Abstract
C3 exoenzyme from C. botulinum is an ADP-ribosyltransferase that inactivates selectively RhoA, B, and C by coupling an ADP-ribose moiety. Rho-GTPases are involved in various cellular processes, such as regulation of actin cytoskeleton, cell proliferation, and apoptosis. Previous studies of our group with the murine hippocampal cell line HT22 revealed a C3-mediated inhibition of cell proliferation after 48 h and a prevention of serum-starved cells from apoptosis. For both effects, alterations of various signaling pathways are already known, including also changes on the transcriptional level. Investigations on the transcriptional activity in HT22 cells treated with C3 for 48 h identified five out of 48 transcription factors namely Sp1, ATF2, E2F-1, CBF, and Stat6 with a significantly regulated activity. For validation of identified transcription factors, studies on the protein level of certain target genes were performed. Western blot analyses exhibited an enhanced abundance of Sp1 target genes p21 and COX-2 as well as an increase in phosphorylation of c-Jun. In contrast, the level of p53 and apoptosis-inducing GADD153, a target gene of ATF2, was decreased. Our results reveal that C3 regulates the transcriptional activity of Sp1 and ATF2 resulting downstream in an altered protein abundance of various target genes. As the affected proteins are involved in the regulation of cell proliferation and apoptosis, thus the C3-mediated anti-proliferative and anti-apoptotic effects are consequences of the Rho-dependent alterations of the activity of certain transcriptional factors.
Similar content being viewed by others
Avoid common mistakes on your manuscript.
Introduction
C3 exoenzyme from Clostridium botulinum (C3) belongs to the group of eight bacterial ADP-ribosyltransferases including C3lim from Clostridium limosum, C3stau from Staphylococcus aureus, C3cer from Bacillus cereus, and C3larvin from Paenibacillus larvae that possess low molecular weight Rho-GTPases as substrates (Aktories and Frevert 1987; Just et al. 1992a; Just et al. 1992b; Wilde et al. 2001; Krska et al. 2015). C3 selectively inactivates the Rho-GTPases RhoA, B, and C by transferring an ADP-ribose moiety from NAD+ onto asparagine 41 of Rho (Chardin et al. 1989; Sekine et al. 1989). This resulting loss of functional Rho causes cellular consequences such as disorganization of the actin cytoskeleton, morphological changes, and impaired formation of contractile ring (Wiegers et al. 1991; Kishi et al. 1993). Because of its specificity, C3 is often applied as a selective Rho inhibitor in studying cellular RhoA signaling. Furthermore, the treatment of murine primary hippocampal neurons with C3 reveals an increased axonal growth as well as branching independently of the enzyme activity and an additional dendritotrophic effect of the C3 wild type (Ahnert-Hilger et al. 2004). Moreover, previous studies demonstrated that Rho inactivation by C3 inhibits cell growth in various cell types (Nishiki et al. 1990; Yamamoto et al. 1993; Zuckerbraun et al. 2003; Rohrbeck et al. 2012). RhoA is associated with the regulation of various proteins involved in the control of cell cycle progression like cyclin D1 and p21 (Adnane et al. 1998; Watts et al. 2006). Additionally, RhoA modulates the activity of certain transcription factors known to play a major role in the regulation of cell proliferation. For example, the overexpression of constitutively active RhoAQ63L increases the transcriptional activity of AP-1 and E2F in NIH3T3 cells (Berenjeno et al. 2007). Interestingly, in murine hippocampal HT22 cells, both C3 and enzyme-deficient C3-E174Q mediate inhibition of proliferation that was accompanied by a reduced level of cyclin D1 and increased expression of negative cell cycle regulator RhoB (Du and Prendergast 1999; Rohrbeck et al. 2012).
