Introduction

Iron (Fe) is one of the abundant microelements in plant cells. It participates in many metabolic pathways and life processes, such as photosynthesis, respiration, hormone synthesis, energy metabolism, and DNA repair (Barton and Abadia 2006; Lill 2009; Couturier et al. 2013; Song et al. 2022). Notably, Fe deficiency in soils seriously decreases crop yield and reduces quality (Tagliavini et al. 2000; Tagliavini and Rombolà 2001; Kobayashi and Nishizawa 2012).

Higher plants implement two kinds of root Fe absorption strategies to adapt to Fe deficiency stress (Kobayashi and Nishizawa 2012; Zelazny and Vert 2015; Fourcroy et al. 2016; Zhang et al. 2019, 2021; Mondal et al. 2022). Strategy I is common in dicotyledons and non-gramineous monocotyledons. In this strategy, H+ is secreted into the rhizosphere through H+-ATPase located on the surface of root cell membrane. This action lowers the pH value of surrounding soil, promotes the dissolution of Fe3+, and reduces Fe3+ to Fe2+ through ferric reductase oxidase (FRO). Subsequently, Fe2+ is absorbed by iron regulated transporter (IRT) members (Barton and Abadia 2006; Kobayashi and Nishizawa 2012; Mondal et al. 2022). Strategy II is common in gramineous plants, in which a series of enzymatic reactions are implemented and mugineic acids (MAs) are synthesized and secreted, forming chelates with Fe3+ in the rhizosphere. Subsequently, MA-Fe3+ chelates are absorbed by the root cells through a specific type of Fe chelator phytosiderophore (PS) pathway that depends on yellow stripe (YS) or yellow stripe-like (YSL) transporters (Schaaf et al. 2005; Zhang et al. 2019; Mondal et al. 2022; Song et al. 2023).

In model plants such as Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa), IRT1 transporters play a role in root Fe2+ transport in Strategy I plants. They also regulate the transport of other ions like Mn2+, Cd2+ and Zn2+ (Eide et al. 1996; Vert et al. 2002, 2009; Nakanishi et al. 2006; Zelazny and Vert 2015; Fourcroy et al. 2016). AtIRT1 is able to transport a broad range of substrates, including Fe2+, Mn2+, Cd2+ and Zn2+ (Eide et al. 1996; Roger et al. 2000; Fourcroy et al. 2016). AtIRT2 was highly expressed in root epidermis, being significantly induced under Fe deficiency. AtIRT2 located in intercellular vesicles stored Fe2+ through compartmentalization to prevent excessive accumulation of Fe2+ absorbed by AtIRT1 from causing toxicity (Vert et al. 2009; Mondal et al. 2022). IRT1 transporters have been subsequently isolated from Solanum lycopersicum (Eckhardt et al. 2001), Malus xiaojinensis (Li et al. 2006), and Arachis hypogaea (Ding et al. 2010). Notably, rice possesses full Strategy II and partial Strategy I and can directly uptake and utilize Fe2+, depending on the way how it absorbs Fe (Ishimaru et al. 2006; Nakanishi et al. 2006; Kobayashi and Nishizawa 2012; Mondal et al. 2022; Song et al. 2023). In particular, OsIRT1 and OsIRT2 were located in the plasma membrane of root epidermal cells and functioned by transferring Fe2+, similar to that of IRT transporters in Strategy I plants, and can also transport Cd2+ (Bughio et al. 2002; Ishimaru et al. 2006; Nakanishi et al. 2006). Further studies revealed that natural resistance associated macrophage proteins (NRAMPs) were identified as a ubiquitous family of metal efflux transporters in rice, and NRAMP1 acts as a transporter of arsenic and manganese and is also essential for low-affinity Fe uptake in rice (Tiwari et al. 2014; Agorio et al. 2017; Mondal et al. 2022; Song et al. 2023).

