Skip to main content

Advertisement

SpringerLink
Log in

Electrochemical immunoassay for the protein biomarker mucin 1 and for MCF-7 cancer cells based on signal enhancement by silver nanoclusters

  • Original Paper
  • Published:
Microchimica Acta Aims and scope Submit manuscript

Abstract

An electrochemical immunoassay is described for the detection of the protein biomarker mucin 1 (MUC-1) and of breast cancer cells of type MCF-7 where MUC-1 is overexpressed. The method is based on the use of silver nanoclusters (Ag-NCs) acting as a signalling probe. The Ag-NCs were synthesized via chemical reduction in the presence of a DNA strand with the sequence of 5′-GCAGTTGATCCTTTGGATACCCTGG-C12-3′. The strand contains mucin 1 aptamer (GCAGTTGATCCTTTGGATACCCTGG) that can specifically bind to MUC1 and the template (C12) for synthesis of Ag-NCs. The assay involves the following steps: (1) Construction of an immunosensor by immobilizing the antibody against MUC-1 on a glassy carbon electrode; (2) addition of sample containing MUC-1; (3) addition of Ag-NCs; (4) signal amplification via silver enhancement process (deposition of metal silver on Ag-NCs); (5) measurement via square wave voltammetry. The current measured at a potential of 0.11 V (vs. SCE) is logarithmically related to the concentration of MUC-1 in the 1 to 500 nM range, with a detection limit of 0.5 nM. We also demonstrate that MCF-7 cancer cells can be detected by this method with high sensitivity (50 cells per mL) due to the presence of MUC-1 proteins on the cell surface.

Schematic representation of the immunosensor preparation and detection process

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1
Fig. 2
Scheme 1
Fig. 3
Fig. 4
Fig. 5

Similar content being viewed by others

References

  1. Qu Z, Xu H, Xu P, Chen K, Mu R, Fu J, Gu H (2014) Ultrasensitive ELISA using enzyme-loaded nanospherical brushes as labels. Anal Chem 86(19):9367–9371

    Article  CAS  Google Scholar 

  2. Ding Y, Li D, Li B, Zhao K, Du W, Zheng J, Yang M (2013) A water-dispersible, ferrocene-tagged peptide nanowire for amplified electrochemical immunosensing. Biosens Bioelectron 48:281–286

    Article  CAS  Google Scholar 

  3. Zhou M, Sun Z, Shen C, Li Z, Zhang Y, Yang M (2013) Application of hydrogel prepared from ferrocene functionalized amino acid in the design of novel electrochemical immunosensing platform. Biosens Bioelectron 49:243–248

    Article  CAS  Google Scholar 

  4. Zhou M, Yang M, Zhou F (2014) Paper based colorimetric biosensing platform utilizing cross-linked siloxane as probe. Biosens Bioelectron 55:39–43

    Article  CAS  Google Scholar 

  5. Sun Z, Deng L, Gan H, Shen R, Yang M, Zhang Y (2013) Sensitive immunosensor for tumor necrosis factor alpha based on dual signal amplification of ferrocene modified self-assembled peptide nanowire and glucose oxidase functionalized gold nanorod. Biosens Bioelectron 39(1):215–219

    Article  CAS  Google Scholar 

  6. Yan L, Shi H, He X, Wang K, Tang J, Chen M, Ye X, Xu F, Lei Y (2014) A versatile activatable fluorescence probing platform for cancer cells in vitro and in vivo based on self-assembled aptamer/carbon nanotube ensembles. Anal Chem 86(18):9271–9277

    Article  CAS  Google Scholar 

  7. Fang YS, Huang XJ, Wang LS, Wang JF (2014) An enhanced sensitive electrochemical immunosensor based on efficient encapsulation of enzyme in silica matrix for the detection of human immunodeficiency virus p24. Biosens Bioelectron 64C:324–332

    Google Scholar 

  8. Liu G, Zhang Y, Guo W (2014) Covalent functionalization of gold nanoparticles as electronic bridges and signal amplifiers towards an electrochemical immunosensor for botulinum neurotoxin type A. Biosens Bioelectron 61:547–553

    Article  Google Scholar 

  9. Akter R, Kyun Rhee C, Rahman MA (2014) Sensitivity enhancement of an electrochemical immunosensor through the electrocatalysis of magnetic bead-supported non-enzymatic labels. Biosens Bioelectron 54:351–357

    Article  CAS  Google Scholar 

  10. Yang F, Han J, Zhuo Y, Yang Z, Chai Y, Yuan R (2014) Highly sensitive impedimetric immunosensor based on single-walled carbon nanohorns as labels and bienzyme biocatalyzed precipitation as enhancer for cancer biomarker detection. Biosens Bioelectron 55:360–365