Besides the inhibition of cell proliferation, previous studies described an influence of C3 on apoptosis in various cell types. Depending on the cell type, C3 is able to trigger apoptosis in EL4 T lymphoma, HUVEC, and hepatic stellate cells (Moorman et al. 1996; Li et al. 2002; Ikeda et al. 2003). Contrary, treatment of astrocytes with C3 after induction of apoptosis with thrombin increases the amount of surviving cells (Donovan et al. 1997). Furthermore, the in vivo application of C3 protects retinal ganglion cells from apoptosis induced either after optic nerve injury or by injection of NMDA (Bertrand et al. 2005; Wang et al. 2014). The injection of C3 on the lesion site decreases the number of apoptotic cells after a spinal cord injury in rodents (Dubreuil et al. 2003). Rohrbeck et al. reported that the prevention of serum-starved and staurosporin-treated HT22 cells from apoptosis is accompanied by the C3-mediated reduction of pro-apoptotic proteins and of the activity of various caspases. Indeed, this anti-apoptotic effect depends on Rho because enzyme-deficient C3-E174Q is without effect (Rohrbeck et al. 2012).
In the present study, we investigated the impact of C3 on the transcriptional level and downstream proteins in HT22 cells. These conditions were selected due to the appearance of C3-mediated inhibition of cell proliferation after 48 h. We demonstrated that C3 Rho-dependently modulated the activity of transcription factors as well as the protein abundance of certain target genes that were associated with the regulation of cell proliferation and apoptosis. Thus, these results strongly indicate that the C3-mediated anti-proliferative and anti-apoptotic effects are mediated by alterations of transcriptional and protein level as a consequence of Rho inactivation by C3.
Materials and methods
Cell culture
The murine hippocampal cell line HT22 was cultivated in Dulbecco’s modified essential medium ((Gibco, Life Technologies, Paisley, UK), 10 % fetal bovine serum (PAN Biotech GmbH, Aidenbach, Germany), 1 % penicillin, 1 % streptomycin (PAA Laboratories GmbH, Pasching, Austria), and 1 mM sodium pyruvate (Biochrom AG, Berlin, Germany)) at 37 °C and 5 % CO2. When the cells reached confluence, they were passaged.
Growth kinetics
For growth kinetics experiments, 30,000 cells∙mL−1 were seeded onto 3.5-cm plates. After 24 h, the cells were treated with 500 nM C3, C3-E174Q, or 20 nM skepinone-L. Every 48 h the medium was replaced including C3 or C3-E174Q. The determination of cell number was performed as described previously (Rohrbeck et al. 2012).
qRT-PCR
The isolation of RNA, primer design, and determination of gene expression level of p21 by the use of real-time qRT-PCR measurements were accomplished as described prior (Rohrbeck et al. 2012). The following primer pairs were applied for qRT-PCR: p21/Cdkn1 (NM_007669.4) forward: GTACTTCCTCTGCCCTGCTG; reverse: GGCACTTCAGGGTTTTCTC, B2M (NM_009735.3) forward: ATTCACCCCCACTGAGACTG; reverse: GCTATTTCTTTCTGCGTGCAT. PCR primers were acquired by Eurofins (Ebersberg, Germany).
Western blot analysis
The cells were seeded onto 3.5-cm plates with a concentration of 150,000 cells∙mL−1. The next day, cells were treated with 500 nM C3, C3-E174Q, or indicated concentrations of inhibitors NSC23766 and skepinone-L (Calbiochem, Merck KGaA, Darmstadt, Germany) for various incubation times. After termination of incubation, the cells were washed with ice-cold PBS and frozen at −20 °C. Preparation of cell lysates and Western blot analysis was performed as described previously (Rohrbeck et al. 2012). For the analysis of phosphorylated proteins, 1 mM sodium-ortho-vanadate (Sigma-Aldrich Chemie GmbH, Munich, Germany) was applied in lysis buffer. The following primary antibodies were applied for immunoblotting: α-RhoA, α-p38, α-JNK1, α-p21, and α-GADD153 (Santa Cruz Biotechnology, CA, USA); α-β-Actin (Sigma-Aldrich, St. Louis, MO, USA); and α-pp38 Thr180/182, α-p-c-Jun Ser63, α-COX-2, and α-p53 (Cell Signaling Technology, Beverly, MA, USA). The chemiluminescence reaction was performed by ECL Femto (Pierce, Thermo Fisher Scientific Inc., Rockford, IL, USA), and the signals were detected and analyzed densitometrical by Kodak 1D software (KODAK GmbH, Stuttgart, Germany).