Application of Fe fertilizer directly influences the growth, flowering, fruit quality, and yield of fruit trees, including grapes (Vitis vinifera) (Song et al. 2016a, b, 2023; Sheng et al. 2020). Despite the well-documented genome of grapes (Jaillom et al. 2007), understanding the molecular mechanisms underlying Fe absorption and transport in grape remains limited. In this study, we isolated VvIRT7 from ‘Marselan’ grape, exploring its expression pattern and potential biological functions. This study contributes valuable gene resources for unraveling the role of VvIRT transporters in grape, shedding light on the molecular mechanisms of Fe absorption and efficient utilization in fruit trees.

Materials and methods

Plant material and growth condition

This study utilized 5-year-old ‘Marselan’ vines and 1-month-old tissue-cultured seedlings, sourced from the Shandong Grape Germplasm Repository in Yantai, China (Zhang et al. 2021; Song et al. 2023). The vines and seedlings were grown under controlled conditions in a growth chamber with a 12/12 h day/night light photoperiod, a 25/20 °C day/night thermoperiod, and 60% relative humidity. For sample collection, leaves, stems, and roots of seedlings, as well as young leaves, mature leaves, full-blooming flowers, young fruits, and mature fruits of 5-year-old vines were collected and immediately frozen in liquid nitrogen for subsequent qRT-PCR analysis. Each experiment involved three biological replicates, with 12 sample sections in each.

The ‘Marselan’ tissue-cultured seedlings were germinated on half-strength MS solid medium (Murashige and Skoog 1962) for 1 month, followed by transfer to half-strength MS solution in plastic containers within the growth chamber. For Fe depletion treatment, Fe was omitted from the MS medium, following established protocols (Song et al. 2014b, 2022, 2023; Zhang et al. 2021). Seedlings underwent Fe depletion for 48 h before expression analysis, and each experiment was replicated three times, with 15 seedlings in each replication.

The wild type Arabidopsis (Col-0), the irt1 knockout mutant, and irt1/35S::IRT7 complementation lines were cultivated in a growth chamber under conditions detailed in previous studies (Zhang et al. 2021; Song et al. 2022, 2023). Seedlings were cultured on half-strength MS medium for 14 days before physiological analysis. The experiments were replicated three times, each involving 20 seedlings.

Physiological analysis

The fresh and dry weights of 20 Arabidopsis seedlings (Col-0, irt1 knockout mutant, and irt1/35S::IRT7 complementation) were measured using an Analytical Balance (Thermo Electron, Waltham, USA). Root characteristics of Col-0, irt1 knockout mutant, and irt1/35S::IRT7 seedlings, including total root length, lateral root numbers, and total surface area, were analyzed using an Epson Rhizo scanner (Long Beach, CA, USA) and the Epson WinRHIZO software (Long Beach, CA, USA). Fe concentration was determined by ICP-AES systems (IRIS Advantage, Thermo Electron, Waltham, USA) after samples were digested using the HNO3–HClO4 method (Song et al. 2014a, 2016b, 2022, 2023; Sheng et al. 2020). Activity assay of aconitase (ACO), nitrite reductase (NiR) and succinate dehydrogenase (SDH) were carried out using relevant detection kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), according to the manufacturer’s descriptions. Chlorophyll was extracted and quantified using the BioRad SmartSpec 3000 spectrophotometer (Wadsworth, Illinois, USA), as mentioned in Song et al. (2014a, 2022) and Sheng et al. (2020). Chlorophyll extraction and quantification were carried out using the BioRad SmartSpec 3000 spectrophotometer (Wadsworth, Illinois, USA), as detailed in previous studies (Song et al. 2014a, 2016b, 2022, 2023; Sheng et al. 2020).

Tissue Fe distribution analysis

After germination on half-strength MS solid medium for 14 days, Arabidopsis seedlings underwent Prussian blue staining following the method outlined by Meguro et al. (2007). Tissue samples were sectioned into small pieces and immersed in a Prussian blue staining solution (4% HCl:4% potassium hexacyanoferrate(II) = 1:1). Subsequently, the stained fragments were washed with deionized water, immersed in chloral hydrate solution until full transparency was achieved, and then subjected to observation using an OLYMPUS CX23 Electron Microscope (Tokyo, Japan). Fe-containing tissues were visualized through a blue stain.

