Abstract
Current methods of CRISPR-Cas9-mediated site-specific mutagenesis create deletions and small insertions at the target site which are repaired by imprecise non-homologous end-joining. Targeting of the Cas9 nuclease relies on a short guide RNA (gRNA) corresponding to the genome sequence approximately at the intended site of intervention. We here propose an improved version of CRISPR-Cas9 genome editing that relies on two complementary guide RNAs instead of one. Two guide RNAs delimit the intervention site and allow the precise deletion of several nucleotides at the target site. As proof of concept, we generated heterozygous deletion mutants of the kcng4b, gdap1, and ghitm genes in the zebrafish Danio rerio using this method. A further analysis by high-resolution DNA melting demonstrated a high efficiency and a low background of unpredicted mutations. The use of two complementary gRNAs improves CRISPR-Cas9 specificity and allows the creation of predictable and precise mutations in the genome of D. rerio.
Avoid common mistakes on your manuscript.
Introduction
CRISPR-Cas9-based site-specific mutagenesis is more and more widespread in life sciences [1]. It is mainly used to inactivate (knock-out, KO) target genes by deletions and small insertions or to insert genes encoding marker proteins (knock-in, KI) at specific genomic sites of various model organisms [2]. The standard CRISPR-Cas9 KO procedure includes the design of a short guide RNA (gRNA) corresponding to the genome sequence at or close to the site of intervention and the injection of cells or developing embryos with this gRNA and Cas9 mRNA or protein. This then results in DNA double-strand breaks at the target site caused by the Cas9 nuclease and subsequent non-homologous DNA repair resulting in random mutations at the target site [2, 3]. The creation and injection of all CRISPR-Cas9 components (gRNAs and Cas9 mRNA) into zebrafish (Danio rerio) embryos is a rather simple and well-established procedure. At the same time, the screening for the desired mutants is time-consuming. Another disadvantage is the unpredictable nature of such mutagenesis. Several methods were proposed to simplify the mutagenesis and selection of mutants [3, 4]. These include the usage of more than one gRNA at once to delete large segments of DNA in animal cells [5], plants [6] and invertebrates, namely Dictyostelium discoideum [7], Drosophila melanogaster and Caenorhabditis elegans [8]. CRISPR-Cas9 with two gRNAs was also used to delete from 1000 to 20,000 nucleotide base pairs (bp) in zebrafish [9].
Here we describe a significant improvement of CRISPR-Cas9 mutagenesis which allows the precise deletion of several nucleotides using of two gRNAs per target site. As an efficient method for mutant screening we propose the PCR-based high-resolution DNA melting (HRM) analysis. Using this approach, we generated two short deletion mutants of kcng4b (α-subunit of the voltage-gated potassium channel), a deletion mutant of gdap1 (ganglioside-induced differentiation-associated protein 1), and a deletion mutant of ghitm (growth hormone-inducible transmembrane protein).
Materials and methods
Animals
Wild-type (AB line) and mutant zebrafish were maintained in the Zebrafish Facility of the International Institute of Molecular and Cell Biology in Warsaw (license no. PL14656251) according to standard procedures and ethical regulations. All experiments involving the zebrafish embryos/larvae were carried out in accordance with the Polish Laboratory Animal Science Association and Local Ethics Committee for Animal Experimentation in Warsaw (permission no. WAW2/181/2019).
To perform CRISPR-Cas9 knock-out, 2 nl of a solution containing two gRNAs (0.04 mg/ml of each) and Cas9 protein (0.2 mg/ml, see below) were injected into the cytoplasm of one-cell stage wild-type AB zebrafish embryos. Fifty embryos of each, gdap1 and ghitm, as well as two variants of kcng4b (variants #1 and #2) knock-outs were grown up after injection to 4 months to be in-crossed as the F0 founders. The phenotype of the F1 off-spring was analyzed at 1–5 dpf under a Leica M165 FC microscope. All F0 founders were fin-clipped for DNA sampling and HRM analysis. The mutation-positive ones were analyzed by DNA sequencing.
