Citrus is known to have its center of origin in the Himalayan region of the North-Eastern (NE) India. Citrus is cultivated worldwide in both tropical and sub-tropical climates, including the Mediterranean basin. Citrus fruits are important for the human diet due to their high content in vitamin C, folate, and potassium, and also a good source of dietary fiber when consumed fresh.

Citrus tristeza virus (CTV) is one of the most destructive plant pathogens of the citrus plantations worldwide (Lee, 2015; Moreno et al., 2008). CTV infects several species of the Citrus genus, with enhanced symptoms when grafted onto the sour orange rootstock (Citrus aurantium), that is preferred for its ability to resist Phytophthora and grow well in the saline soils. In those parts of the world where soil salinity and Phytophthora incidence are not a problem Citrus trifoliate (Citrus trifoliata and its relatives) is a preferred rootstock for its resistance to CTV. The occurrence of citrus tristeza disease in the state of Assam (NE India) was confirmed through biological indexing, as well as serological and molecular studies (Biswas, 2010). Different CTV strains/isolates are reported in the citrus growing regions of India (Biswas et al., 2012). Genetic diversity studies of CTV in NE-India, has indicated the presence of four distinct CTV isolates. The long distance spread of CTV occurs through the movement and planting of infected propagative material, whereas the local spread occurs through the insect vector Toxoptera citricidus, that transmits CTV (Bar-Joseph et al., 1989). CTV is a phloem-limited, flexuous, filamentous virus belonging to the genus Closterovirus and family Closteroviridae. Its positive-sense single stranded (ss)RNA genome (ca. 20 kb) consists of 12 open reading frames that can encode for at least 17 different proteins (Karasev et al., 1995). The CTV induces symptoms such as the decline in citrus plants that are grafted on sour orange rootstocks; yellowing and growth cessation of sour orange and lemon; stunting, stem pitting, and reduced yields in different citrus species (Meister and Tuschl, 2004).

Double-stranded (ds) RNA based technology is a promising technology for protection of plants against viruses (Voloudakis et al., 2022), in particular for the plants that are recalcitrant to transformation. This dsRNA-based protection technology is already demonstrated against diverse plant viruses infecting large number of plant species, such as papaya (Vadlamudi et al., 2020), pigeonpea (Patil et al., 2021), tobacco (Konakalla et al., 2016; Holeva et al., 2021), tomato (Namgial et al., 2019), pepper, and cucurbits (Kaldis et al., 2018).

The CTV isolate G8, originating from a Khasi mandarin tree in Assam state (Biswas 2010; Biswas et al., 2012), was maintained on sweet orange (C. sinensis) rootstock, in an insect-proof glasshouse at the Advanced Center for Plant Virology (ACPV) of IARI, New Delhi, India, in controlled environmental conditions. In the present study, the G8 strain of CTV was used as a template for the production of dsRNA molecules. The total RNA was extracted from the veinal tissue of the leaf of the CTV-infected sweet orange plant using the SV Total RNA extraction kit (Promega, USA) and its quality was confirmed by agarose gel electrophoresis. A specific pair of primers, namely the forward primer KLM543 (5’ CTCTAGATCTTTTGAATTATGGACGAC3’) and the reverse primer KLM544 (5’CGCGAATTCAACAGATCAACGTGTGT3’) amplifying the 672 nt of the CP gene, of CTV genome, were used for PCR-based amplification using a well optimized protocol (Biswas, 2010).

Since the G8 strain of CTV is not fully sequenced, primers were designed from the conserved regions of the CP, p20, and p23 gene sequences of diverse CTV strains/isolates. The sequences of CP, p20, and p23 retrieved from the GenBank database (NCBI, USA) and were aligned with the software Multalin (http://multalin.toulouse.inra.fr/multalin/) to identify the conserved regions within these gene sequences. Primers were designed by using the Primer 3 (http://primer3.ut.ee/) software (Table S1).

