1 Introduction

Breast cancer is one of the most common malignant tumors in women all over the world. According to the latest data of International Agency for Research on Cancer (IARC) in 2018, the incidence of breast cancer among women worldwide was 24.2%, and 52.9% happened in the developing countries [1]. In China, there were 3 hundred thousand women diagnosed as breast cancer, the incidence increased year by year.

Triple-negative breast cancer (TNBC) occupies 20% of breast cancer [2], with the character of down-regulating estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2). Investigating the mechanisms underlying TNBC is the best approach against cancer progression and to find out new targets which could be applied to the principle of precise and comprehensive treatment. According to the biological behavior of the tumor and the physical conditions of patient, a variety of treatment methods should be jointly used. Treatments should be given considerations to the local and the systemic treatments, in order to improve the efficacy and quality of the patients’ life. Targeted therapy blocked tumor growth by specific interference. Comparing with chemotherapy, targeted therapy had less impacts on normal cells, and was well tolerated by patients during treatment.

Glycoprotein hormone is a kind of hormones, which would promote cell growth and development. Stanniocalcin 2 (STC2) is one of glycoprotein hormone. Zhang et al. was the first one to find STC secreted by the bony fish’s unique endocrine gland, the Stani corpuscles [3]. STC facilitates the phosphate absorption, and then keep the normal concentration of blood calcium to maintain the stable concentration relationship of calcium and phosphorus [3]. STC-like proteins include STC1 and STC2. Both of them were not only closed to the tumor development, but also related to cancer risk, as well as the poor prognosis of different kinds of cancer, and breast tumor was one of them [4, 5]. STC2 was known as skeleton related peptide, participating in the pathological and physiological processes of various organs and tissues. Previous researchers drew the conclusion that STC2 was connected to the occurrence and metastasis of many cancers, serving as an effective biomarker in some cancers [6, 7]. However, the results of STC2 on the mechanism of action of breast cancer are contradictory.

Epithelia-like cells changing into mesenchymal-like cells is called epithelial–mesenchymal transformation (EMT). MDA-MB-231 and MDA-MB-231HM are most frequently used breast cancer lines. According to Hou et al., MDA-MB-231 expressed lower STC2 but 231HM expressed highly [8]. They suggested that 231HM cells showed lower migrating ability comparing to 231 cells by measuring protein kinase C (PKC) and Claudin-1, relating to EMT process. The results indicated that EMT process could be suppressed by STC2 by regulating PKC and Claudin-1, thereby inhibiting the breast cancer migration and invasion. Murai et al. [9] suggested that STC1 promoted metastatic potential of breast cancer cells via activation of PI3K/AKT, indicating the activity of STC family being related to PI3K/AKT. Yang et al. [4] concluded that STC2 controls HNSCC metastasis via the PI3K/AKT/Snail signaling axis and that targeted therapy against STC2. Di et al. [10] found that the LncRNA MAFG-AS1 triggers tumorigenesis in the breast cancer and regulates breast cancer proliferation and metastasis by modulating the downstream target gene STC2, which was a targeted gene of long non-coding RNA MAFG-AS1 in AKT–ERK signaling pathway. Therefore, STC2 was with important relationship with breast cancer metastasis and tumor progression.

In our study, we investigated the effects of STC2 on EMT, migration, invasion and apoptosis of MDA-MB-231 cells. Tumor forming experiments in nude mice were for detecting the effects of STC2 on tumor growth and migration. Our experiments were for providing clinical therapy on TNBC targeting STC2 with molecular mechanisms.

2 Materials and methods

2.1 Tissues samples

35 pairs of TNBC tissues and the para-carcinoma tissues were collected from the breast cancer patients in Yuebei People’s Hospital (Shaoguan, China) from December of 2019 to December 2022. All the patients received no preoperational antitumor therapy including radiotherapy and chemotherapy. All the patients were without lymph node metastasis and distant metastasis. Patients were undergone radical resection, and the cancer tissues and para-carcinoma tissues were collected avoiding of necrosis. Informed consents were obtained from every patient. The experiments were approved by the Ethics Committee of Yuebei People’s Hospital. This study was approved by the Yuebei People’s Hospital Ethics Committee with approval number KY-2021-299 (Fig. 1).