Standard single gRNA mutagenesis was performed as a control. For this, the 5′-site gRNAs of each set (all gRNAs-1 and Kcng4b-gRNA-3) were injected into 50 embryos as described above. The fish were analyzed by HRM at 5 days post fertilization (dpf) stage.
gRNA synthesis
DNA oligonucleotides encoding gRNAs with invariant adapter sequence were used, four for kcng4b and two for gdap1 and ghitm: Kcng4b-gRNA-1, TAATACGACTCACTATATGAAGAGAGACTCCTTTTCTGTTTTAGAGCTAGAA; Kcng4b-gRNA-2, TAATACGACTCACTATAGTTAGCAATGGCCCAAGAAAGTTTTAGAGCTAGAA; Kcng4b-gRNA-3, TAATACGACTCACTATAAGCAGTGAGGGTTGGCTGAAGTTTTAGAGCTAGAA; Kcng4b-gRNA-4, TAATACGACTCACTATACATGCAGCAGCAGTGAGGGTGTTTTAGAGCTAGAA; Gdap1-gRNA-1, TAATACGACTCACTATAGGGAGTCTACGGTGATCTCTGTTTTAGAGCTAGAA; Gdap1-gRNA-2, TAATACGACTCACTATAGGCTGGTATGTGGGAGTCTAGTTTTAGAGCTAGAA; Ghitm-gRNA-1, TAATACGACTCACTATACGCGGGCAGTGTGGGCCTGAGTTTTAGAGCTAGAA; Ghitm-gRNA-2, TAATACGACTCACTATATGTGGGCCTGACGGCGCTCTGTTTTAGAGCTAGAA (gRNA sequences are underlined, all sequences here and below have the 5′–3′ direction).
For gRNA synthesis each of them was mixed with the constant oligonucleotide, containing a complementary adapter part and a T7 promoter sequence, Const-gRNA: AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC, both 10 μM, and a double-stranded product was synthesized according to the following protocol: 95 °C—3 min and 35 cycles of 95 °C—15 s, 20 °C—15 s, 72 °C—15 s using PCR Mix Plus mixture (A&A Biotechnology, Poland). The resulting DNA was purified by Clean-Up Concentrator kit (A&A Biotechnology, Poland) and verified by 2.5% agarose gel-electrophoresis. 0.2 μg of DNA was used for RNA in vitro transcription by T7 RNA-Polymerase (A&A Biotechnology, Poland) according to the manufacturer’s protocol.
Cas9 protein production
DNA encoding Streptococcus pyogenes Cas9 protein with N- and C-terminal nuclear localization signals (NLS) was PCR amplified using PCR Mix Plus mixture (A&A Biotechnology, Poland) and pCS2-nCas9n plasmid [11] as a template and cloned into pETM-60 vector (Novagen) using NcoI and XhoI restriction endonuclease sites. The final construct encoded an N-terminal hexa-histidine-NusA tag followed by peptide cleavage site for tobacco etch virus (TEV) protease and C-terminal hexa-histidine (His) tag. The protein was expressed in BL21 Rosetta Escherichia coli strain (Novagen) in simplified Studier’s autoinduction media [12] at 37 °C for 4 h followed by 20 h at 20 °C. Cells were harvested by centrifugation at 4000 × g for 30 min and stored at −20 °C.
