholar

Copyright information

© The Author(s) 2010

Open AccessThis is an open access article distributed under the terms of the Creative Commons Attribution Noncommercial License (https://creativecommons.org/licenses/by-nc/2.0), which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

Authors and Affiliations

  • A. B. F. Ivens
    • 1
    • 2
    Email author
  • D. J. C. Kronauer
    • 2
    • 3
  • J. J. Boomsma
    • 2
  1. 1.Theoretical Biology Group, Centre for Ecological and Evolutionary StudiesUniversity of GroningenGroningenThe Netherlands
  2. 2.Centre for Social Evolution, Department of BiologyUniversity of CopenhagenCopenhagenDenmark
  3. 3.Museum of Comparative ZoologyHarvard UniversityCambridgeUSA

Personalised recommendations