Skip to main content
SpringerLink
Log in

Melting of polymeric DNA double helix at elevated temperature: a molecular dynamics approach

  • Original Paper
  • Published:
Journal of Molecular Modeling Aims and scope Submit manuscript

Abstract

Genomic DNA of higher organisms exists as extremely long polymers, while in bacteria and other lower organisms it is circular with no terminal base pairs. Temperature-induced melting of the DNA double helix by localized strand separation has been unattainable by molecular dynamic simulations due to more rapid fraying of the terminal base pairs in oligomeric DNA. However, local-sequence-dependent unfolding of the DNA double helix is extremely important for understanding various biochemical phenomena, and can be addressed by simulating a model polymeric DNA duplex. Here, we present simulations of polymeric B-DNA of sequence d(CGCGCGCGAATTCGCGCGCG)2 at elevated temperatures, along with its equivalent oligomeric constructs for comparison. Initiation of temperature-induced DNA melting was observed with higher fluctuations of the central d(AATT) region only in the model polymer. The polymeric construct shows a definite melting start site at the weaker A/T stretch, which propagates slowly through the CG rich regions. The melting is reflected in the hydrogen bond breaking, i.e. basepair opening, and by disruption of stacking interaction between successive basepairs. Melting at higher temperature of the oligomer, however, was only through terminal fraying, as also reported earlier.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1
Fig. 2
Fig. 3
Fig. 4
Fig. 5
Fig. 6
Fig. 7
Fig. 8