The cell pellet was resuspended in 40 mM Tris–HCl buffer (pH 7.5) containing 5% of glycerol, 0.5 M NaCl, 40 mM imidazole, 1.0 mM phenylmethylsulfonyl fluoride (PMSF) and 2 mM 2-mercaptoethanol, then ultrasonicated and centrifugated at 10,000 × g 4 °C for 20 min. The supernatant was loaded on a HisTrap FF Crude® column (GE Healthcare) equilibrated by the same buffer. After washing with 20 mM Tris–HCl buffer (pH 7.5) containing 5% of glycerol, 0.5 mM NaCl and 80 mM imidazole, the protein was eluted by the same buffer containing 0.3 M imidazole and the N-terminal His-NusA tag was cleaved off by TEV protease (1 mg per 100 mg of Cas9 protein) during overnight dialysis against 20 mM Tris–HCl buffer (pH 7.5) containing 5% of glycerol, 0.15 mM NaCl and 2 mM 2-mercaptoethanol. The protein solution was then clarified by centrifugation (10,000 × g, 10 min) and loaded on a Q Sepharose® Fast Flow column (GE Healthcare) equilibrated by the same buffer. The flow-through was collected and dialyzed overnight against 20 mM HEPES buffer (pH 7.5) containing 0.2 mM KCl and 20% of glycerol. As a final step the protein sample was concentrated on a Vivaspin 500 centrifugal concentrator (Merk) and stored at −80 °C.
All Cas9 purification steps were controlled by spectrophotometry and by SDS-polyacrylamide gel electrophoresis.
Fish mutation analysis
The clipped fins of adult fish or 5-day-old embryos chilled on ice were placed into 30 μl of 96% ethanol, heated at 80 °C until ethanol evaporates (~10 min) and 50 μl of TE buffer (pH 8.0) were added. After 10 min of heating (80 °C) samples were chilled and incubated 3 h at 55 °C with 0.5 mg/ml Proteinase K (Merck). After another heating (10 min, 95 °C) and chilling, 1 μl of the solution was used as a template for PCR and HRM analysis.
The HRM analysis was performed according to the manufacturers’ protocols (Roche and BioRad). PCR was performed in 10 μl volume with a 0.4 μM of each primer using Light Cycler 480 High-Resolution Melting Master Mix, 2 mM MgCl2 (Roche) or using Precision Melt Supermix (BioRad). Melting curves were taken by Light Cycler 96 (Roche) or by CFX Connect Real-Time PCR System (BioRad). The following oligonucleotides were used as the primers:
-
For kcng4b #1: Kg4-HRM-1f, GATGCCACTGCTAAAGAGG, and Kg4-HRM-1r, GGTTGGCTGAATGGCAGC; and for kcng4b #2: Kg4-HRM-2f, TGCTAACAGAAATAGCCTGC, and Kg4-HRM-2r, CTCATTAAAACATACAGAAATCC.
-
For gdap1: GDAP1-HRM-f, GGAAGCACGTATTATCATCG; and GDAP1-HRM-r, TGCGAATGTGTGTAGTGGC.
-
For ghitm: GHITM-HRM-f, CGATCTGGCCGCAGTACG; and GHITM-HRM-r, TACCAGCCAGGAGTTGCTC.
The following PCR conditions were used: pre-incubation: 95 °C—10 min; 3 step amplification (45 cycles): 95 °C—10 s, 60 °C—15 s, 72 °C—15 s; high resolution melting: 95 °C—60 s, 40 °C—60 s, 65 °C—1 s, 97 °C—1 s.
For the PCR and following sequencing kcng4b-specific primers were used: Kcng4b-seq-fvd, CGTTCATATCACGAACTGAAG, and Kcng4b-seq-rev, GGTAGGTCAAATCTTTGAAAAC; while the gdap1 and ghitm fragments were amplified using the HRM primers. The following PCR conditions were used: pre-incubation: 95 °C—3 min; 3 step amplification (35 cycles): 95 °C—30 s, 58 °C—30 s, 68 °C—15 s. PCR-products were got using PCR Mix Plus mixture from A&A Biotechnology (Poland) and sequenced from the same primers. Heterozygous sequences were analyzed using the TIDE web tool [10].