TF activation profiling plate array
For screening the transcriptional activity of 48 different transcription factors after treatment with C3 for 48 h, the TF Activation Profiling Plate Array I (Signosis Inc., Santa Clara, CA, USA) was performed. HT22 cells were incubated with 500 nM C3 or medium for control conditions. After 48 h, the nuclear extraction (Signosis Inc., Santa Clara, CA, USA) was performed according to manufacturers’ instructions. The protein concentration was determined by Bradford assay, and 5 μg of nuclear extracts per condition were applied in TF Activation Profiling Plate Array I according to manufacturers’ instructions. Both conditions were measured on one 96-well plate containing two sets for each 48 transcription factors. The luminescence was detected at Synergy4 microplate reader (BioTek Instruments Inc., Winooski, VT, USA). For each condition, the relative light units of the transcription factors were normalized to the value of the non-regulated SATB1 as internal control. The relative regulation was calculated by the ratio of C3-treatment in comparison to control condition. Significant regulations were estimated in a twofold increase or decrease of transcriptional activity. Transcription factors whose activity was altered in all three experiments significantly in the same direction were defined as regulated.
Luciferase reporter experiments
The dual-luciferase reporter experiments were performed with the Cignal Reporter Assay Kit (Qiagen, Hilden, Germany). The reporter system consists of a firefly luciferase reporter under the control of an inducible basal TATA box promotor, with upstream tandem repeat elements (TRE)-sequences for Sp1, and as an internal control, a construct that constitutively expressed Renilla luciferase under the control of a CMV immediate early enhancer/promotor in a ratio of 40:1. For detection of background signals, a negative control construct that encodes the firefly luciferase under a non-inducible basal TATA box promotor and a constitutively expressed Renilla luciferase (in a ratio of 40:1) were applied. 7500 HT22 cells per well were seeded into 96-well plates. The cells were transfected with 1 μg DNA construct of either transcription factor reporter or negative control by the use of jetPrime Polyplus transfection system (Polyplus transfection S.A., Illkirch, France) according to manufacturers’ instructions. After 4 h, the cells were treated with 500 nM C3, 500 nM C3-E174Q, 20 nM skepinone-L, or 50 μM NSC23766 for 48 h. To attain a stimulation of Sp1 activity, cells were incubated with 100 ng/mL PMA (Sigma-Aldrich Chemie GmbH, Munich, Germany) for 18 h as a positive control. The luciferase activity was determined by Dual-Glo® Luciferase assay system (Promega Corporation, Madison, WI, USA) on Synergy4 microplate reader (BioTek Instruments Inc., Winooski, VT, USA). Data were processed by normalizing the relative light units of firefly to Renilla luciferase, subtracting background signals and calculating the relative regulation of transcriptional activity. To determinate the effectivity of transfection, cells were transfected with a positive control reporter containing a construct that encodes GFP. The cells were visualized by light and fluorescence microscopy (Zeiss Axiovert 200 M; Carl Zeiss GmbH, Göttingen, Germany).
Expression and purification of recombinant C3 proteins
C3 wild type and C3-E174Q were expressed as recombinant fusion proteins with a glutathione S-transferase (GST)-tag into plasmid pGEX-2T (gene of C. botulinum C3, accession no. X59039) that was transferred into E. coli TG1. The purification of recombinant protein was performed as described previously (Rohrbeck et al. 2012).
Reproducibility of the experiments and statistics
All experiments were performed independently at least three times. The figures display results from representative experiments. For graphical and statistical analysis, Microsoft® Excel 2010 version 14.0 (Microsoft Corporation, Redmond, USA) was applied. The values (n ≥ 3) are means ± SEM. The statistical significance of differences between treated compared to untreated cells were calculated by the use of a two-sided unpaired Student’s t test (* = p ≤ 0.05, ** = p ≤ 0.01, and *** = p ≤ 0.001). The statistical differences between treated compared to untreated cells in qRT-PCR experiments were calculated by the use of a one-sided unpaired Student’s t test (* = p ≤ 0.05).