CTV has evolved three viral suppressors of RNA silencing (VSRs), namely CP (p25 gene), p23, and p20, to overcome the host antiviral defense in citrus (Lu et al., 2004); all of these genes were targeted in the present study. The in vitro RNA synthesis method (a two-step PCR followed by an in vitro transcription) was employed for production of dsRNA for the CP, p20, and p23 gene sequences (Voloudakis et al., 2015) (Fig. 1).

Fig. 1
figure 1

Synthesis of dsRNAs targeting the silencing suppressor gene sequences of Citrus tristeza virus (CTV), namely CP (422 bp), p20 (368 bp), and p23 (420 bp). First, second PCR products with T7 promoter sequences, and the dsRNAs produced by in vitro transcription, as revealed by 1.5% agarose gel electrophoresis. M: 100-bp DNA ladder (New England Biolabs, USA); bp: base pair

Full size image

In order to reduce CTV titer variability among different trees in our experimentation, three branches, consisting the three biological replications, from the CTV (G8)-infected sweet orange plant (5 years old, grafted on Khasi mandarin) were selected to topically apply each of the three different dsRNA molecules targeting the three different genes of CTV (Fig. 2a). Five leaves were selected for each of the three branches (Fig. 2b) for tissue collection at four-time points after dsRNA application (T1, T2, T3, and T4), including an untreated negative control leaf, to which dsRNA was not applied. The selected leaves were tagged accordingly, i.e., T1 (1-day post-application [dpa]), T2 (3 dpa), T3 (7 dpa), T4 (10 dpa), and untreated control for each branch of the citrus plant (Fig. 2b). The inoculation mixture consisted of 15 μl dsRNA, with a concentration of 19.1, 17.5, and 25.3 ng/μl for dsRNA based on CP, p20, and p23 gene sequences of CTV, respectively, to which an equal volume of sterile distilled water was added. Each of the four leaves of the branch-1 (Fig. 2b) received 286.5 ng (19.1 ng X 15 μl) of the dsRNA_CP. Similarly, the four leaves of the branch-2 received 262.5 ng (17.5 ng X 15 μl) of the dsRNA_p20 construct and the four leaves of branch-3 received 379.5 ng (25.3 ng X 15 μl) of the dsRNA_p23. For each of the dsRNA treatment, the dsRNA mixture was gently rubbed on the adaxial surface of the leaf dusted with celite powder. The treated leaves were thoroughly washed with water after 5 minutes of treatment to remove the celite powder dust. The treated plants were kept in conditions as mentioned above, and at T1, T2, T3, and T4 the leaves were detached for total RNA extraction. The leaves kept as untreated control (mock) were detached at the end of the experiment (10 dpa) for total RNA isolation from all three branches. Total RNA, isolated from all the 15 leaf samples were used to obtain cDNAs to quantify the copy number of the CP gene of CTV, employing the standard calibration curve. The cDNAs were quantified with a NanoDrop Spectrophotometer 2000 (Thermo Fisher Scientific, UK). The CTV titers for a period of 10 days post application (dpa) of dsRNAs were estimated by RT-qPCR employing a constructed standard curve and the values are shown in Table 1.

Fig. 2
figure 2

The experimental layout (a, left) and the schematic diagram for the proof-of-concept (b, right) of experiment for the topical application of dsRNAs against Citrus tristeza virus G8 strain from North East India: (a) The CTV-G8-infected sweet orange plant, indicating the three branches, each one selected for one of the three treatments (dsRNA_CTV-CP, dsRNA_CTV-p20, dsRNA_CTV-p23); (b) A schematic diagram of the CTV-G8 infected sweet orange plant showing selection of five leaves (T1, T2, T3, T4 and Mock), for each of the three treatments involving distinct dsRNAs targeting the three different silencing suppressors, for total RNA isolation at four different time points, including an untreated control (Mock)

Full size image
Table 1 Titer of Citrus tristeza virus (CTV) as estimated by qPCR Ct values, at different time points after the topical application of dsRNAs derived from three different CTV gene sequences
Full size table