Isolation and cloning of VvIRT genes

The putative VvIRT genes were identified by referencing the amino acid sequences of Arabidopsis AtIRT1-3 (Kobayashi and Nishizawa 2012) and screening the Grape Genome Database (Jaillom et al. 2007). The coding sequence (CDS), genomic DNA sequence, and amino acid sequence of VvIRT genes were retrieved. Verification of the amino acid sequences of VvIRT proteins were performed using Pfam and InterProScan 4.8 online servers. Specific prime pairs were designed for CDS cloning of VvIRT genes. Total RNA was extracted from 1-month-old ‘Marselan’ seedlings using the RNAprep Pure Plant Kit (TianGen, Beijing, China), and 1 μg of RNA was reverse-transcribed into the first-strand cDNA template using the PrimeScript™ RT reagent kit (Takara, Dalian, China). The CDS of VvIRT genes were then amplified using Prime STARTM HS DNA polymerase (Takara, Dalian, China) and sequenced by Shenggong Bioengineering Co. Ltd. (Shanghai, China). Successfully sequenced CDSs were submitted to NCBI GenBank to obtain accession numbers, which are listed in Supplementary Table S1.

Phylogenetic tree construction

The amino acid sequences of IRT homologs from various plant species, including grape (VvIRT1-VvIRT10), Arabidopsis thaliana (AtIRT1-AtIRT3), Raphanus sativus (RsIRT1), Arachis hypogaea (AhIRT1), Citrus sinensis (CsIRT1), Gossypium hirsutum (GhIRT1), Oryza sativa (OsIRT1 and OsIRT2), Zea mays (ZmIRT1), Populus trichocarpa (PtIRT1), Malus xiaojinensis (MxIRT1), Prunus persica (PpIRT1), P. mume (PmIRT1), Pyrus betulaefolia (PbIRT1), Solanum lycopersicum (SlIRT1), and S. tuberosum (StIRT1), were aligned using ClusterX 2.0.13 software. The phylogenetic tree of plant IRT homologs was constructed using the maximum likelihood method in MEGA 15.0. A bootstrap test with 1000 iterations was employed to assess the confidence of the tree.

RNA extraction and quantitative real time PCR (qRT-PCR)

Specific primers for VvIRT genes were designed using NCBI/Primer-BLAST on-line server (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome). The primer sequences were listed in Supplementary Table S1. PCR analysis was conducted on 7500 Real Time PCR System (Applied Biosystems, New York, USA) using SYBR Premix Ex Taq (TaKaRa, Kyoto, Japan) reaction kit. The specificity of primers was determined by observing the melting curve of qRT-PCR products and the presence of specific bands on agarose gel. The grape in-house keeping gene Ubiquitin was used as the internal reference for normalization, as in previous studies (Tang et al. 2020; Zhang et al. 2021; Song et al. 2023). PCR conditions were arranged as follows: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 34 s. Relative expression levels of VvIRT genes were presented after normalization to the internal reference Ubiquitin from three independent biological repeats, each with four technical replicates.

To investigate the response of VvIRT genes under Fe depletion at the transcriptional level, the expression value under control condition was set as 1. A relative expression value under Fe depletion < 1 indicates a decrease in the gene expression level (depicted in blue), while a value > 1 it means an increase in the gene expression level (depicted in red). A heat map illustrating the expression changes was generated using HemI software (Sheng et al. 2020; Zhang et al. 2021, 2022; Song et al. 2022, 2023).

