Skip to main content
SpringerLink
Log in

Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase α2 gene that is essential for expression

  • Physiology and Biochemistry
  • Published:
Plant Cell Reports Aims and scope Submit manuscript

Abstract

Arabidopsis harbors two α and two β genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPα genes were analyzed using transgenic plants containing a promoter::ß-glucuronidase (GUS) fusion construct. Whereas the AtPFPα1 promoter was found to be ubiquitously active in all tissues, the AtPFPα2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPα2 promoter identified a key regulatory element from nucleotides −194 to −175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPα2 and which is essential for AtPFPα2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a −46 CaMV35S minimal promoter, we also demonstrate that PFPα2 is sufficient for normal AtPFPα2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPα2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1
Fig. 2
Fig. 3
Fig. 4
Fig. 5
Fig. 6

Similar content being viewed by others

References

  • Alves AM, Meijer WG, Vrijbloed JW, Dijkhuizen L (1996) Characterization and phylogeny of the pfp gene of Amycolatopsis methanolica encoding PPi-dependent phosphofructokinase. J Bacteriol 178:149–155

    PubMed  CAS  Google Scholar 

  • Benfey PN, Chua NH (1990) The cauliflower mosaic virus-35s promoter - combinatorial regulation of transcription in plants. Science 250:959–966

    Article  CAS  PubMed  Google Scholar 

  • Black CC, Mustardy L, Sung SS, Kormanik PP, Xu D-P, Paz N (1987) Regulation and roles for alternative pathways of hexose metabolism in plants. Physiol Plant 69:387–394

    Article  CAS  Google Scholar 

  • Buchel AS, Brederode FT, Bol JF, Linthorst HJ (1999) Mutation of GT-1 binding sites in the Pr-1A promoter influences the level of inducible gene expression in vivo. Plant Mol Biol 40:387–396

    Article  PubMed  CAS  Google Scholar 

  • Carlisle SM, Blakeley SD, Hemmingsen SM, Trevanion SJ, Hiyoshi T, Kruger NJ, Dennis DT (1990) Pyrophosphate-dependent phosphofructokinase. Conservation of protein sequence between the α- and β-subunits and with the ATP-dependent phosphofructokinase. J Biol Chem 265:18366–18371

    PubMed  CAS  Google Scholar 

  • Claassen PAM, Budde MA, de Ruyter HJ, van Calker MH, van Es A (1991) Potential role of pyrophosphate:fructose-6-phosphate phosphotransferase in carbohydrate metabolism of cold stored tubers of Solanum tuberosum cv Bintje. Plant Physiol 95:1243–1249

    PubMed  CAS  Google Scholar 

  • Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:735–743

    Article  PubMed  CAS  Google Scholar 

  • Dennis DT, Greyson MF (1987) Fructose-6-phosphate metabolism in plants. Physiol Plant 69:395–404

    Article  CAS  Google Scholar 

  • Duke SO, Canel C, Rimando AM, Tellez MR, Duke MV, Paul RM (2000) Current and potential exploitation of plant glandular trichome productivity. In: Hallahan DL, Gray JC (eds) Advances in botanical research, vol 31. Academic Press, San Diego, pp 121–151

    Chapter  Google Scholar 

  • Eisner T, Eisner M, Hoebeke ER (1998) When defense backfires: detrimental effect of a plant’s protective trichomes on an insect beneficial to the plant. Proc Natl Acad Sci USA 95:4410–4414

    Article  PubMed  CAS  Google Scholar 

  • Fahrendorf T, Holtum JA, Mukherjee U, Latzko E (1987) Fructose-2,6-bisphosphate, carbohydrate partitioning and crassulacean acid metabolism. Plant Physiol 84:182–187

    Article  PubMed  CAS  Google Scholar 

  • Fuse T, Sasaki T, Yano M (2001) Ti-plasmid vectors useful for functional analysis of rice genes. Plant Biotechnol 18:219–222

    CAS  Google Scholar 

  • Gutiérrez-Alcal G, Calo L, Gros F, Caissard JC, Gotor C, Romero LC (2005) A versatile promoter for the expression of proteins in glandular and non-glandular trichomes from a variety of plants. J Exp Bot 56:2487–2494