Similar content being viewed by others

References

  1. Mergny JL, Lacroix L (2003) Oligonucleotides 13:515

    Article  CAS  Google Scholar 

  2. Stucki M, Stagljar I, Jonsson ZO, Hubscher U (2001) Prog Nucleic Acid Res Mol Biol 65:261

    Article  CAS  Google Scholar 

  3. Kannan S, Zacharias M (2009) Phys Chem Chem Phys 11:10589

    Article  CAS  Google Scholar 

  4. Zeng Y, Zocchi G (2006) Biophys J 90:4522

    Article  CAS  Google Scholar 

  5. van Erp TS, Cuesta-Lopez S, Peyrard M (2006) Eur Phys J E Soft Matter 20:421

    Article  Google Scholar 

  6. Mandal M, Mukhopadhyay C (2014) Phys Chem Chem Phys 16:21706

    Article  CAS  Google Scholar 

  7. Das A, Mukhopadhyay C (2009) Proteins 75:1024

    Article  CAS  Google Scholar 

  8. Dastidar SG, Mukhopadhyay C (2005) Phys Rev E Stat Nonlinear Soft Matter Phys 72:051928

    Article  Google Scholar 

  9. Roy S, Basu S, Dasgupta D, Bhattacharyya D, Banerjee R (2015) PLoS One 10:e0142173

    Article  Google Scholar 

  10. Samanta S, Mukherjee S, Chakrabarti J, Bhattacharyya D (2009) J Chem Phys 130:115103

    Article  Google Scholar 

  11. Kundu S, Mukherjee S, Bhattacharyya D (2012) J Biosci 37:445

    Article  CAS  Google Scholar 

  12. Bevan DR, Li LP, Pedersen LG, Darden TA (2000) Biophys J 78:668

    Article  CAS  Google Scholar 

  13. Cheng Y, Korolev N, Nordenskiold L (2006) Nucleic Acids Res 34:686

    Article  CAS  Google Scholar 

  14. Mukherjee S, Kundu S, Bhattacharyya D (2014) J Comput Aided Mol Des 28:735

    Article  CAS  Google Scholar 

  15. Luan B, Aksimentiev A (2008) Phys Rev Lett 101:118101

    Article  Google Scholar 

  16. Chandrasekaran R, Arnott S (1996) J Biomol Struct Dyn. 13:1015

    Article  CAS  Google Scholar 

  17. MacKerell AD, Banavali NK (2000) J Comput Chem 21:105

    Article  CAS  Google Scholar 

  18. Foloppe N, MacKerell AD (2000) J Comput Chem 21:86

    Article  CAS  Google Scholar 

  19. Brooks BR, Bruccoleri RE, Olafson BD, States DJ, Swaminathan S, Karplus M (1983) J Comput Chem 4:187

    Article  CAS  Google Scholar 

  20. Korolev N, Lyubartsev AP, Laaksonen A, Nordenskiold L (2003) Nucleic Acids Res 31:5971

    Article  CAS  Google Scholar 

  21. Dai L, Mu Y, Nordenskiold L, van der Maarel JR (2008) Phys Rev Lett 100:118301

    Article  Google Scholar 

  22. Halder S, Bhattacharyya D (2010) J Phys Chem B 114:14028

    Article  CAS  Google Scholar 

  23. Feller SE, Zhang YH, Pastor RW, Brooks BR (1995) J Chem Phys 103:4613

    Article  CAS  Google Scholar 

  24. Kale L, Skeel R, Bhandarkar M, Brunner R, Gursoy A, Krawetz N, Phillips J, Shinozaki A, Varadarajan K, Schulten K (1999) J Comput Phys 151:283

    Article  CAS  Google Scholar 

  25. Nelson M, Humphrey W, Kufrin R, Gursoy A, Dalke A, Kale L, Skeel R, Schulten K (1995) Computer Phys Commun 91:111

    Article  CAS  Google Scholar 

  26. Bansal M, Bhattacharyya D, Ravi B (1995) Computer Appli Biosci 11:281

    CAS  Google Scholar 

  27. Mukherjee S, Bansal M, Bhattacharyya D (2006) J Comput Aided Mol Des 20:629

    Article  CAS  Google Scholar 

  28. Dickerson R, Bansal M, Calladine CR (1989) EMBO J 8:1

    Google Scholar 

  29. Olson WK, Bansal M, Burley SK, Dickerson RE, Gerstein M, Harvey SC, Heinemann U, Lu XJ, Neidle S, Shakked Z, Sklenar H, Suzuki M, Tung CS, Westhof E, Wolberger C, Berman HM (2001) J Mol Biol 313:229

    Article  CAS  Google Scholar 

  30. Pingali PK, Halder S, Mukherjee D, Basu S, Banerjee R, Choudhury D, Bhattacharyya D (2014) J Comput Aided Mol Des 28:851

    Article  CAS  Google Scholar 

  31. Mukherjee S, Bhattacharyya D (2013) J Biomol Struct Dyn 31:896

    Article  CAS  Google Scholar 

  32. Calladine CR (1982) J Mol Biol 161:343

    Article  CAS  Google Scholar 

  33. Drew HR, Samson S, Dickerson RE (1982) Proc Natl Acad Sci USA 79:4040

    Article  CAS  Google Scholar 

  34. Dickerson RE, Kopka ML, Pjura P (1983) Proc Natl Acad Sci USA 80:7099

    Article  CAS  Google Scholar 

  35. Drsata T, Perez A, Orozco M, Morozov AV, Sponer J, Lankas F (2013) J Chem Theo Comput 9:707

    Article  CAS  Google Scholar 

Download references

Acknowledgments

We are thankful for partial financial support from the BARD project of Department of Atomic Energy, Government of India and Department of Biotechnology, Government of India.

Author information

Author notes

  1. Sangeeta Kundu

    Present address: Structural Biology and Bioinformatics Division, CSIR-Indian Institute of Chemical Biology, 4, Raja S. C. Mullick Road, Kolkata, 700032, India

  2. Sanchita Mukherjee

    Present address: Department of Biological Sciences, Indian Institute of Science Education and Research Kolkata, Mohanpur, Kolkata, West Bengal, 741 246, India

  3. Sangeeta Kundu and Sanchita Mukherjee contributed equally to this work.

Authors and Affiliations

  1. Computational Science Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata, 700064, India

    Sangeeta Kundu & Dhananjay Bhattacharyya

Authors
  1. Sangeeta Kundu
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Sanchita Mukherjee
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Dhananjay Bhattacharyya
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Dhananjay Bhattacharyya.

Electronic supplementary material

ESM 1

(DOC 2492 kb)

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Kundu, S., Mukherjee, S. & Bhattacharyya, D. Melting of polymeric DNA double helix at elevated temperature: a molecular dynamics approach. J Mol Model 23, 226 (2017). https://doi.org/10.1007/s00894-017-3398-5

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1007/s00894-017-3398-5

Keywords

Search

Navigation