Complementation of VvIRT7 gene in yeast mutant

The recombinant plasmid pYH23-IRT7 was constructed by cloning the CDS region of VvIRT7 gene into pYH23 vector (Eide et al. 1996; Nakanishi et al. 2006; Vert et al. 2009), using the forward primer 5′- GACGGATCCATGGCCTCGTGCGTAGGCGAT -3′ (BamH I was underlined) and reverse primer 5′- GAGTCTAGAGTCAGGCCCAAAGGGCCAGAAC -3′ (Xba I was underlined). According to the description of Eide et al. (1996) and Vert et al. (2009), yeast mutant DEY1453 (MAT α/MAT α Ade2/+canl/canl his3/his3 leu2/leu2 trpl/trpl ura3/ura3 fet3-2::HIS3/fet3-2::HIS3fet4-1::LEU2/fet4-1::LEU2) was transformed with pYH23 or recombinant plasmid pYH23-IRT7. Yeast transformants were cultured in liquid YPD medium (1% yeast extract, 2% peptone, 2% glucose) until the OD600 reached 1.0. The culture was then diluted to concentrations of 10−1, 10−2, and 10−3. Yeast cell growth was determined in synthetic defined medium (SD, 6.7 g L−1 of yeast nitrogen base without amino acids, pH 5.5), supplied with 10 or 0 μmol L−1 Fe2SO4, respectively. For Fe-depleted media (0 μmol L−1 Fe2SO4), 50 μmol L−1 bathophenanthroline disulfonic acid (BPDS) was added. Pictures were taken 60 h after incubation at 30 °C.

Generation of transgenic Arabidopsis complementing VvIRT7 gene

The recombinant plasmid pBH-IRT7 was constructed by cloning the CDS region of VvIRT7 gene into pBH vector (Supplementary Fig. S1; Song et al. 2022; Zhang et al. 2022), using the forward primer 5′- GACGAGCTCATGGCCTCGTGCGTAGGCGAT -3′ (SacI was underlined) and reverse primer 5′- GAGTCTAGATCAGGCCCAAAGGGCCAGAAC -3′ (Xba I was underlined). The recombinant plasmid was subcloned into Agrobacterium tumefaciens EHA 105. Subsequently, it was transformed into the previously germinated Arabidopsis irt1 knockout homozygote mutant on half-strength MS solid medium for 1 month, using the floral dip method. Independent T1 generation of irt1/35S::IRT7 complementation lines were obtained by screening hygromycin resistant regenerated Arabidopsis seedlings. The genomic DNA was extracted from T1 generation of irt1/35S::IRT7 lines using the Universal Genomic DNA Extraction Kit (TaKaRa, Dalian, China), and further verified the existence of a 1008 bp product of VvIRT7 by reverse transcription PCR. T1 generation of irt1/35S::IRT7 seedlings were grown on half-strength MS solid medium for 2 weeks, and total RNA of shoots and roots T1 transgenic lines were extracted and synthesized into the first strand cDNA template for presence determination of VvIRT7. Purified T3 generation seeds of #1, #5, and #15 irt1/35S::IRT7 complementation lines were harvested and sown on half-strength MS solid medium for 21 days before physiological analysis, respectively. Data of #1 irt1/35S::IRT7 complementation lines were shown in this work. Biological repeats were carried out for three times, each with 20 seedlings.

Statistical analysis

Graphs were created using Origin 12.0 software. Significant differences were analyzed using the Student’s t-test in SPSS 13.0 software (SPSS Chicago, IL, USA) or ANOVA followed by Fisher’s LSD test, with details provided in the legends.

Results

Isolation of IRT genes in grape

In total, 10 putative IRT genes were identified from the grape genome and designated as VvIRT1 to VvIRT10 (see Supplementary Fig. S2). The Genbank numbers of these genes are listed in Supplementary Table S1. Protein domain verification demonstrated that all of them possess the zinc/Fe transporter domain (PF02535), confirming their classification as Fe regulated transporters.

Phylogenetic tree analysis revealed that IRT homologs from Rosaceae (M. xiaojinensis, P. betulaefolia, P. persica, and P. mume), Gramineae (O. sativa and Z. mays) or Brassicaceae (A. thaliana and R. sativus) share the closest genetic relationships. Moreover, VvIRT1 was closely clustered with known plant IRT1 homologs, including AtIRT1, SlIRT1, and Rosaceae IRT1 members. VvIRT2 and VvIRT3 were tightly clustered with OsIRT1 and ZmIRT1, while VvIRT4-10 transporters were prone to be closely clustered together (Fig. 1).