    Article  CAS  Google Scholar 

  • Hajirezaei M, Sonnewald U, Viola R, Carlisle S, Dennis D, Stitt M (1994) Transgenic potato plants with strongly decreased expression of pyrophosphate:fructose-6-phosphate phosphotransferase show no visible phenotype and only minor changes in metabolic fluxes in their tubers. Planta 192:16–30

    CAS  Google Scholar 

  • Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6:3901–3907

    PubMed  CAS  Google Scholar 

  • Jeon J-S, Chung Y-Y, Lee S, Yi G-H, Oh B-G, An G (1999) Isolation and characterization of an anther-specific gene, RA8, from rice (Oryza sativa L.). Plant Mol Biol 39:35–44

    Article  PubMed  CAS  Google Scholar 

  • Kim HJ, Triplett BA (2001) Cotton fiber growth in planta and in vitro. Models for plant cell elongation and cell wall biogenesis. Plant Physiol 127:1361–1366

    Article  PubMed  CAS  Google Scholar 

  • Kruger NJ, Dennis DT (1987) Molecular properties of pyrophosphate:fructose-6-phosphate phosphotransferase from potato tuber. Arch Biochem Biophys 256:273–279

    Article  PubMed  CAS  Google Scholar 

  • Larkin JC, Oppenheimer DG, Pollock S, Marks MD (1993) Arabidopsis GLABROUS1 gene requires downstream sequences for function. Plant Cell 5:1739–1748

    Article  PubMed  CAS  Google Scholar 

  • Liu HC, Creech RG, Jenkins JN, Ma DP (2000) Cloning and promoter analysis of the cotton lipid transfer protein gene Ltp3. Biochim Biophys Acta 1487:106–111

    PubMed  CAS  Google Scholar 

  • Mena M, Cejudo FJ, Isabel-Lamoneda I, Carbonero P (2002) A role for the DOF transcription factor BPBF in the regulation of gibberellin-responsive genes in barley aleurone. Plant Physiol 130:111–119

    Article  PubMed  CAS  Google Scholar 

  • Mertens E (1990) Occurrence of pyrophosphate:fructose 6-phosphate 1-phosphotransferase in Giardia lamblia trophozoites. Mol Biochem Parasitol 40:147–149

    Article  PubMed  CAS  Google Scholar 

  • Morita A, Umemura T, Kuroyanagi M, Futsuhara Y, Perata P, Yamaguchi J (1998) Functional dissection of a sugar-repressed α-amylase gene (RAmy1 A) promoter in rice embryos. FEBS Lett 423:81–85

    Article  PubMed  CAS  Google Scholar 

  • Nielsen TH, Rung JH, Villadsen D (2004) Fructose-2,6-bisphosphate: a traffic signal in plant metabolism. Trends Plant Sci 9:556–563

    Article  PubMed  CAS  Google Scholar 

  • Nielsen TH, Stitt M (2001) Tobacco transformants with strongly decreased expression of pyrophosphate:fructose-6-phosphate expression in the base of their young growing leaves contain much higher levels of fructose-2,6-bisphosphate but no major changes in fluxes. Planta 214:106–116

    Article  PubMed  CAS  Google Scholar 

  • Park HC, Kim ML, Kang YH, Jeon JM, Yoo JH, Kim MC, Park CY, Jeong JC, Moon BC, Lee JH, Yoon HW, Lee S-H, Chung WS, Lim CO, Lee SY, Hong JC, Cho MJ (2004) Pathogen- and NaCl-induced expression of the SCaM-4 promoter is mediated in part by a GT-1 box that interacts with a GT-1-like transcription factor. Plant Physiol 135:2150–2161

    Article  PubMed  CAS  Google Scholar 

  • Podesta FE, Plaxton WC (2003) Fluorescence study of ligand binding to potato tuber pyrophosphate-dependent phosphofructokinase: evidence for competitive binding between fructose-1,6-bisphosphate and fructose-2,6-bisphosphate. Arch Biochem Biophys 414:101–107