Results
We here describe an improved method of CRISPR-Cas9 genome editing to generate precise deletion mutant alleles of zebrafish kcng4b, gdap1 and ghitm (Fig. 1). Our method is based on the injection of two (instead of one) complementary gRNAs closely delimiting the target site along with the purified Cas9 protein into one cell D. rerio embryos. We found that for the 5′-target site of kcng4b (i.e. variant #1) 7 out of 50 (14%) F0 founder fish carried the 5 bp deletion that matches the gap between the two gRNAs (Fig. 1). This probably represents a synergistic effect of the two gRNAs, Kcng4b-gRNA-1 and Kcng4b-gRNA-2. Two founders (4%) had a cytosine insertion at the site targeted by Kcng4b-gRNA-2. At the 3′-targeted site of kcng4b (i.e. variant #2), 18 of 50 F0 founders (36%) had a deletion of 8 bp also precisely corresponding to the gap between the two gRNAs (Fig. 1).
The schematic view of zebrafish (D. rerio) kcng4b, gdap1 and ghitm mutant generation. Stop-codons are colored red, PAM-sequences are underlined and colored blue. Bold italics shows the DNA joining nucleotides after Cas9 brakes. A wild-type translation is colored green, modified one in the mutants—purple
In the case of gdap1 mutagenesis, 19 F0 fish (38%) had an 11 bp deletion corresponding to the synergistic action of the Gdap1-gRNA-1 and Gdap1-gRNA-2, while 6 fish (12%) exhibited either a 3′-shifted deletion in respect to Gdap1-gRNA-1 and Gdap1-gRNA-2 delimited site or a 16-bp deletion mediated by the Gdap1-gRNA-1 alone (Fig. 1).
For the ghitm the number of mutants with the precise deletion was 22 (44%), while 3 fish (6%) with different deletion mutations were detected (Fig. 1). The first group of mutants corresponds to the synergistic Ghitm-gRNA-1 and Ghitm-gRNA-2 action, whereas the second, minor group represents the result of CRISPR-Cas9 mutagenesis of the Ghitm-gRNA-1 site alone.
All F0 fish carrying the CRISPR-Cas9 modification were heterozygotes. HRM detected mutations (Fig. 2) and DNA sequencing confirmed their presence.
The HRM analysis of the fish generated by precise two gRNAs CRISPR-Cas9 mutagenesis. (a, b) kcng4b variant #1; (c, d) kcng4b variant #2; (e, f) gdap1; (g, h) ghitm. (a, c, e, g) Normalized melting curves; (b, d, f, h) normalized melting peaks. Green—wild type; purple, red and magenta—heterozygote precise deletion mutants; blue—minor mutant fractions
A follow-up analysis of F1 mutant in-cross offspring of kcng4b variant #1 showed the characteristic developmental defect of the kcng4b phenotype described earlier [13] for ~25% of embryos (Supplementary Fig. 1). In contrast, ~25% of homozygotes of the kcng4b variant #2 showed a developmental phenotype different from the one described by Shen et al. [13] (Supplementary Fig. 1), which could be explained by the fact that the mutation does not lead to a premature truncation (Fig. 1). All kcng4b mutants exhibiting the specific phenotype described above died during the first eight days of development. This further supports the observation that all F0 founders were heterozygotes. The HRM analysis showed that surviving F1 offspring were only heterozygotes and wild type animals (Fig. 2).
Around 25% of gdap1 F0 mutant in-cross offspring exhibited a phenotype resembling the one observed after gdap1 morpholino knock-down described previously [14] (Supplementary Fig. 1), while there was no obvious phenotype in ghitm mutant F1 offspring apparent in the first 5 days of development. An analysis of these gdap1 and ghitm mutants’ survival beyond this time point was precluded by the limitations imposed by our ethical regulation protocol.
In contrast to our new improved method using two gRNAs, the HRM analysis of the mutants of all three genes (kcng4b, gdap1 and ghitm) generated by the traditional single gRNA CRISPR-Cas9 approach revealed a spectrum of variants. None of them represented the majority or a unified group (Fig. 3). This supports our claim that the use of two gRNAs creates more precise deletions.