    Article  CAS  Google Scholar 

  11. Diez I, Ras RH (2011) Fluorescent silver nanoclusters. Nanoscale 3(5):1963–1970

    Article  CAS  Google Scholar 

  12. Yuan X, Luo Z, Yu Y, Yao Q, Xie J (2013) Luminescent noble metal nanoclusters as an emerging optical probe for sensor development. Chem Asian J 8(5):858–871

    Article  CAS  Google Scholar 

  13. Shang L, Dong S, Nienhaus GU (2011) Ultra-small fluorescent metal nanoclusters: synthesis and biological applications. Nano Today 6:401–408

    Article  CAS  Google Scholar 

  14. Choi S, Dickson RM, Yu J (2012) Developing luminescent silver nanodots for biological applications. Chem Soc Rev 41(5):1867–1891

    Article  CAS  Google Scholar 

  15. Obliosca JM, Liu C, Yeh HC (2013) Fluorescent silver nanoclusters as DNA probes. Nanoscale 5(18):8443–8461

    Article  CAS  Google Scholar 

  16. Petty JT, Zheng J, Hud NV, Dickson RM (2004) DNA-templated Ag nanocluster formation. J Am Chem Soc 126:5207–5212

    Article  CAS  Google Scholar 

  17. Yeh HC, Sharma J, Shih Ie M, Vu DM, Martinez JS, Werner JH (2012) A fluorescence light-up Ag nanocluster probe that discriminates single-nucleotide variants by emission color. J Am Chem Soc 134(28):11550–11558

    Article  CAS  Google Scholar 

  18. Zhou Z, Du Y, Dong S (2011) DNA-Ag nanoclusters as fluorescence probe for turn-on aptamer sensor of small molecules. Biosens Bioelectron 28(1):33–37

    Article  Google Scholar 

  19. Yeh HC, Sharma J, Han JJ, Martinez JS, Werner JH (2010) A DNA--silver nanocluster probe that fluoresces upon hybridization. Nano Lett 10(8):3106–3110

    Article  CAS  Google Scholar 

  20. Zhang Y, Cai Y, Qi Z, Lu L, Qian Y (2013) DNA-templated silver nanoclusters for fluorescence turn-on assay of acetylcholinesterase activity. Anal Chem 85(17):8455–8461

    Article  CAS  Google Scholar 

  21. Huang Z, Pu F, Lin Y, Ren J, Qu X (2011) Modulating DNA-templated silver nanoclusters for fluorescence turn-on detection of thiol compounds. Chem Commun (Camb) 47(12):3487–3489

    Article  CAS  Google Scholar 

  22. Han S, Zhu S, Liu Z, Hu L, Parveen S, Xu G (2012) Oligonucleotide-stabilized fluorescent silver nanoclusters for turn-on detection of melamine. Biosens Bioelectron 36(1):267–270

    Article  CAS  Google Scholar 

  23. Shen C, Xia X, Hu S, Yang M, Wang J (2015) Silver nanoclusters-based fluorescence assay of protein kinase activity and inhibition. Anal Chem 87(1):693–698

    Article  CAS  Google Scholar 

  24. Dong H, Jin S, Ju H, Hao K, Xu LP, Lu H, Zhang X (2012) Trace and label-free microRNA detection using oligonucleotide encapsulated silver nanoclusters as probes. Anal Chem 84(20):8670–8674

    Article  CAS  Google Scholar 

  25. Kufe DW (2009) Mucins in cancer: function, prognosis and therapy. Nat Rev Cancer 9(12):874–885

    Article  CAS  Google Scholar 

  26. Wan Y, Wang Y, Wu J, Zhang D (2011) Graphene oxide sheet-mediated silver enhancement for application to electrochemical biosensors. Anal Chem 83(3):648–653

    Article  CAS  Google Scholar 

  27. Lin D, Wu J, Ju H, Yan F (2014) Nanogold/mesoporous carbon foam-mediated silver enhancement for graphene-enhance delectrochemical immunosensing of carcinoem bryonic antigen. Biosens Bioelectron 52:153–158

    Article  CAS  Google Scholar 

  28. Zhang Z, Li W, Zhao Q, Cheng M, Xu L, Fang X (2014) Highly sensitive visual detection of copper (II) using water-soluble azide-functionalized gold nanoparticles and silver enhancement. Biosens Bioelectron 59:40–44

    Article  CAS  Google Scholar 

  29. Wei W, Li DF, Pan XH, Liu SQ (2012) Electrochemiluminescent detection of mucin 1 protein and MCF-7 cancer cells based on the resonance energy transfer. Analyst 137(9):2101–2106

    Article  CAS  Google Scholar 

  30. Ritchie CM, Johnsen KR, Kiser JR, Antoku Y, Dickson RM, Petty JT (2007) J Phys Chem C 111:175–181

    Article  CAS  Google Scholar 

  31. Gupta S, Huda S, Kilpatrick PK, Velev OD (2007) Characterization and optimization of gold nanoparticle-based silver-enhanced immunoassays. Anal Chem 79:3810–3820