Fig. 1
figure 1

Research flow chat

Full size image

2.2 STC2 levels in breast cancer tissues

STC2 levels in TNBC tissues and para-carcinoma tissues were measured by IHC. Tissues were separated from human body and then fixed in 4% polyformaldehyde (PFA) (Solarbio Sciences & Technology Co., Ltd., Beijing, China) for more than 48 h. Tissues were dehydrated by gradient ethanol (70%, 80%, 90%, 100%, 100%) for 30 min of each, and then cleared by twice of xylene (Bioss Antibodiess Co., Ltd. Beijing, China) for 30 min of each. Waxed tissued twice for 30 min of each, with the temperature between 58–62 °C. Paraffin embedded tissues were cut into 5 μm of slices and dried at 60 °C for 1 h for fixation. For STC2 detection, slices were dried at 60 °C for 1 h and dewaxed in twice of xylene for 30 min of each. Hydrated slices in gradient ethanol (100% for 2 min, 100% for 2 min, 90% for 2 min, 80% for 5 min, 70% for 10 min) and twice of ddH2O for 2 min. Washed slices twice with 1 × phosphate buffer solution (PBS) (Solarbio). Antigen repaired with 1 × Tris/EDTA (pH 9.0) (Bioss) in microwave oven for 10 min at high heat. Replenished with ddH2O and heated in microwave oven for 40 min at moderate heat. Cooled to room temperature, and then washed with 1 × PBS for 5 min, three times. Inactivated in 3% hydrogen peroxide solution (Bioss), sealed with 10% goat serum (Beyotime Biotechnology, Inc. Shanghai, China) for 10 min, and then incubated with rabbit anti-STC2 (ab255610,1:200) (Abcam, Shanghai, China) containing SignalUp™ immunostaining enhancer (Beyotime) at 37 °C for 1–2 h. Washed with PBST (PBS with 0.1% tween-20, Solarbio) twice for 5 min and incubated with Horseradish peroxidase (HRP) Polymer (Bioss) secondary antibody for 30 min. Washed with PBST twice for 5 min and stained with diaminobenzidine (DAB) (Bioss) for 10 min. Washed with water and re-stained with hematoxylin (Bioss). Dehydrated with graduated ethanol (70% for 10 s, 80% for 10 s, 90% for 10 s, 100% for 10 s) and cleared with twice of xylene for 5 min. Sealed slices with neutral balsam (Bioss) and observed under a microscope.

2.3 Quantitative real-time PCR measuring STC2 levels

2.3.1 RNA extraction

Total RNA was extracted from the cancer tissues and the para-carcinoma tissues. Tissues were ground in liquid nitrogen as powder. Mixed with 1 ml Trizol (Beyotime) and let stand for 5 min. Mixed with 200 μl chloroform (Guangzhou Chemical Reagent Factory, Guangzhou, China) on vortex for 30 s, and let stand for 2 min. Centrifugated at 4 °C, 12,000×g for 10 min. Separated the top level (RNA), added equal volume of Isopropanol (Chemical Reagent Factory) mixed gently, and then let stand for 10 min. Centrifugated at 4 Centrifugated at 4 °C, 12,000×g for 10 min and collected the precipitation. Washed with 75% ethanol twice and dried in laminar flow cabinet. Dissolved with 20–60 μl diethyl pyrocarbonate (DEPC) water (Aladdin Biochemical Technology Co., Ltd. Shanghai, China).

2.3.2 RNA purity and integrity detection

50 times diluted RNA was detected with BioPhotometer plus (Eppendorf China) to measure the OD260/OD280 > 1.8, representing pollution-free from proteins. 1 μl RNA was analyzed by 1% agarose (Biosharp Life Sciences, Hefei, China) gel with 80 V for 20 min, and the observed by ultraviolet (UV) cross link apparatus (Thermo Fisher Scientific, Inc. Shanghai, China) to confirm the RNA integrity, representing as clearing 5 s rRNA, 18 s rRNA and 28 s rRNA.

2.3.3 STC2 reverse transcription and quantitative PCR (qPCR)

The STC2 reverse transcription (TransGen Biotech Co., Ltd. Beijing, China) was carried on according to the instruction of the kit. The qPCR reaction system includes SYBR Green Mix, primers (STC2 F: GGGTGTGGCGTGTTTGAATG, R: TTTCCAGCGTTGTGCAGAAAA; β-actin F: ATGGATGTAGAAAATGAGCAG, R: TAGTCGCCTTTTTGCCTTGG), cDNA template, and water, with a total volume of 20 μl. The reaction conditions are 95 °C pre-denaturation for 5 min, followed by 40 cycles of 95 °C denaturation for 15 s and 60 °C annealing and extension for 32 s.