Results
C3 altered the transcriptional activity of ATF2 and Sp1
To get an overview of those transcription factors influenced by C3, the TF Activation Profiling Plate Array I was carried out for simultaneously analyzing 48 different transcription factors. Data analysis of this array exhibited five transcription factors, namely Sp1, ATF2, CBF, E2F-1, and Stat6, that were significantly regulated in all three independent experiments as shown in Table S1. For this study, we focused on the influence of C3 on Sp1 and ATF2, as examples for an upregulation and downregulation, respectively, of transcription factors. Both transcription factors are essentially involved in the regulation of numerous cellular processes, such as cell proliferation and apoptosis (Walton et al. 1998; Deniaud et al. 2009). As summarized in Fig. 1a, the transcriptional activity of ATF2 was distinctly reduced, while the activity of Sp1 increased after incubation with C3 for 48 h. To verify exemplarily, the results of the upregulated transcription factor Sp1, a luciferase reporter assay, was applied. The enhanced transcriptional activity of Sp1 after treatment with C3 for 48 h was confirmed by the luciferase assay, whereas the enzyme-deficient C3-E174Q did not influence the activity of Sp1 (Fig. 1b). To get an idea of further participating signaling pathways, the Rac inhibitor NSC23766 was applied. NSC23766 is known to selectively inhibit Rac1 by impairing the activation of the Rac-specific GEFs Tiam1 and Trio (Gao et al. 2004). Notably, no effect was detectable after the incubation of HT22 cells with the Rac inhibitor under the chosen conditions. Additionally, experiments with the p38 inhibitor skepinone-L were performed. Skepinone-L is the first highly selective ATP-competitive p38 inhibitor that was identified in 2011 by Koeberle et al. (Koeberle et al. 2012a; Koeberle et al. 2012b). Interestingly, skepinone-L only enhanced marginally the transcriptional activity of Sp1 (Fig. 1b) in the luciferase assay. As positive control cells were incubated with 100 ng/mL PMA for 18 h that increased the Sp1 activity by 1.6-fold. For the determination of transfection effectivity, cells were transfected with a supplied positive control reporter that contains an additional construct encoding for GFP (Fig. S1). A convincing effectivity was detected by fluorescence microscopy of GFP-transfected cells. These consistent results of both assays revealed a C3-mediated alteration of the transcriptional activity of Sp1.
For validation of the identified transcription factors, the downstream target genes of Sp1 and ATF2 were analyzed. Western blot analyses of the three different Sp1 target genes p21, c-Jun, and cyclooxygenase (COX)-2 harboring at least one Sp1 binding site in their gene promotor were performed (Rozek and Pfeifer 1993; Appleby et al. 1994; Datto et al. 1995; Rozek and Pfeifer 1995; Biggs et al. 1996; Xu et al. 2000). In case of c-Jun, we focused on the activation in terms of a phosphorylation of c-Jun. The enzyme-deficient C3-E174Q was carried along as a negative control, as it did not provoke any alterations in transcriptional activity of Sp1. Additionally, the effects of Rac and p38 inhibitors on the target proteins were determined.
C3-induced increase of p21 and anti-proliferative effect
C3 increased the protein abundance of p21 significantly after 24 h. After 48 h, the abundance of p21 was still enhanced compared to the control. From 60 h on C3, the level of p21 is reduced by approximately 25 % (Fig. 2a, b). RT-PCR data shown in Fig. 2c confirmed that C3 also raised gene expression of p21 by twofold after 24 h and by 3.5-fold after 48 h. C3-E174Q raised the protein abundance of p21 after 24 h but did not provoke any detectable effect neither on protein nor on mRNA level at the other incubation times. The p38 inhibitor skepinone-L decreased p21 by about 15–20 % after 48 and 60 h.
As p21 is a major regulator of cell cycle progression; the effect of C3 on cell proliferation was examined by growth kinetic experiments in a concentration-dependent manner (Fig. 2d). Incubation with 100 nM of C3 did not impair the proliferation of HT22 cells. A fivefold raise of the concentration of C3 caused an inhibition of cell growth from the second day of treatment. Interestingly, a tenfold increase in concentration to about 5 μM of C3 did not further enhance the observed proliferation inhibition shown in Fig. 2d nor resulted in any signs of cellular toxicity. The temporal delay of 48 h of the C3-mediated inhibition of cell proliferation was independently of the cellular growth phase and only correlated with the incubation time with C3 (Fig. S2). In contrast, the enzyme-deficient C3-E174Q induced a Rho-independent, medium inhibition of cell proliferation in HT22 cells (Rohrbeck et al. 2012). The p38 inhibitor skepinone-L inhibited the proliferation of HT22 cells moderately starting from the second day of incubation (Fig. S3). A combined incubation of C3 and skepinone-L provoked a minimum increased anti-proliferative effect compared to the single C3 treatment confirming the involvement of p38 in the C3-mediated anti-proliferative effect.
