Test Products
Boiled, hard, sugar-free candies that were either supplemented or not supplemented with L. paracasei DSMZ16671 were produced for this study by DR.C SOLDAN® GmbH (Nuremberg, Germany), a company certified to have met the requirements of International Food Standard (IFS) version 5 for the development, manufacture, and packaging of drops, fruit jelly sweets, and pastilles (category 14). The pasteurized and spray-dried L. paracasei DSMZ16671 had been added as the active ingredient in its commercially available form (Lactobacillus pro-t-action®, BASF Future Business GmbH, Ludwigshafen, Germany). The dosage of L. paracasei DSMZ16671 in the candies was confirmed from the sodium content of the candies as measured by atomic spectrometry. Briefly, the candies were produced by mixing, then boiling, all ingredients (except flavoring agents and L. paracasei DSMZ16671) until achieving a homogeneous melt. The melt was then cooled to 80 °C, whereupon flavor and L. paracasei DSMZ16671 were added, while mixing. This hot melt was pressed into forms, cooled, and packaged as candies. Basic ingredients for the test candies were isomaltitol, maltitol, water, sucralose, and mint oil. Test and placebo candies were identical in weight (2.5 g), size, color, and flavor.
Study Design and Subjects
A randomized, placebo-controlled, double-blind, in vivo study was done with 3 study arms: placebo, test group 1 (1 mg L. paracasei DSMZ16671/candy), and test group 2 (2 mg L. paracasei DSMZ16671/candy). Study subjects (n = 60) gave informed written consent consistent with ICH Good Clinical Practice guidelines. This study was conducted at a single center in Berlin, Germany. As the trial was not a clinical trial, an ethical committee did not need to be considered, and the trial was not registered, as at the time of the trial in Germany, it was not customary for pilot-type trials to be registered.
This clinical trial was designed as a pilot to gain information regarding the treatment effect. Although there was not enough data for a sample size calculation, the trial proceeded with a sample size of 20 subjects per study group. The randomization procedure was a block randomization of 10 blocks with a block size of 6. Randomization was performed beforehand and the resulting allocation was recorded in the allocation lists. The participants those administering the treatment and those evaluating the results were blinded to the group assignment.
Subjects were excluded if under current treatment for oral or pharyngeal inflammation, restorative, gingival/periodontal, or oral surgical problems, brushed their teeth more than three times daily, used antibiotics or had dental hygiene treatment in the past 6 weeks, used full artificial dentures, were currently pregnant or lactating, had history of alcohol abuse or drug addiction, or had German language difficulties. Inclusion criteria were good health, age over 18, and written consent. There was no preselection screening of subjects for baseline levels of mutans streptococci.
Test Schedule
The study was conducted according to the protocol and was performed over two successive days. Subjects were not to perform any oral hygiene activities or consume coffee, tea, wine, probiotic foods (such as yoghurt or cheese) from the evening prior to the first study day until completion of the study 1.5 days later. They were instructed to expectorate one mL of saliva (R-1) into a sterile 15-mL polyethylene (PE) tube, without any mechanical or taste stimulation, upon rising. This sample (R1) was to be transported to the study site within 1 h. At the study site, a second saliva sample (Pre-1) was collected before candy use. All subjects were then randomized to one of three treatment groups (placebo, test 1, or test 2) and were instructed to consume a single assigned candy piece by sucking, until fully consumed, and to refrain from chewing. The assigned candies were provided in packages coded so as to keep subjects and investigators blind. Immediately (no later than 10 min) after consuming the candy, the subjects collected another saliva sample (Post-1). Subjects who had removable partial dentures wore them throughout all study procedures.
Each subject consumed 3 more candies, one at a time, during the day, 10 min after each unsupervised meal, and was instructed not to exchange candies with other study participants.
On day 2, all subjects again collected a saliva sample upon rising (R-2), and another saliva sample (Pre-2) was collected at the study site before sucking another identically coded candy. A final saliva sample (Post-2) was collected within 10 min after consumption of this candy.
Sampling and Sample Analysis
Except for the unsupervised saliva samples collected early in the mornings upon rising, all samples were collected on-site, under supervision by trained clinical staff. The samples were kept at room temperature and transported to the microbiology facility, and processed within a maximum of 2 h of collection, which had been established in pretests to give reliable and reproducible results (CFU). They were homogenized by sonication (15 min, ultrasonic bath Bandelin Sonorex GT120), vortexed, and a 0.5 mL volume of each was transferred into a sterile PE tube, diluted with 4.5 mL phosphate-buffered saline, and re-vortexed. One milliliter aliquot of 1:100 and 1:500 dilutions was spread in duplicate onto selective TSY20B agar [11]. The TSYB medium which was used for the detection and quantification is selective for mutans streptococci (S. mutans, S. sobrinus, etc.). The medium contains Bacitracin, which is an antibiotic selective for mutans streptococci among other bacteria. The plates were incubated anaerobically at 37 °C for 5 days and CFU/mL of saliva determined. Colonies were confirmed as S. mutans by random PCR checks using specific primers (Sm F5: AGCCATGCGCAATCAACAGGTT; Sm R4: CGCAACGCGAACATCTTGATCAG [12]). Data were recorded on Case Report Forms.
Primary Outcome Measures
The primary outcome measure was the group change in salivary concentration of mutans streptococci immediately before (Pre-1, day 1 and Pre-2, day 2) and after (Post-1, day 1 and Post-2, day 2) consuming the test candies as compared to placebo candy. A second outcome measure was the individual study subject change in salivary mutans concentration.
Product Acceptability Evaluation
Study subjects were asked to rate the acceptability of candies through an interview conducted by the blinded investigator.
Statistical Methods
As mutans streptococcal counts were not normally distributed, as expected [5], all values were log-transformed to improve distribution for parametric analysis. Per protocol, data sets with less than 1,500 CFU/mL were excluded from further consideration due to the limit of detection.
Frequency distributions were analyzed using the chi-square test (p
chi-value). The Kruskal–Wallis (p
KW-value) method was employed to test for among-group comparisons (placebo vs. test groups). Comparisons within a group (e.g., pre- vs. post-consumption) were performed using the Wilcoxon signed-rank test (p
Wil). The mean relative difference in the number of mutans streptococci before (Pre-1) and after (Post-1) candy consumption was calculated for all three groups, for day one [Post-1 vs. Pre-1] and day two [Post-2 vs. Pre-2]. Statistical analyses were performed with SPSS (SPSS for Windows, Release 19, LEAD Technologies, Inc.). Values of p < 0.05 were considered significant. Means were given with 95 % confidence intervals. Nonparametric analyses were performed because of the small sample size and its emphasis on the qualitative results. The t test was used for quantitative descriptions. CI was presented for this pilot study and represents the individual range of data and provides information about the variance of the data.