Discussion
Our modification of the CRISPR-Cas9 genome editing based on two complementary gRNAs that delimit the intervention site generates a precise deletion of several nucleotides in the target gene. It makes the outcome of mutagenesis more predictable, mutant screening much easier and allows the introduction of different open reading frame (ORF) shift mutations resulting in amino acid sequence changes, mainly preliminary truncation. The precise mutagenesis was confirmed for two different sites in the kcng4b gene, and single sites in the gdap1 and ghitm genes, with a different number of nucleotides deleted, in a range from 5 to 11. This caused different ORF shifts, resulting in premature truncation in the kcng4b variant #1 and gdap1, no frame shift in the case of ghitm, and prolongation of the polypeptide in the kcng4b variant #2 (Fig. 1).
A rather negligible difference in the efficiency of generating precise deletion mutants was detected: 14% and 36% for kcng4b variant #1 and #2, 38% for gdap1 and 44% for ghitm. These differences could be explained either by (1) specificity of gRNA action and peculiarities of the targeted site or (2) by mutant negative selection. The first is supported by the fact that the non-precise deletion mutants represent the minority. Moreover, the percentage of such incidental mutagenesis differs for all three genes: 4% for kcng4b variant #1 with lack in variant #2, 12% for gdap1, and 6% for ghitm. The kcng4b variant #1 incidental mutagenesis represents the insertion of a cytosine, which corresponds to the Kcng4b-gRNA-2 site-specific Cas9 action and follow-up DNA repair (Fig. 1). The ghitm incidental mutagenesis corresponds to cleavage at the Ghitm-gRNA-1 site. The same was detected for Gdap1-gRNA-1 (Fig. 1). All this suggests the unequal activity of the two gRNAs. Besides, the gRNA orientation may play a role. The more efficient kcng4b variant #2 mutagenesis, as well as the gdap1 and ghitm ones seem to rely on correspondence of both gRNAs to the same DNA strand, whereas in the less efficient kcng4b variant #1 mutagenesis the gRNAs targeted opposite DNA strands (Fig. 1). Perhaps, different targeting of DNA strands may influence the effectiveness of Cas9 nuclease.
Only one insertion (kcng4b variant #1) was detected in our experiments. This supports the idea of a cooperative action of the gRNA pair even in cases of minor imprecise deletions. Presence of such incidental deletions may be caused by the DNA repair activity after a precise double gRNAs’ directed cleavage.
As to the mutant negative selection and its contribution to the effectiveness of mutagenesis, it is important to note that the survival rate of the two kcng4b variants was different. This may be caused by a toxic loss-of-function of the variant #1 mutation causing a reduction in survival even in the heterozygous state, e.g. through a deleterious effect of the mutation on spermatogenesis and/or survival of males as reported in rodents [15]. In support of a negative selection of mutants there is the highest efficiency of the ghitm mutagenesis (44%) where deletion did not lead to ORF shift.
Conclusions
Our modified version of the CRISPR-Cas9 genome editing based on the two complementary gRNAs and Cas9 protein injection allows the precise deletion of several nucleotides in the target gene. HRM-based identification of mutants is an effective, rapid, economical and reliable tool for the selection of heterozygotes.
Data availability
All data presented are available by request according the IIMCB Regulations.