2.4 Cell culturing

MDA-MB-231 cell line obtained from China Center for Type Culture Collection (CCTCC). MDA-MB-231 cells were cultured with Leibovitz’s L-15 (Thermo) containing 10% fetal bovine serum (FBS) (Thermo), 10,000 U/ml penicillin and 10,000 μg/ml streptomycin, and maintained at 37 °C, 5% CO2 and saturated humidity. Cultured medium was changed every 2 to 3 days. Passage culturation was assayed when MDA-MB-231 cells reached 90% density. MDA-MB-231 cells in logarithmic growth phase were used for the following experiments.

2.5 Overexpressing or silencing STC2 in MDA-MB-231 cells

Overexpressed STC2 plasmid and siRNA-STC2 were constructed and synthesized by Shanghai Genechem Co., Ltd. (Shanghai, China). MDA-MB-231 were transfected with overexpressed STC2 plasmid (OE-STC2 group) or siRNA-STC2 (si-STC2 group) using Lipo.3000 (Thermo) according to the instruction. 48 h later, the cells were for measuring the related proteins expressions, cell apoptosis, metastatic and invasive abilities comparing to the negative control (NC group).

2.6 STC2 expression and EMT levels in MDA-MB-231 cells

The transfected MDA-MB-231, mentioned before, were lysed with moderate radio immunoprecipitation assay (RIPA) buffer (Beyotime) containing 1 mM of Phenylmethanesulfonyl fluoride (PMSF) (KeyGEN BioTECH, Nanjing, China) on ice for 30 min. Centrifugated at 12,000×g, 4 °C for 10 min and collected the supernatant. Mixed with 5 × loading buffer and heated at 100 °C for 10 min, and then stored at − 80 °C or continued for proteins expressions measurement. Quantitated the total protein by BCA assay (KeyGEN) before western blotting (WB). 40 μg of total protein was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with 10% separating gel and 5% storing gel. Proteins were transferred to polyvinylidene fluoride (PVDF) (Merck Millipore cooperation, Germany) membrane and then sealed with 5% skim milk containing 2% bovine serum albumin (BSA) (Solarbio). Rabbit anti-STC2 (ab255610, 1:1000, Abcam), rabbit anti-E-cadherin (20874-1-AP, 1:10,000) (Proteintech Group, Inc. Wuhan, China), rabbit anti-N-cadherin (22018-1-AP, 1:5000, Proteintech), rabbit anti-Lamiin γ1 (ab233389, 1:1000, Abcam), rabbit anti-Fibronectin (15613-1-AP, 1:10,000, Proteintech), rabbit anti-β-catenin (51067-2-AP, 1:10,000, Proteintech), rabbit anti-Vimentin (10366-1-AP, 1:5000, Proteintech), rabbit anti-Claudin-1 (28674-1-AP, 1:2000, Proteintech), rabbit anti-FSP1 (20886-1-AP, 1:3000, Proteintech), rabbit anti-Snail 1 (13099-1-AP, 1:500, Proteintech), rabbit anti-ZEB1 (21544-1-AP, 1:500, Proteintech), mouse anti-α-SMA (ab7817, 1:1000, Abcam) and mouse anti-GAPDH (RM2002, 1:3000, Beijing Ray Antibody Biotech, Beijing, China) antibodies were used to incubate the corresponding protein bands at 4 °C, overnight. After washing with PBST (PBS containing 0.1% Tween-20) (Sangon Biotech Co., Ltd. Shanghai, China) for 3 times, peroxidase affinipure goat anti-rabbit IgG (H+L) (111-035-003, Jackson ImmunoResearch Inc. USA) or peroxidase affinipure goat anti-mouse (115-035-003, Jackson) antibodies were incubated the corresponding protein bands at 25 °C for 1 h. After washing with PBST for three times, protein bands were analyzed with ECL system (P0018FS, Beyotime).

2.7 Cell cycle and apoptosis assay

The transfected MDA-MB-231 mentioned before, were digested with trypsin without EDTA (Thermo) and suspended in L-15 with 10% FBS. Washed and suspended with 1 × PBS to prepare as single cell suspension with concentration of 1–5 × 106 cells/ml. 100 μl of cell suspension was collected in the flow cytometry tube. 5 μl of Annexin V-FITC (Beyotime) was added into the cells, and then mixed with 5 μl of propidium iodide (PI) (Beyotime). After 10 min incubation at 25 °C in dark, the cell cycle and apoptotic cells were analyzed by flow cytometer (Attune CytPix, Thermo).