A comparative analysis of the effect of dsRNAs on CTV titer was performed at 10 days post-application (dpa) of dsRNA. Following RT-qPCR and subsequent one-way ANOVA analysis of the data indicated that the treatments were different at p<0.001. Furthermore, the Duncan’s multiple range test confirmed that the untreated control leaf tissue possessed a higher CTV titer, whereas the dsRNA treated leaves had reduced CTV titers in C. sinensis. This study is the first proof-of-concept of RNAi induced protection by exogenous application of dsRNA against CTV, a Closterovirus, in C. sinensis, a perennial host plant. The data from this study strongly suggests that this non-transgenic approach of inducing RNA-interference is capable of significantly reducing the CTV titers in planta (Fig. 3). The CTV-infected plant leaves used in this experiment did not exhibit any symptoms before the experiment was conducted and this remained the same even after 10 dpa of dsRNA.

Fig. 3
figure 3

Real time (RT)-qPCR based quantification of Citrus tristeza virus (CTV) load/titre, upon application of dsRNAs targeting the three distinct silencing suppressors (dsRNA-CP, -p20, and -p23) on the leaves of CTV-G8 infected orange plant at 10 days post application (dpa). The results are depicted as a graphical bar diagram, with the mean ± SE for three replications. Treatments with different letter show significant difference in CTV titers upon one-way ANOVA at p< 0.001 and a Duncan’s multiple range test

Full size image

CTV causes serious losses to the citrus industry globally (Moreno et al., 2008) and there is an urgent need to develop novel methods of protection, especially in regions of the world where transgenics are not yet approved or accepted for cultivation. Transgenesis has been employed to establish in planta RNAi against several economically-important plant viruses, including CTV (Voloudakis et al., 2015). Since last few years, a non-transgenic approach, popularly referred as RNA-based vaccination, has been a promising alternative to transgenesis to protect the plants from viral diseases (Moreno et al., 2008; Hunter et al., 2012; Voloudakis et al., 2015, 2022). For the latter approach, it has been shown that the direct application of the in vitro produced dsRNAs, derived from the viral sequences, onto plant leaf tissues, confers resistance against the cognate virus (Holeva et al., 2021; Konakalla et al., 2016; Kaldis et al., 2018; Namgial et al., 2019; Konakalla et al., 2019; Vadlamudi et al., 2020; Patil et al., 2021).

The dsRNA molecules for all the three VSRs of the G8 strain of CTV were successfully synthesized by in vitro transcription, following a well-established two-step PCR method (Voloudakis et al., 2015) as shown in Fig. 1. This dsRNA was exogenously applied onto the leaf surfaces of CTV G8-infected orange. Upon topical application of this dsRNA on CTV-G8 infected leaves, a rapid CTV titer reduction was observed starting one-day post-application (Table 1). To our knowledge, this study represents the first report of RNA-based vaccination against a Closterovirus. Also, it is first time that the RNA-based vaccination was applied to an already virus-infected perennial plant, thus looking for a curative effect of this technology. Since CTV is transmitted locally by aphid vectors, to reduce the disease epidemiology, it would be more effective to combine together the control of the insect vector and the virus in citrus. RNAi against insects, the use of a single dsRNA molecule aiming at two different target genes (Namgial et al., 2019), as well as field application of RNA-based vaccination (Patil et al., 2021) has already been demonstrated. Further research is required to support the hypothesis that the siRNAs, produced in the dsRNA-treated leaf, rapidly spread systemically or whether the siRNAs that are produced in the systemic leaves from the rapidly spreading dsRNAs. In future, a long-term experiment to study the phenotypic effect of dsRNA vaccination in citrus against CTV needs to be performed. In conclusion, the ability of dsRNAs (targeting the VSRs of CTV) to reduce CTV levels indicates that the non-transgenic dsRNA vaccination is applicable against Closteroviruses and this approach could be included in an integrated pest management of the citrus tristeza disease. If the dsRNAs could be delivered using suitable carriers, such as the BioClay, the antiviral effect of this dsRNA could be enhanced and prolonged.