Fig. 1
figure 1

Phylogenetic tree of plant IRT homologs. Phylogenetic tree of plant IRT homologs from grape (VvIRT1-VvIRT10), Arabidopsis thaliana (AtIRT1-AtIRT3), Raphanus sativus (RsIRT1), Arachis hypogaea (AhIRT1), Citrus sinensis (CsIRT1), Gossypium hirsutum (GhIRT1), Oryza sativa (OsIRT1 and OsIRT2), Zea mays (ZmIRT1), Populus trichocarpa (PtIRT1), Malus xiaojinensis (MxIRT1), Prunus persica (PpIRT1), P. mume (PmIRT1), Pyrus betulaefolia (PbIRT1), Solanum lycopersicum (SlIRT1), and S. tuberosum (StIRT1) was constructed using the maximum likelihood method in MEGA 13.0 to analyze the genetic evolution relationship. Scale indicates genetic distance

Full size image

Expression profiles of VvIRT genes

Results showed that the expression levels of VvIRT genes varied significantly among different tested tissues/organs, including annual young leaves, mature leaves, new phloem, new roots, full blooming flowers, young fruits, mature fruits, and leaves, stems, and roots of ‘Marselan’ seedlings (Fig. 2). In particular, the overall expression of VvIRT7 was the most abundant, with the highest level observed in roots (both in adult vines and seedlings), followed by mature fruits and leaves (in both adult vines and seedlings). Notably, VvIRT8 exhibited specific expression in full bloom flowers, and VvIRT9 was dominantly expressed in leaves, while VvIRT1 and VvIRT2 were exclusively observed in roots of both adult vines and seedlings. Additionally, the highest expression level of VvIRT6 were found in mature fruits, followed by leaves. Although the overall expression level was extremely low, the highest expression level of VvIRT4 was detected in roots, and VvIRT5 showed the highest expression in fruits. However, the expression of VvIRT3 and VvIRT10 was not detected in the tested tissues in this study (Fig. 2).

Fig. 2
figure 2

Tissue specific expression analysis of VvIRT genes in grape. Samples of leaves, stems and roots of seedlings, and young leaves, mature leaves, full blooming flowers, young fruits, and mature fruits of 5-year-old vines were collected and frozen immediately in liquid nitrogen before qRT-PCR analysis. Data are presented as means ± SD (n = 3)

Full size image

Differential response of VvIRT genes under Fe depletion in tissue-cultured seedlings

Further analysis revealed that VvIRT genes exhibited differential responses to Fe depletion in tissue-cultured grape seedlings (Fig. 3). Thus, five genes (VvIRT1, VvIRT4, VvIRT6, VvIRT7 and VvIRT9) responded to Fe depletion in at least one tested tissue (leaves, stems, or roots), showing significantly increased expression levels, while the remaining five genes exhibited minimal changes. Notably, VvIRT4, VvIRT6, and VvIRT7 demonstrated high sensitivity to Fe depletion, with their expression levels up-regulated throughout the entire plant seedlings. Additionally, the expression of VvIRT1 and VvIRT9 in roots was induced under Fe depletion (Fig. 3).

Fig. 3
figure 3

Response of VvIRT genes to Fe depletion in grape seedlings. One-month-old tissue-cultured ‘Marselan’ seedlings were subjected to Fe depletion for 48 h before analysis. Relative expression levels of the target genes were normalized to the internal control (Ubiquitin) from three independent biological replicates. Data are presented as means ± SD (n = 3). Significant differences between control and Fe-depleted conditions at P ≤ 0.05 were determined using Student’s t-test in the SPSS 13.0 software

Full size image

VvIRT7 restored the normal growth of yeast mutant DEY1453

Given that VvIRT7 emerged as the most abundantly expressed gene in the IRT family of grapes, particularly in roots, with heightened expression under Fe depletion across all tested tissues (Figs. 2, 3), we proceeded to functionally assess VvIRT7 using yeast expression system. The yeast mutant DEY1453, which is deficient in Fe2+ uptake, cannot grow normally on YPD medium in the absence of Fe2+ (Eide et al. 1996; Nakanishi et al. 2006; Vert et al. 2009). We conducted a comparison of yeast cell growth on YPD medium supplemented with varying concentrations of Fe2+. Notably, DEY1453 cells harboring either pYH23 or pYH23-IRT7 thrived on YPD medium supplemented with 10 μmol L−1 Fe2+. However, only DEY1453 cells containing pYH23-IRT7 displayed normal growth on YPD medium supplemented with 0 μmol L−1 Fe2SO4, while DEY1453 cells with the empty vector pYH23 failed to grow (Fig. 4). These findings suggest that VvIRT7 directly participates in Fe2+ uptake or transport in yeast, thereby restoring the normal growth of the DEY1453 mutant.