    Article  CAS  Google Scholar 

  32. Ding L, Qian R, Xue Y, Cheng W, Ju H (2010) In situ scanometric assay of cell surface carbohydrate by glyconanoparticle-aggregation-regulated silver enhancement. Anal Chem 82:5804–5809

    Article  CAS  Google Scholar 

  33. Wen J, Zhou S, Yuan Y (2014) Graphene oxide as nanogold carrier for ultrasensitive electrochemical immunoassay of Shewanella oneidensis with silver enhancement strategy. Biosens Bioelectron 52:44–49

    Article  CAS  Google Scholar 

  34. Gao F, Zhu Z, Lei J, Geng Y, Ju H (2013) Sub-femtomolar electrochemical detection of DNA using surface circular strand-replacement polymerization and gold nanoparticle catalyzed silver deposition for signal amplification. Biosens Bioelectron 39(1):199–203

    Article  CAS  Google Scholar 

  35. Zhang J, Chen X, Yang M (2014) Enzyme modified peptide nanowire as label for the fabrication of electrochemical immunosensor. Sensors Actuators B Chem 196:189–193

    Article  CAS  Google Scholar 

  36. He Y, Lin Y, Tang H, Pang D (2012) A graphene oxide-based fluorescent aptasensor for the turn-on detection of epithelial tumor marker mucin 1. Nanoscale 4:2054–2059

    Article  CAS  Google Scholar 

  37. Ma N, Jiang W, Li T, Zhang Z, Qi H, Yang M (2014) Fluorescence aggregation assay for the protein biomarker mucin 1 using carbon dot-labeled antibodies and aptamers. Microchim Acta 182(1–2):443–447

    Google Scholar 

  38. Hu R, Wen W, Wang Q, Xiong H, Zhang X, Gu H, Wang S (2014) Novel electrochemical aptamer biosensor based on an enzyme–gold nanoparticle dual label for the ultrasensitive detection of epithelial tumour marker MUC1. Biosens Bioelectron 53:384–389

    Article  CAS  Google Scholar 

  39. Hua X, Zhou Z, Yuan L, Liu S (2013) Selective collection and detection of MCF-7 breast cancer cells using aptamer-functionalized magnetic beads and quantum dots based nano-bio-probes. Anal Chim Acta 788:135–140

    Article  CAS  Google Scholar 

  40. Croce MV, Isla-Larrain MT, Capafons A, Price MR, Segal-Eiras S-E (2001) Humoral immune response induced by the protein core of MUC1 mucin in pregnant and healthy women. Breast Cancer Res Treat 69:1–11

    Article  CAS  Google Scholar 

Download references

Acknowledgments

The authors thank the support of this work by the National Key Basic Research Program of China (2014CB744502), the National Natural Science Foundation of China (No. 81200326, 21205039 and 21105128) and Natural Science Foundation of Hunan Province (Grant No. 2015JJ1019 and 13JJ6071)

Author information

Author notes

    Authors and Affiliations

    1. Department of General Surgery, The Second Xiang-ya Hospital, Central South University, Changsha, 410011, China

      Qingjun Guo, Haizhi Qi & Ting Li

    2. College of Chemistry and Chemical Engineering, Central South University, Changsha, 410083, China

      Xiangzhi Li, Congcong Shen & Minghui Yang

    3. Department of Chemistry and Chemical Engineering, Hunan University of Arts and Science, Changde, 415000, China

      Songbai Zhang

    Authors
    1. Qingjun Guo
      View author publications

      You can also search for this author in PubMed Google Scholar

    2. Xiangzhi Li
      View author publications

      You can also search for this author in PubMed Google Scholar

    3. Congcong Shen
      View author publications

      You can also search for this author in PubMed Google Scholar

    4. Songbai Zhang
      View author publications

      You can also search for this author in PubMed Google Scholar

    5. Haizhi Qi
      View author publications

      You can also search for this author in PubMed Google Scholar

    6. Ting Li
      View author publications

      You can also search for this author in PubMed Google Scholar

    7. Minghui Yang
      View author publications

      You can also search for this author in PubMed Google Scholar

    Corresponding authors

    Correspondence to Haizhi Qi or Minghui Yang.

    Additional information

    Qingjun Guo and Xiangzhi Li contributed equally to this work.

    Rights and permissions

    Reprints and permissions

    About this article

    Check for updates. Verify currency and authenticity via CrossMark

    Cite this article

    Guo, Q., Li, X., Shen, C. et al. Electrochemical immunoassay for the protein biomarker mucin 1 and for MCF-7 cancer cells based on signal enhancement by silver nanoclusters. Microchim Acta 182, 1483–1489 (2015). https://doi.org/10.1007/s00604-015-1471-2

    Download citation

    • Received:

    • Accepted:

    • Published:

    • Issue Date:

    • DOI: https://doi.org/10.1007/s00604-015-1471-2

    Keywords

    Search

    Navigation