References
Lake F (2019) Putting the spotlight on: CRISPR. Biotechniques 67(2):41
Li M, Zhao L, Page-McCaw P, Chen W (2016) Zebrafish genome engineering using the CRISPR-Cas9 system. Trends Genet 32(12):815–827
Sorlien EL, Witucki MA, Ogas J (2018) Efficient production and identification of CRISPR/Cas9-generated gene knockouts in the model system Danio rerio. J Vis Exp 138:56969
D’Agostino Y, Locascio A, Ristoratore F, Sordino P, Spagnuolo A, Borra M et al (2016) A rapid and cheap methodology for CRISPR/Cas9 zebrafish mutant screening. Mol Biotechnol 58:73–78
Mandal PK, Ferreira LMR, Collins R, Meissner TB, Boutwell CL, Friesen M et al (2014) Efficient ablation of genes in human hematopoietic stem and effect or cells using CRISPR/Cas9. Cell Stem Cell 15:643–652
Do PT, Nguyen CX, Bui HT, Tran LTN, Stacey G, Gillman JD et al (2019) Demonstration of highly efficient dual gRNA CRISPR/Cas9 editing of the homologous GmFAD2–1A and GmFAD2–1B genes to yield a high oleic, low linoleic and α-linolenic acid phenotype in soybean. BMC Plant Biol 19:311
Iriki H, Kawata T, Muramoto T (2019) Generation of deletions and precise point mutations in Dictyostelium discoideum using the CRISPR nickase. PLoS One 14(10):e0224128
Pulido-Quetglas C, Aparicio-Prat E, Arnan C, Polidori T, Hermoso T, Palumbo E et al (2017) Scalable design of paired CRISPR guide RNAs for genomic deletion. PLoS Comput Biol 13(3):e1005341
Hoshijima K, Jurynec MJ, Shaw DK, Jacobi AM, Behlke MA, Grunwald DJ (2019) Highly efficient CRISPR-Cas9-based methods for generating deletion mutations and F0 embryos that lack gene function in zebrafish. Dev Cell 51:1–13
Brinkman EK, Chen T, Amendola M, van Steensel B (2014) Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res 42(22):e168 https://tide.deskgen.com/
Jao L-E, Wente SR, Chen W (2013) Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A 110(34):13904–13909
Studier FW (2005) Protein production by auto-induction in high-density shaking cultures. Protein Expr Purif 41(1):207–234
Shen H, Bocksteins E, Kondrychyn I, Snyders D, Korzh V (2016) Functional antagonism of voltage-gated K+ channel α-subunits in the developing brain ventricular system. Development 143:4249–4260
Eijkenboom I, Vanoevelen JM, Hoeijmakers JGJ, Wijnen I, Gerards M, Faber CG, Smeets HJM (2019) A zebrafish model to study small-fiber neuropathy reveals a potential role for GDAP1. Mitochondrion 47:273–281
Regnier G, Bocksteins E, Marei WF, Pintelon I, Timmermans JP, Leroy JLMR et al (2017) Targeted deletion of the Kv6.4 subunit causes male sterility due to disturbed spermiogenesis. Reprod Fertil Dev 29(8):1567–1575
Acknowledgements
We greatly thank Prof. Jacek Kuznicki and Prof. Matthias Bochtler for their unconditional support.
Funding
This research was supported by grants Nr 2016/21/B/NZ3/00354 (VK) and Nr UMO-2011/02/A/NZ1/00052 (MP) from the National Science Center (Krakow, Poland) and by DFG ME1922/16-1 and ME1922/17-1 (AM). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Author information
Authors and Affiliations
Contributions
EG, AM and VK designed the project, MP cloned and purified Cas9 protein, EG and MW performed zebrafish mutagenesis, EG, JJ and MW analyzed the mutants, EG wrote the text with MP, JJ, MW, AM and VK assistance and editing.
Corresponding author
Ethics declarations
Conflict of interest
The authors declare that they have no conflict of interests.
Ethical approval
All experiments involving the zebrafish embryos/larvae were carried out in accordance with the Polish Laboratory Animal Science Association rules and permission of the Local Ethics Committee for Animal Experimentation in Warsaw (permission no. WAW2/181/2019).
Consent for publication
Authors agree to data publication and informed about the Publisher rules and terms.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Below is the link to the electronic supplementary material.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Gasanov, E.V., Jędrychowska, J., Pastor, M. et al. An improved method for precise genome editing in zebrafish using CRISPR-Cas9 technique. Mol Biol Rep 48, 1951–1957 (2021). https://doi.org/10.1007/s11033-020-06125-8
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/s11033-020-06125-8