C3 induced increase in phosphorylation of c-Jun and reduced the level of p53
Western blot analysis of phospho-c-Jun was applied to study the impact of C3 on the activation of c-Jun. The abundance of phospho-c-Jun was increased significantly by approximately 2.5-fold after treatment with C3 for 24 and decreased to 1.7-fold over time (Fig. 3a, b). The enzyme-deficient C3-mutant did not exhibit any effect on the phosphorylation of c-Jun, whereas skepinone-L enhanced significantly the level of phospho-c-Jun after 72 h. To determine the functionality of activated c-Jun, the cell cycle regulator p53, a downstream target gene of c-Jun, was analyzed. c-Jun is involved in the regulation of various cellular processes, including the regulation of p53 via an AP-1-like site, namely PF-1 site, in the p53 promotor (Ginsberg et al. 1990; Schreiber et al. 1999). After 24 h, the abundance of p53 was raised insignificantly by C3, C3-E174Q, and both inhibitors. C3 reduced the level of p53 by 25 % from 48 h on and maintained a reduction of 15 % up to 72 h (Fig. 3c, d). C3-E174Q slightly increased the abundance of p53 until 48 h, whereas skepinone-L first marginally increased the level of p53 after 48 h and then reduced the abundance comparably to C3 after 72 h.
C3 modulated the level of COX-2 biphasically
The level of COX-2 was elevated up to 30 % in cells treated with C3 and C3-E174Q and by 40 % after treatment with NSC23766 for 48 h (Fig. 4a, b).
Surprisingly, C3 reduced distinctly and significantly the abundance of COX-2 by more than 60 % after 60 and 72 h. Incubation with skepinone-L from 60 h on lowered slightly the COX-2 level by 20 %, but no effect was detectable after treatment with C3-E174Q for 60 and 72 h. The decrease in COX-2 starting from 60 h revealed a biphasic modulation mediated by C3. Due to the weak signal intensity at Western blot analysis, the quantification of COX-2 after 24 h was not reliable.
Taken collectively, the increased protein abundances of p21, phospho-c-Jun, and COX-2 after treatment with C3 for 48 h indicated an enhanced activity of Sp1.
C3-induced alterations in p38 activity and reduction of GADD153
With regard to the C3-mediated anti-apoptotic effect, the signaling cascade of ATF2, which is associated with apoptosis induction, was analyzed (Walton et al. 1998). The activity of ATF2 is regulated via phosphorylation by various kinases including p38 MAP kinase (Raingeaud et al. 1996). Therefore, the influence of C3 on the phosphorylation of p38 was studied by Western blot analysis (Fig. 5a, b). The level of phospho-p38 was significantly decreased by more than 25 % after incubation with C3 for 48 h but was not significantly altered in C3-treated cells after 60 and 72 h. In contrast, C3-E174Q did not affect phospho-p38 until 60 h but led to a marginal increase of phospho-p38 after 72 h. Skepinone-L reduced continuously the abundance of phospho-p38 from 24 h on. The Growth Arrest and DNA Damage-inducible protein 153 (GADD153) is involved in the induction of apoptosis and is regulated by ATF2 via the p38 MAP kinase pathway (Bruhat et al. 2000; Maytin et al. 2001; Oh-Hashi et al. 2001; van der Sanden et al. 2004). Western blot analysis exhibited a reduced abundance of GADD153 after treatment with C3 starting from 48 h (Fig. 5c, d). The level of GADD153 was raised by 30–50 % in cells treated with C3-E174Q, NSC23766, and skepinone-L for 24 and 48 h. However, furthermore, we only focused on the inhibitory effects of skepinone-L in detail due to the fact that the p38 signaling pathway was more promising as described in the literature to be involved in the regulation of ATF2 (Raingeaud et al. 1996). After treatment with skepinone-L for 60 and 72 h, the abundance of GADD153 was decreased significantly by 20 %, whereas C3-E174Q provoked only minimum effects at this time. These results indicated a C3-mediated effect on p38 MAPK signaling that might lead downstream via ATF2 to a decreased abundance of GADD153.