Fig. 4
figure 4

Functional determination of VvIRT7 in yeast. The yeast mutant DEY1453, harboring either the empty vector pYH23 or the recombinant plasmid pYH23-IRT7, was cultured in liquid YPD medium (1% yeast extract, 2% peptone, 2% glucose) until reaching an OD600 of 1.0. The culture was then diluted to concentrations of 10−1, 10−2, and 10−3. Yeast cell growth was assessed in synthetic defined medium (6.7 g L−1 of yeast nitrogen base without amino acids, pH 5.5) supplemented with either 10 or 0 μmol L−1 Fe2SO4. For Fe-depleted media (0 μmol L−1 Fe2SO4), 50 μmol L−1 bathophenanthroline disulfonic acid (BPDS) was added. Pictures were captured after 60 h of incubation at 30 °C

Full size image

VvIRT7 rescued the retarded growth of Arabidopsis irt1 mutant

In Arabidopsis, the growth of the irt1 knockout mutant was severely hindered, accompanied with chlorosis symptoms (Eide et al. 1996; Vert et al. 2002, 2009). To investigate whether VvIRT7 could restore the normal growth of the irt1 mutant, VvIRT7 was subcloned into the binary expression vector pHB (Supplementary Fig. S1A). At least 6 putativeT1 generation irt1/35S::IRT7 complementation lines (#1, #5, #7, #11, #12, and #15) were verified using reverse transcription PCR for the presence of a 1008 kb fragment of VvIRT7 (Supplementary Fig. S1B), which was dominantly expressed in the roots of T1 generation irt1/35S::IRT7 lines (Fig. 5A). Purified T3 generation of #1, #5, and #15 irt1/35S::IRT7 lines were randomly selected for further physiological analysis, with data of #1 irt1/35S::IRT7 lines presented in this work.

Fig. 5
figure 5

Generation and phenotype analysis of VvIRT7 complementation Arabidopsis seedlings. A Tissue specific expression of VvIRT7 in T1 generation irt1/35S::IRT7 lines. The genomic DNA was extracted from T1 generation of irt1/35S::IRT7 lines using the Universal Genomic DNA Extraction Kit (TaKaRa, Dalian, China) and further verified for the existence of a 1008 bp product of VvIRT7 by reverse transcription PCR. B Phenotype analysis of T3 generation #1 irt1/35S::IRT7 lines. Arabidopsis seedlings were grown on half-strength MS solid medium for 14 days before phenotype analysis. The control condition is shown on the left, and Fe depletion condition is shown on the right. Note M, standard DL2000 DNA ladder (Takara, Dalian, China). WT wild type, S shoots, R roots. (Color figure online)

Full size image

Compared to the wild type, the irt1 mutant lines exhibited severe withering, loss of green leaves, and reduced fresh weight, dry weight, total root length, total root surface, lateral root numbers, and total leaf chlorophyll under both control conditions and Fe depletion (Fig. 5B; Table 1). Indeed, the tissue Fe concentration in irt1 mutant lines was significantly reduced under both conditions (Table 1). Notably, the Fe–S protein NiR, a key enzyme in chloroplastic nitrogen assimilation, as well as ACO and SDH, crucial for mitochondrial citric acid cycle of glycol metabolism, showed significantly reduced activity in irt1 mutant lines under both conditions (Table 1). In contrast, #1 irt1/35S::IRT7 lines exhibited a healthier growth status than that of the irt1 mutant lines under both conditions (Fig. 5B). Simultaneously, the fresh weight, dry weight, total root length, total root surface, lateral root numbers, total leaf chlorophyll, ACO activity, NiR activity, and SDH activity of #1 irt1/35S::IRT7 lines were significantly enhanced, compared to the irt1 mutant (Table 1). These findings imply that the complementation of VvIRT7 effectively rescued the retarded growth of the irt1 mutant.