2.8 Cell proliferation measurement by cell counting kit-8 (CCK-8)

The transfected MDA-MB-231 mentioned before, were digested with trypsin without EDTA (Thermo) and suspended in L-15 with 10% FBS. Washed and suspended with 1 × PBS to prepare as single cell suspension with concentration of 1–5 × 106 cells/ml. 2 × 103 cells were resuspended in 100 μl of L-15 with 10% FBS, and then seeded in a 96-well plate. The cell proliferation was measure at 0 h, 24 h, 48 h, 72 h and 96 h by using CCK-8 (Beyotime, C0038) according to the specification, separately.

2.9 Cell migration measurement by wound healing assay

The transfected MDA-MB-231 were digested with trypsin without EDTA (Thermo) and suspended in L-15 containing 10% FBS. 1–5 × 105 cells were seeded in a 6-well plate (Corning Inc. Shanghai, China). Use a pipette tip to make a straight line. Continue to culture for 48 h. Observed the scratch healing under a microscope (Leica Microsystems, Danaher Life Sciences, Germany). Randomly selected 8 fields to measure the average width of the scratch healing at 0 h, 6 h, 24 h and 48 h, separately.

2.10 Cell invasion measurement by transwell system

The transfected MDA-MB-231 were digested with trypsin without EDTA (Thermo) and suspended in L-15 without FBS to the appropriate concentration. For invasion assay, 1–5 × 104 cells (no more than 300 μl) were seed to the upper chambers of the Transwell system with 24-well insert (8 μm pore size) (Corning). A upper chamber was coated with 5 μl Matrigel (Becton, Dickinson and Company, USA) mixed with 95 μl L-15. The lower chambers were loaded with 600 μl L-15 containing 20% FBS. After incubation for 24 h, removed the medium, fixed with methanol for 20 min, and stained with 0.1% Crystal Violet (Beyotime) in 20% methanol. Cleaned the cells on the upper surface of the upper chamber. Observed the transmembrane cells under a microscope (Leica). Selected 8 fields randomly and calculated the average number of the cells stained as purple.

2.11 PKC/PI3K/AKT/mTOR signaling pathway measurements

On one hand, pAKT Ser473, pPKCδ Ser645 and pPKCδ Thr507 were measured in the transfected MDA-MB-231 with silencing STC2 or over-expressing STC-2, comparing to the NC. On the other hand, the transfected MDA-MB-231 were treated with rapamycin (25 nM, 24 h), LY294002 (10 μM, 24 h) or Rottlerin (3 μM, 24 h), separately. PCR and WB assays were for determining the STC2 level, and WB was for pAKT Ser473, pPKCδ Ser645 and pPKCδ Thr507 levels. Rabbit anti-pAKT Ser473 (9273, 1:1000, Cell Signaling Technology, Inc. Shanghai, China), rabbit anti-pPKCδ Ser645 (9376, 1:1000, CST), rabbit anti-pPKCδ Thr507 (bs-3727r, 1:1000, Bioss Antibodies, Inc. Beijing, China), rabbit anti-STC2 (ab80590,1:1000, Abcam) and mouse anti-GAPDH (RM2002, 1:3000, Ray) antibodies were used for primary antibodies. The following steps were mentioned as before.

2.12 Tumor formation in nude mouse

All animal care conditions and experimental protocols were approved by the Animal Ethics Committee of Yuebei People’s Hospital with approval number G2024014. Animal experiments were carried out according to Institutional Animal Care and Use Committee (IACUC) Guidelines. 15 BALB/c-nude mice (male, age 5 to 6 weeks, were obtained from SPF. All the nude mice were housed and kept in a specific pathogen-free (SPF) animal facility in 12 h light/dark cycles, with controlled humidity and temperature and free access to food and water. Nude mice were divided into 3 groups, randomly, including si-STC2 group, OE-STC2 group and the NC group, 5 in each group. Collected the transfected MDA-MB-231 with digestion by trypsin without EDTA (Thermo), washed with PBS 3 times, and suspended in 1 ml of PBS to the concentration of 107 cells/0.3 ml. Injected the cells into the mammary fat pad of nude mice through a 22-gauge needle 1 to 2 cm deep to prevent leakage of the inoculum, according to the grouping. 1 week before injection, each mouse received subcutaneous injection of 5 μg of 17β-estradiol valerate (Aladdin Biochemical Technology Co., Ltd, Shanghai, China), which was dissolved in 0.5 ml of sesame oil (Solarbio) as repository vehicle. Estrogen was injected every week until sacrifice in order to sustain tumor growth. When solid tumors reached palpable size, sacrificed the nude mice and separated the tumors. Cleaned the non-tumorous tissues, recorded the tumor size, and then fixed in 4% polyformaldehyde (PFA) (Solarbio) more than 24 h until cutting into sections.