Discussion
Because of its selective inactivation of Rho-GTPases, C3 is a biological tool to study the involvement of RhoA, B, and C in cellular processes. Previous studies have already revealed that the C3-mediated ADP-ribosylation of RhoA results in an inactivation and degradation of RhoA in various cell types (Rohrbeck et al. 2012; Rohrbeck et al. 2015a, b). In HT22 cells treated with C3 for 48 and 72 h, a large percentage of the cellular RhoA is degraded as detected by a distinct reduction of RhoA in Western blot analysis (Rohrbeck et al. 2012; Rohrbeck et al. 2015b). But until now, only less is known about the impact of C3 on Rho downstream pathways effecting cell proliferation and apoptosis. In the present study, we identified five transcription factors that were regulated in hippocampal HT22 cells in response to C3. With regard to the described C3-mediated anti-proliferative and anti-apoptotic effects, it is not surprising that the identified transcription factors Sp1, ATF2, and E2F are major regulators of cell proliferation and apoptosis (Mudryj et al. 1990; Shirodkar et al. 1992; Walton et al. 1998; Deniaud et al. 2009). Additionally, also Stat6 and CCAAT/enhancer binding protein zeta (CBF) are involved in the regulation of cell cycle-dependent genes (Milarski and Morimoto 1986; Lum et al. 1990; Kaplan et al. 1998). However, RhoA is involved in the regulation of various transcription factors like AP-1 and E2F (Rivard et al. 1999; Berenjeno et al. 2007). Consistent with our results, overexpression of constitutively active RhoAQ63L increases the transcriptional activity of E2F, whereas C3 inhibits serum-stimulated E2F activity (Rivard et al. 1999; Berenjeno et al. 2007). Constitutively active RhoAQ63L also triggers AP-1 activity (Berenjeno et al. 2007). In contrast, C3 does not impair AP-1 activity in cardiac muscle cells after stimulation of AP-1 promotor activity with phenylephrine (Thorburn et al. 1997). These results are in agreement with our data that AP-1 is not regulated by C3. The present study focused on C3-induced alterations of the activity of Sp1 and ATF2, since E2F, CBF, and Stat6 are subjects of separate studies because of the broad spectrum of regulated downstream pathways. The missing effect of C3-E174Q on Sp1 activity strongly indicates that C3 modulates the activity of Sp1 via Rho and related downstream cascades like MAP kinase signaling (Fig. 6). In this context, the impact of p38 can be neglected because the reduction of p38 activity by Rho inhibitor C3 and the p38 inhibitor skepinone-L did not affect Sp1 activity. To further verify the identified transcription factors and characterize the extent of C3-mediated effects on protein level, the protein abundances of certain target genes of Sp1 were examined. Especially Sp1 is known for transcriptional regulation of proteins involved in cell cycle control such as c-Jun, p21, and various cyclins (Harper et al. 1993; Wisdom et al. 1999; Deniaud et al. 2009). Previous studies reported that the C3-mediated anti-proliferative effect after 48 h is featured by the inactivation and degradation of ADP-ribosylated RhoA, an enhanced expression of RhoB and a decrease in cyclin D1 (Rohrbeck et al. 2012). Now, in this study, we determined an enhanced activity of Sp1 accompanied by an altered protein abundance of its downstream target genes p21, phospho-c-Jun, and COX-2 at this time. In agreement with previous studies, C3 increased the level of p21 on RNA and protein level after 24 and 48 h. After treatment of smooth muscle cells with C3 for 24 h, the protein level of p21 is raised and the activity of p21 promotor is enhanced by C3 in various cell lines (Adnane et al. 1998; Zuckerbraun et al. 2003). Besides p21, c-Jun is a major player of regulation of cell proliferation that was phosphorylated distinctly and continuously after treatment with C3 starting from 24 h in this current work. A functional connection between overexpression of Sp1 and an increased level of c-Jun was first described in murine IL-3-dependent Baf-3 cells. These cells overexpresses Sp1 after induction with doxycycline exhibiting a rise in c-Jun expression detected by microarray analysis and RT-PCR (Deniaud et al. 2009). In accordance with our results, Alberts & Treisman described an increased phosphorylation of c-Jun after transfection of NIH 3T3 cells with C3 (Alberts