    Article  PubMed  CAS  Google Scholar 

  • Spilatro SR, Anderson JM (1989) Cabohydrate metabolism and activity of pyrophosphate:fructose-6-phosphate phosphotransferase in photosynthetic soyabean (Glycine max, Merr.) suspension cells. Plant Physiol 88:862–888

    Google Scholar 

  • Stitt M (1990) Fructose-2,6-bisphosphate as a regulatory molecule in plants. Annu Rev Plant Physiol Plant Biol 41:153–158

    Article  CAS  Google Scholar 

  • Theodorou ME, Cornel FA, Duff SM, Plaxton WC (1992) Phosphate starvation-inducible synthesis of the α-subunit of the pyrophosphate-dependent phosphofructokinase in black mustard suspension cells. J Biol Chem 267:21901–21905

    PubMed  CAS  Google Scholar 

  • Todd JF, Blakeley SD, Dennis DT (1995) Structure of the genes encoding the α- and β-subunits of castor pyrophosphate-dependent phosphofructokinase. Gene 152:181–186

    Article  PubMed  CAS  Google Scholar 

  • Traw MB, Bergelson J (2003) Interactive effects of jasmonic acid, salicylic acid, and gibberellin on induction of trichomes in Arabidopsis. Plant Physiol 133:1367–1375

    Article  PubMed  CAS  Google Scholar 

  • Wang E, Gan S, Wagner GJ (2002) Isolation and characterization of the CYP71D16 trichome-specific promoter from Nicotiana tabacum L. J Exp Bot 53:1891–1897

    Article  PubMed  CAS  Google Scholar 

  • Wang YH, Shi JN (1999) Evidence that fructose 1,6-bisphosphate specifically protects the α-subunit of pyrophosphate-dependent 6-phosphofructo-1-phosphotransferase against proteolytic degradation. FEBS Lett 459:448–452

    Article  PubMed  CAS  Google Scholar 

  • Xu DP, Sung SJ, Black CC. (1989) Sucrose metabolism in Lima black beans. Plant Physiol 89:1100–1116

    Google Scholar 

  • Yanagisawa S (2000) Dof1 and Dof2 transcription factors are associated with expression of multiple genes involved in carbon metabolism in maize. Plant J 21:281–288

    Article  PubMed  CAS  Google Scholar 

  • Yanagisawa S, Schmidt RJ (1999) Diversity and similarity among recognition sequences of Dof transcription factors. Plant J 17:209–214

    Article  PubMed  CAS  Google Scholar 

  • Zhou DX (1999) Regulatory mechanism of plant gene transcription by GT-elements and GT-factors. Trends Plant Sci 4:210–214

    Article  PubMed  Google Scholar 

Download references

Acknowledgments

This work was supported, in part, by grants from the SRC program of MOST/KOSEF(R11-2000-081) through the Plant Metabolism Research Center, from the Crop Functional Genomics Center (CFGC) of the 21st Century Frontier Research Program (CG1422, CG1111), from the Biogreen 21 program, Rural Development Administration, and from the BK21 program, Ministry of Education.

Author information

Authors and Affiliations

  1. Plant Metabolism Research Center & Graduate School of Biotechnology, Kyung Hee University, Yongin, 446-701, Korea

    Hye-Min Lim, Jung-Il Cho, Man-Ho Cho, Seong Hee Bhoo, Tae-Ryong Hahn & Jong-Seong Jeon

  2. Division of Molecular and Life Sciences, Pohang University of Science and Technology, Pohang, 790-784, Korea

    Sichul Lee & Gynheung An

Authors
  1. Hye-Min Lim
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Jung-Il Cho
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Sichul Lee
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Man-Ho Cho
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Seong Hee Bhoo
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Gynheung An
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Tae-Ryong Hahn
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Jong-Seong Jeon
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Jong-Seong Jeon.

Additional information

Communicated by W. T. Kim

Rights and permissions

Reprints and permissions

About this article

Cite this article

Lim, HM., Cho, JI., Lee, S. et al. Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase α2 gene that is essential for expression. Plant Cell Rep 26, 683–692 (2007). https://doi.org/10.1007/s00299-006-0272-9

Download citation

  • Received:

  • Revised:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s00299-006-0272-9

Keywords

Search

Navigation