2.13 Immunohistochemistry

The tumor tissues removed from nude mice were dehydrated and waxed mentioned before. 5 μm of slices were obtained for dewaxing and hydrating. After antigen repairing, inactivating and sealing, primary antibodies including STC2 (1:100), N-Cadherin (1:100), E-Cadherin (1:100), β-catenin (1:100) and Claudin-1 (1:100) were added at 4 °C overnight. HRP Polymer secondary antibody were incubated for 30 min, and then stained by DAB and hematoxylin. Dehydrated and cleared the sections and observed under a microscope.

2.14 Statistical analysis

Statistical analysis was performed by SPSS 19.0 (SPSS Inc., Chicago, IL). Experiments were repeated at least 3 times and the data were presented as mean. Student’s t test was used for comparisons between groups, while ONE-WAY ANOVA was used among groups more than two. A value of P < 0.05 was considered as significant difference.

3 Results

3.1 Lower STC2 level in TNBC tissues than para-carcinoma tissues

STC2 protein expression in tissues of TNBC patients were measured by IHC assay. As showed in Fig. 2A, weakly positive (+) STC2 was detected in breast cancer tissues, presenting the lower STC2 expression in breast cancer. Strongly positive (+++) STC2 was detected in para-carcinoma tissues, comparing to the TNBC tissues, which presented higher STC2 expression in normal tissues.

Fig. 2
figure 2

STC2 expressions in TNBC tissues comparing to the para-carcinoma tissues. A STC2 protein levels by IHC. B STC2 mRNA levels of 5 TNBC patients. C STC2 mRNA levels of 35 TNBC patients. (+, weakly positive; +++ , strongly positive; *, comparing to TNBC tissue, P < 0.05; 1 to 5, 5TNBC patients; TNBC three-negative breast cancer)

Full size image

3.2 Lower STC2 mRNA in TNBC tissues than para-carcinoma tissues

STC2 mRNA level in tissues of TNBC patients were measured by qPCR. As showed in Fig. 2B, 5 TNBC patients were included. The STC2 mRNA value in every sample was calculated as 2^−△△Ct. The STC2 mRNA value in the para-carcinoma tissue was taken as control (as the denominator) in each pair. In every pair of TNBC tissue and the para-carcinoma, STC2 mRNA level was both lower in TNBC tissue, significantly (P < 0.05). Figure 2C showed the STC2 mRNA level of 35 TNBC patients. Comparing to the para-carcinoma tissue, STC2 level was lower in TNBC tissues, significantly (P < 0.05). The mRNA results fitted well with STC2 IHC results.

3.3 STC2 promoted apoptosis of MDA-MB-231

Apoptosis rate of MDA-MB-231 with silencing or over-expressing STC2 was determined by flow cytometry. As showed in Fig. 3A and B, the total apoptosis rate, early and late apoptosis, was higher in OE-STC2 than the si-STC2 and the NC groups, both obviously, while the normal cells were with opposite trend. These results indicated the promoting effect of STC2 on the apoptosis of MDA-MB-231.

Fig. 3
figure 3

Silencing STC2 (si-STC2) or overexpressing STC2 (OE-STC2) in MDA-MB-231 cells. A & B Apoptotic rate (%) was measured by flow cytometry and compared among groups. C & D Cell cycle was measured by flow cytometry and compared among groups. E Cell proliferation was measured by cell counting kit-8 (CCK-8). (NC negative control; * comparing between the groups, P < 0.05)

Full size image

3.4 STC2 suppressed cell cycle G2/M progression in MDA-MB-231

Cell cycle of MDA-MB-231 with silencing or over-expressing STC2 was determined by flow cytometry. As showed in Fig. 3C and D, silencing STC2 induced cell cycle G1/S arrest, while over-expressing STC2 promoted cell cycle G2/M progression, comparing to the NC, both obviously. These results indicated the inhibition of STC2 on MDA-MB-231 cell cycle G2/M progression and tumorgenesis.

3.5 STC2 suppressed cell proliferation in MDA-MB-231

Proliferation of MDA-MB-231 with silencing or over-expressing STC2 was determined by using CCK-8. As showed in Fig. 3E, silencing STC2 promoted MDA-MB-231 proliferation, while over-expressing STC2 suppressed cell proliferation, comparing to the NC, both obviously. These results indicated the inhibition of STC2 on MDA-MB-231 proliferation.