and Treisman 1998). To determine the functionality of this activation of c-Jun, the abundance of p53 was examined. The observed decreased abundance of p53 after incubation with C3 for 48 until 72 h is consistent with previous data of serum-starved HT22 cells that showed a reduced level of p53 under similar conditions (Rohrbeck et al. 2012). Ginsberg et al. first described a binding of c-Jun to a PF1-site in the p53 promotor causing an uncommon repression of gene expression (Ginsberg et al. 1990). In accordance with our results, Schreiber et al. reported that the level of p53 is increased in c-Jun-deficient 3T3-fibroblasts in comparison to wild-type cells. Moreover, stable overexpression of c-Jun in those cells reduces the p53 expression. Interestingly, concurrently, the abundance of p21 is increased in the c-Jun-deficient cells and is reduced after overexpression of c-Jun (Schreiber et al. 1999). In contrast to that, Kardassis et al. demonstrated that a simultaneous overexpression of c-Jun and Sp1 transactivates the p21 promotor in Drosophila Schneider’s SL2 and HepG2 cells (Kardassis et al. 1999). In this context, it is possible that the simultaneous overexpression of c-Jun and Sp1 exceeded the c-Jun-mediated repression of p21. Taken together, we identified a C3-mediated enhanced Sp1 activity resulting in an increased level of p21 and phosphorylated c-Jun that in turn reduced the level of p53. This is further supported by the missing effects of enzyme-deficient C3-E174Q and the insignificant impact of the Rac and p38 inhibitors on Sp1 and the studied target proteins. Thus, C3 regulated specifically the Sp1 activity via Rho inactivation, whereas the influence of Rac and p38 is negligible. Certainly, the moderate effect of skepinone-L on cell proliferation, the slight enhancement of C3-mediated anti-proliferative effect in combination with C3 in growth kinetic experiments, and the modified levels of phospho-c-Jun after 72 h indicated an influence of p38 on cell proliferation. Due to the missing alterations of Sp1 and target proteins after treatment with skepinone-L until 60 h, this effect plays indeed a minor role in the proposed Sp1 signaling. However, also C3-E174Q exhibits a moderate anti-proliferative effect in HT22 cells indicating an additional Rho-independent impact on cell proliferation (Rohrbeck et al. 2012). Overall, this observed combination of altered signaling pathways is able to cause an inhibition of cell proliferation, mainly based on an increased activity of Sp1 and enhanced abundance of p21 that are highly associated with cell cycle arrest (Harper et al. 1993; Deniaud et al. 2009). The impact of c-Jun on cell proliferation is cell type-dependent, because the growth of c-Jun-deficient embryonic stem cells is not influenced, but c-Jun-deficient fibroblasts are arrested in the G1 phase of the cell cycle (Hilberg and Wagner 1992; Wisdom et al. 1999). Our results demonstrated that the interactions of altered levels of Sp1, p21, and phospho-c-Jun play a crucial role in C3-mediated inhibition of cell proliferation. The influence of the other identified transcription factors such as E2F, another major regulator of cell proliferation, is still unclear. Further studies are ongoing to clarify the role.
In a rat spinal cord injury model, the expression of Sp1 target gene COX-2, a marker protein of inflammation, is increased up to 48 h (Appleby et al. 1994; Resnick et al. 1998; Xu et al. 2000). Indeed, the expression of COX-2 is not only induced by inflammation and after injuries but COX-2 is also constitutively expressed on a basal level in neuronal cells of the spinal cord and certain areas of the brain (Yamagata et al. 1993; Resnick et al. 1998). Nevertheless, the enhanced expression after 48 h was mediated enzyme-independently, because both C3 and C3-E174Q induced this effect. The C3-mediated decreased COX-2 abundance after 60 and 72 h is in agreement with previous studies demonstrating that the induction of COX-2 promotor by a constitutively active Gα13-subunit of heteromeric G proteins is blocked in NIH 3T3 cells after transfection with a C3 expression vector for 72 h (Slice et al. 1999). Due to the fact that also the p38 inhibitor skepinone-L slightly reduced COX-2 by 20 %, after 72 h, the p38 signaling seems to play a minor but Sp1-independent role in the regulation of COX-2.