Table 1 Physiological analysis of irt1/35S::IRT7 lines under control conditions
Full size table

In comparison to the wild type, the tissue Fe concentration in the whole plant of irt1 mutant lines decreased under both control conditions and Fe depletion. Conversely, the Fe concentration in irt1/35S::IRT7 lines was increased compared to that of the irt1 mutant lines. Consistently, under control conditions, tissue Prussian blue staining analysis revealed that the most abundant Fe was detected in the roots of the wild type, while tissue Fe distribution was significantly reduced in tested tissues of irt1 mutants (Fig. 6). Notably, Fe distribution was specifically strengthened in the roots of #1 irt1/35S::IRT7 lines compared to that of irt1 mutants (Fig. 6), which aligns with the fact that VvIRT7 was dominantly expressed in the roots the of the T1 generation irt1/35S::IRT7 lines (Fig. 5A). However, Fe distribution was hardly observed in all tested seedlings under Fe depletion, and there was no significant difference among the wild type, irt1 mutant, and #1 irt1/35S::IRT7 lines (Supplementary Fig. S3). These findings collectively suggest that the iron regulated transporter VvIRT7 is likely implicated in regulating Fe2+ transport in grape.

Fig. 6
figure 6

Tissue Fe distribution analysis. After germination on half-strength MS solid medium for 14 days, Arabidopsis seedlings were subjected to Prussian blue staining, and sliced tissue sections were chosen for microscope examination of tissue iron distribution. Fe-containing tissues were dyed in blue. (Color figure online)

Full size image

Discussion

As one of the most indispensable mineral elements in fruit trees, Fe directly affects tree growth, flowering, fruit quality formation, and fruit yield (Couturier et al. 2013; Song et al. 2016a, b, 2022, 2023; Sheng et al. 2020). The concentration of Fe required for normal plant growth is typically in the range of 10−9 to 10−4 mol L−1. However, the concentration of Fe2+ and Fe3+ in soils under normal pH values usually does not exceed 10−15 mol L−1, falling significantly short of meeting the needs for normal plant growth (Barton and Abadia 2006; Kobayashi and Nishizawa 2012; Couturier et al. 2013). Despite the critical role of Fe, the molecular basis and regulatory mechanisms governing Fe uptake and transport in fruit trees remain largely unknown. As a dicotyledon woody fruit vine, grape belongs to Strategy I Fe absorption plants (Kobayashi and Nishizawa 2012; Zhang et al. 2019; Mondal et al. 2022). In this study, we isolated 10 VvIRT transporters from grapes, and the corresponding amino acid sequences, along with homologs from 14 other plants, were highly conserved, with an identity of 60.58% (Supplementary Fig. S1). Notably, IRT homologs of Rosaceae, Cruciferous, or Gramineae were prone to be closely clustered, while VvIRT transporters were likely to be tightly clustered (Fig. 1), implying that IRT homologs from the same family or near genus may possess a closer genetic distance and similar biological functions during the long-term evolution. Therefore, studying the function of grape IRT transporters may provide theoretical support for revealing the biological function of IRT homologs from Vitaceae or Vitis plants.