3.6 STC2 suppressed EMT of MDA-MB-231

By established overexpressed STC2 (OE-STC2 group) and silenced STC2 (si-STC2 group) model in MDA-MB-231, EMT related proteins were detected by WB. As showed in Fig. 4, siRNA targeting at STC2 successfully silenced STC2, presenting as obviously lower STC2 level than the negative control (NC). Overexpressed STC2 plasmid successfully enhanced STC2 level comparing to the NC, also obviously. E-Cadherin and Laminin-γ had the similar trend as STC2, showing lower levels in si-STC2 group but higher levels in OE-STC2 group. N-Cadherin, Claudin-1, Fibronectin, FSP1, Snail, Vimentin, Zeb1, α-SMA and β-catenin were both with opposite trends as STC2. These changes of EMT related-protein indicated the suppression of STC2 on EMT, chronic inflammation, cancer metastasis or fibrillation in breast cancer cells.

Fig. 4
figure 4

EMT related-protein expressions in silencing STC2 (si-STC2) or overexpressing STC2 (OE-STC2) in MDA-MB-231 cells. (NC negative control; * comparing between the groups, P < 0.05)

Full size image

3.7 STC2 suppressed MDA-MB-231 migration and invasion

Migration and invasion of MDA-MB-231 with silencing or over-expressing STC2 was determined by wound healing assay and Transwell assay, separately. As showed in Fig. 5A and B, scratch width of MDA-MB-231 in each group was measured at 0 h, 6 h, 24 h and 48 h after scratching. Scratch width of si-STC2 group narrowed down quickly, while that of OE-STC2 group was slow, comparing to the NC, obviously. The line chart presented the migrated MDA-MB-231 cells after silencing STC2 were more than that of over-expressing STC2 and the NC.

Fig. 5
figure 5

Silencing STC2 (si-STC2) or overexpressing STC2 (OE-STC2) in MDA-MB-231 cells. A & B Migration rate of MDA-MB-231 cells by wound healing assay at 0 h, 6 h, 24 h and 48 h. C & D Invasion rate of MDA-MB-231 cells by Transwell assay at 24 h. (NC negative control; * comparing between the groups, P < 0.05)

Full size image

As showed in Fig. 5C and D, MDA-MB-231 cells were counted after invading for 24 h. More MDA-MB-231 cells passed through the Matrigel after silencing STC2, while less MDA-MB-231 passed through after over-expressing STC2, comparing to the NC, both obviously. The migration and invasion results suggested the inhibition of STC2 on MDA-MB-231 cell migration and invasion.

3.8 Lower STC2 level activated PKCδ/PI3K/AKT/mTOR signaling pathway

pAKT Ser473, pPKCδ Thr507 and pPKCδ Ser645 in MDA-MB-231 with silencing or over-expressing STC2 were measured, and then PI3K/AKT inhibitor (LY294002), mTOR inhibitor (rapamycin) and PKCδ inhibitor (rottlerin) were used to treat the MDA-MB-231 cells, in order to analyze PKC/PI3K/AKT/mTOR signal pathway. As showed in Fig. 6A, silencing STC2 inhibited pPKCδ Ser645 and pPKCδ Thr507, but enhanced pAKT Ser473, while over-expressing STC2 got the opposite appearances. These results suggested that STC2 expression was related to the downregulation of pAKT (Ser473) and upregulation of PKCδ (Ser645 and Thr507) phosphorylation.

Fig. 6
figure 6

Silencing STC2 (si-STC2) or overexpressing STC2 (OE-STC2) in MDA-MB-231 cells. A Effects of STC2 on AKT and PKCδ phosphorylation/activation in MDA-MB-231 cells. B Effects of PI3K inhibitor (LY294002), mTOR inhibitor (rapamycin) and PKCδ inhibitor (rottlerin) on STC2 mRNA level in MDA-MB-231 cells. C Effects of PI3K inhibitor (LY294002), mTOR inhibitor (rapamycin) and PKCδ inhibitor (rottlerin) on STC2 protein level in MDA-MB-231 cells. (NC negative control; * comparing between the groups, P < 0.05; ** comparing between the groups, P < 0.01; NS, no significance)

Full size image

As showed in Fig. 6B and C, PI3K/AKT inhibitor LY294002 and mTOR inhibitor rapamycin both induced STC2 expression in MDA-MB-231 with overexpressing STC2, comparing to the NC and Blank groups, on both mRNA level and protein level. PKCδ inhibitor rottlerin suppressed STC2 expression in NC group comparing to Blank group, with no significance. The significances between NC and OE-STC2 was also obvious with the treatment of PKCδ inhibitor rottlerin.

These results suggested that STC2 could suppress PKC/PI3K/AKT/mTOR pathway, and PKC/PI3K/AKT/mTOR pathway repressed STC2 expression, while PKCδ might upregulate STC2 at both transcriptional and translational levels.

3.9 Lower STC2 level promoted EMT of breast cancer

Nude mice received injection of MDA-MB-231 with silencing STC2 (si-STC2), overexpressing STC2 (OE-STC2) and empty plasmid (NC) to form the tumor. Tumor size comparisons were showed in Fig. 7A and B. Silencing STC2 promoted tumor growth, while overexpressing STC2 suppressed tumor growth.

Fig. 7
figure 7

Nude mice were received injection of MDA-MB-231 with silencing STC2 (si-STC2), overexpressing STC2 (OE-STC2) and empty plasmid (NC). A & B Tumor size comparisons. C & D STC2, N-Cadherin, E-Cadherin, β-catenin and Claudin-1 expressions tumors by IHC. E Tumor growth curve from the 13rd day to 37th day. (NC negative control; * comparing between the groups, P < 0.05)

Full size image

STC2 and EMT related proteins including N-Cadherin, E-Cadherin, β-catenin and Claudin-1 were measured by IHC. As show in Fig. 7C and D, IHC results presented that weakly positive (+) STC2 in si-STC2 group and strongly positive (+++) STC2 in OE-STC2 group, comparing to the moderately positive (++) STC2 in tumor. Silencing STC2 promoted EMT in tumor, presenting as strongly positive (+++) N-Cadherin, β-catenin and Claudin-1 and weakly positive (+) E-Cadherin. Overexpressing STC2 presenting as weakly positive (+) N-Cadherin, β-catenin and Claudin-1 and strongly positive (+++) E-Cadherin, comparing to the NC group.

Tumor growth was measured from the 13rd day to the 37th day. The tumor growth curve, showing in Fig. 7E, presented that silencing STC2 promoted tumor growth, while over-expressing STC2 suppressed tumor growth, comparing to the NC group, both obviously.

These results suggested that STC2 could suppress tumor growth and inhibit EMT in breast tumor.

4 Discussions

In this study, 35 TNBC patients were included, and their cancer tissues as well as the para-carcinoma tissues were for measuring STC2 levels. In every pair of tissue, STC2 in TNBC tissues were obviously lower than that in para-carcinoma tissues, both on protein and mRNA levels. Cellular experiments were carried on for further confirming. Silencing STC2 and over-expressing STC2 were established in MDA-MB-231 cells. Cell EMT, migration, invasion, proliferation and apoptosis were for determining the effects of STC2 on TNBC progression. The study data showed the suppression of over-expression of STC2 on EMT, migration, invasion and proliferation of MDA-MB-231 cells but promotion on cell apoptosis, while silencing STC2 was with the opposite appearances. The relationship among PKC/PI3K/AKT/mTOR signaling pathway and STC2 was analyzed by measuring the phosphorylation, as well as the effects of their inhibitors on STC2. STC2 activated PKC (pPKCδ Ser645 and pPKCδ Thr507) phosphorylation but suppressed PI3K/AKT (pAKT Ser473) phosphorylation. PI3K/AKT/mTOR inhibitors repressed STC2, but PKC inhibitor upregulated STC2, on both mRNA and protein levels.

In vivo experiments, nude mice were injected with MDA-MB-231, which was with silencing STC2, overexpressing STC2 or the empty plasmid (NC). The growing tumor were separated for size and EMT measurements. Tumor size was bigger in silencing STC2 group than the NC, while overexpressing STC2 was with smaller size than the NC. Silencing STC2 promoted N-Cadherin, β-catenin and Claudin-1 levels but suppressed E-Cadherin level in breast tumor tissues, while overexpressing STC2 got the opposite appearances. These results proved that STC2 was a protector during TNBC progression, which could be the target gene for breast cancer therapy.

Hou et al. suggested that EMT procession could be inhibited by STC2, therefore suppressing migration and invasion of breast cancer [10]. However, Jiang et al. found that STC2 expressed highly in breast cancer tissues, resulting in a significant effect on lymph node metastasis, distant metastasis, tumor node metastasis (TNM) stage and histological grade [11]. As well, Liang et al. also confirmed that STC2 expressed highly in breast cancer, which was correlated with the pathological stage and tumor size, but they used MCF-7 as the cell model to investigate the molecular mechanisms relating to the down-regulation of ki67 and cyclin D1 and upregulation of cleaved caspase3 [12].