In particular, four genes (VvIRT1, VvIRT2, VvIRT4 and VvIRT7) exhibit high expression levels in the roots of both adult vines and tissue cultured seedlings (Fig. 2), which aligns with observations in other plant species such as AtIRT1 and AtIRT2 in Arabidopsis (Eide et al. 1996; Vert et al. 2002, 2009), OsIRT1 and OsIRT2 in rice (Ishimaru et al. 2006; Nakanishi et al. 2006), AhIRT1 in peanut (Ding et al. 2010), MxIRT1 in M. xiaojinensis (Li et al. 2006), and RsIRT1 in radish (He et al. 2013), suggesting a functional role for IRT transporters in plant roots. Previously studies demonstrated that the expression of AtIRT1 (Eide et al. 1996), AhIRT1 (Ding et al. 2010), MxIRT1 (Li et al. 2006), and RsIRT1 (He et al. 2013) in roots significantly increased under Fe depletion. Consistently, 5 out of 10 genes (VvIRT1, VvIRT4, VvIRT6, VvIRT7 and VvIRT9) were responsive to Fe depletion in grape, with their expression significantly up-regulated, particularly in roots (Fig. 3). These findings suggest that these IRT genes play a crucial role in ensuring Fe uptake/transport in grape under Fe depletion, thereby maintaining optimal Fe2+ uptake or transport capacity in limited Fe conditions to support essential life activities dependent on Fe. Notably, VvIRT3 and VvIRT10 were not detected in the tested tissues in this study, potentially due to the higher threshold in the qRT-PCR identification system. Simultaneously, these two genes are likely to be pseudogenes that may have lost their protein-coding ability due to accumulated mutations or unprocessed segmental duplication over long-term evolution (Li et al. 2013; Cheetham et al. 2019), requiring further verification. Furthermore, the highest expression level of VvIRT7 was observed in roots, being 3–30 times that of VvIRT1, VvIRT4, VvIRT6, and VvIRT9 genes, respectively (Fig. 2). We speculate that the abrupt increase in VvIRT7 expression may serve as a crucial indicator that grape vines respond to environmental Fe deficiency stresses.

In Arabidopsis, AtIRT1 was identified as a key player in Fe2+ transport and the maintenance of cation dynamic equilibrium, with the knockout severely impeding normal plant growth (Eide et al. 1996). Despite having lower similarity to AtIRT1 (compared to VvIRT1, VvIRT2, or VvIRT3), VvIRT7 stands out as the most abundantly expressed IRT gene in grapes, exhibiting an increase in all tested tissues under Fe depletion. Moreover, the overexpression of VvIRT7 successfully rescued an Arabidopsis irt1 mutant in this study, potentially linked to distinct protein expression levels resulting from amino acid sequence divergence (Supplementary Fig. S2). Notably, the maximum expression level of VvIRT7 was detected in roots, three times that of VvIRT1 and six times that of VvIRT3. Despite being controlled by of a constitutive 35S promoter rather than its intrinsic promoter, the expression of VvIRT7 in transgenic Arabidopsis lines is higher in roots than in shoots (Fig. 5A). The site of integration of the transgene (VvIRT7) into the Arabidopsis irt1 mutant genome can influence its expression, and the 35S promoter may undergo epigenetic modifications in the roots of the transgenic lines, leading to its preferential silencing or activation in these tissues. Nonetheless, these findings partially explain that overexpression of VvIRT7 explain the specific strengthening of Fe distribution in the roots of irt1/35S::IRT7 lines, as revealed by further tissue Prussian blue staining, with the most abundant Fe detected in the roots of the wild type.

Encouragingly, tissue Fe concentration significantly increased in irt1/35S::IRT7, partially explaining the improved growth performance. Complementation of VvIRT7 may actively mobilize the limited Fe uptake capacity of irt1/35S::IRT7 lines to maintain basic life activities and metabolic processes dependent on a sufficient amount of Fe, including chlorophyll synthesis and the activities of key Fe–S proteins. Indeed, total leaf chlorophyll and the activities of ACO, NiR, and SDH were synchronously enhanced in irt1/35S::IRT7 lines (Table 1), contributing beneficially to plant perseverance. Once again, these findings underscore the indispensable role of Fe as a mineral element for plants to maintain normal growth (Barton and Abadia 2006; Couturier et al. 2013; Song et al. 2016a, b, 2022). Nonetheless, VvIRT7 emerges as a crucial Fe-regulated transporter implicated in root Fe2+ uptake or transport in grapes, especially under Fe-deficient conditions.

Conclusion

In summary, we isolated a total of 10 VvIRT family genes in grapes, revealing significant differences in their expression levels across distinct grape tissues and organs. VvIRT7, identified as the most abundantly expressed IRT family gene in grapes, demonstrated a remarkable ability to transport Fe2+, successfully restoring normal growth in the DEY1453 mutant. Furthermore, the overexpression of VvIRT7 proved effective in rescuing the impaired growth of the Arabidopsis irt1 knockout mutant.