In our study, we firstly measured STC2 level in TNBC tissues comparing to the para-carcinoma. The results showed the lower STC2 level in TNBC tissues, significantly. Secondly, we used MDA-MB-231, representing as TNBC, to confirm the inhibiting effect of STC2 on MDA-MB-231 migration and invasion. Thirdly, we injected the MDA-MB-231 with overexpressing STC2 or silencing STC2 into nude mice, and then we found that the tumor with silencing STC2 grew faster than the overexpressing STC2, as well as the NC group. EMT related proteins had been measured to confirm the migration and invasion of TNBC tumor. The animal experiments also confirmed that the STC2 prevented TNBC from metastasis and invasion, as well as the tumor growth. Our results were accorded with those confirmed by Hou et al. [8] but opposite to the others [11, 12]. We suggested that the different results might be the different types of breast cancer. STC2 might suppress TNBC migration and invasion by inhibiting EMT progression but promote the other breast cancer.

The effect of STC2 on breast cancer cell apoptosis was rarely studied. Qiong et al. concluded the inhibition of STC2 expression on proliferation of prostate cancer cells, and STC2 could induce prostate cancer cells apoptosis [13]. Qie et al. investigated the effects of STC2 in a variety of cancer and concluded the promotion of STC2 on cancer cell proliferation but inhibition on apoptosis in nutrient-deprived conditions [14]. Huan et al. used MCF-7 to study the role of STC2 acting in the biological characteristics of breast cancer, and then they suggested the higher level of STC2 in breast cancer and the inhibition on MCF-7 apoptosis [12]. In our study, we found that overexpressing STC2 in MDA-MB-231 suppressed cell proliferation but promoted cell apoptosis, as well as suppressing cell cycle G2/M progression. Our results were with opposite appearances with some of previous researches. We suggested the reason as basing on different type of breast cancer.

PKC/PI3K/AKT/mTOR pathway shows aberrations in breast cancer, especially in TNBC [15]. PKC/PI3K/AKT/mTOR pathway has been activated in most types of breast cancer, which promotes tumor grow, proliferation and cancer progression. In this study, we measured PKC/PI3K/AKT/mTOR pathway in MDA-MB-231 with overexpressing STC2 or silencing STC2, and we found that STC2 expression could suppress over-activation of PKC/PI3K/AKT/mTOR. When using PI3K/AKT or mTOR inhibitors, the STC2 level had been upregulated comparing to the Blank group, not only in normal MDA-MB-231, but also in MDA-MB-231 with overexpressing STC2. PKCδ inhibitor had not obvious effect on STC2 in MDA-MB-231 comparing to the Blank, and the overexpression STC2 with PKCδ inhibitor treatment seemed to be downregulated, comparing to PI3K/AKT or mTOR inhibitors treatments. These results suggested that STC2 could suppress PKC/PI3K/AKT/mTOR pathway, and PKC/PI3K/AKT/mTOR pathway might repress STC2 expression, while PKCδ might upregulate STC2, at both transcriptional and translational levels.

On one side, there were some limitations in our study. Firstly, only 35 cases were included in this research. More clinical samples were needed to confirm the STC2 level in TNBC. Secondly, we only used MDA-MB-231 to represent TNBC in this study. More cell lines were carried on to investigated the different functions of STC2 in different kinds of breast cancer. Thirdly, the molecular mechanisms of STC2 in breast cancer, especially the relationship between STC2 and the signal pathway, were still unclear. More evidences should be found to understand the molecular mechanisms. On the other side, our study provided the clinical researches on TNBC with a new molecular target. STC2 was with potential value to be the therapeutic target in treating TNBC, as the protective molecular to suppress TNBC progression. Our study provided clinical researches on TNBC with new molecular evidences.

5 Conclusion

In a conclusion, STC2 expressed lower in TNBC tissues comparing to the para-carcinoma tissues in human body. Over-expression of STC2 could suppressed metastasis, invasion and proliferation of TNBC cells MDA-MB-231 but promoting its apoptosis. STC2 could suppress breast tumor growth in nude mice and inhibit the tumor developing EMT. The molecular mechanisms might be correlated with PKC/PI3K/AKT/mTOR pathway activation. Therefore, STC2 could be the target therapy for treating TNBC, as well as with values on pathological analysis, efficacy evaluation and prognosis evaluation of breast cancer. Our studies provided clinical treatment on TNBC with molecular mechanisms. Further investigations would be focused on the influence of TNBC progression by using drugs targeting at STC2 level, both in vitro and in vivo.