Besides the inhibition of cell proliferation, C3 prevents serum-starved HT22 cells from apoptosis by downregulation of the pro-apoptotic proteins Bax, Bid, p53, and certain caspases at an mRNA and protein level. Moreover, the enzyme activity of caspase-3 and caspase-7 is reduced by C3 treatment for 48 h (Rohrbeck et al. 2012). Among the identified transcriptional factors, especially ATF2 is involved in the transcription of apoptosis-inducing proteins like GADD153, whose increased expression is strongly associated with induction of apoptosis in various cell types (Walton et al. 1998; Bruhat et al. 2000; Maytin et al. 2001; Oh-Hashi et al. 2001; van der Sanden et al. 2004). However, the C3-mediated protection from apoptosis in HT22 cells is in agreement with our findings of a reduced GADD153 abundance. The activation of ATF2 is mediated via phosphorylation by certain kinases such as p38 and JNK (Gupta et al. 1995; Raingeaud et al. 1996). The observed decreased level of phosphorylated p38 supports a connection between ATF2 and p38. The findings are endorsed by a study of Pausawasdi et al. identifying a C3-induced decrease in carbachol-stimulated p38 activity (Pausawasdi et al. 2000). These results imply that the reduced level of phosphorylated p38 may lead downstream to a decreased activity of ATF2. The proposed correlation between p38, ATF2, and GADD153 is further strengthened by the C3-like effects of the p38 inhibitor reducing moderately the level of GADD153 by 20 % after incubation with skepinone-L for 60 and 72 h. In agreement with these findings, prior studies reported that GADD153 transcription is highly associated with p38 in the context of apoptosis induction in various cell types (Oh-Hashi et al. 2001, Wang and Ron 1996). Moreover, GADD153 can also be activated directly by p38 via phosphorylation at serine 78 and 81 (Maytin et al. 2001). Additionally, the missing inhibiting effects of C3-E174Q on phospho-p38 and GADD153 strongly indicate a Rho-dependent reduction of ATF2 activity as a result of the decreased activity of p38 downstream inhibiting the GADD153 abundance (Fig. 6). With regard to the impact of p53 and c-Jun on the C3-mediated anti-apoptotic effect, a prior study in primary hepatocytes demonstrated that c-Jun not only represses the p53 expression via the PF-1 site but also antagonizes p53 activity after apoptosis induction by TNFα (Ginsberg et al. 1990; Schreiber et al. 1999; Eferl et al. 2003). Accordingly, as already mentioned for the C3-induced growth inhibition, also the C3-mediated prevention of apoptosis represents a consequence of the several alterations on the transcriptional and downstream protein level interfering to the anti-apoptotic impact.
In conclusion, we demonstrated that C3-mediated inactivation of Rho-GTPases also influenced transcriptional regulation involved in distinct cellular functions in addition to reorganization of the actin cytoskeleton. We identified a Rho-dependent effect of C3 on transcription factors such as Sp1 and ATF2 and their downstream target genes that were strongly involved in cell proliferation and apoptosis. Thus, these alterations in cell signaling after 48 h result in the C3-mediated anti-proliferative and anti-apoptotic effects.
Abbreviations
- C3:
-
C3 exoenzyme from Clostridium botulinum
- C3-E174Q:
-
Enzyme-deficient C3-mutant
- PMA:
-
Phorbol-12-myristate-13-acetate
- Sp1:
-
Specificity protein 1
- ATF2:
-
Activating transcription factor 2
- E2F-1:
-
E2F transcription factor 1
- CBF:
-
CCAAT/enhancer binding protein (C/EBP), zeta
- Stat6:
-
Signal transducer and activator of transcription 6
- COX-2:
-
Cyclooxygenase 2
- GADD153:
-
Growth Arrest and DNA Damage-inducible protein 153
References
Adnane J, Bizouarn FA, Qian Y, et al. (1998) p21(WAF1/CIP1) is upregulated by the geranylgeranyltransferase I inhibitor GGTI-298 through a transforming growth factor beta- and Sp1-responsive element: involvement of the small GTPase rhoA. Mol Cell Biol 18:6962–6970
Ahnert-Hilger G, Höltje M, Grosse G, et al. (2004) Differential effects of Rho GTPases on axonal and dendritic development in hippocampal neurones. J Neurochem 90:9–18. doi:10.1111/j.1471-4159.2004.02475.x
Aktories K, Frevert J (1987) ADP-ribosylation of a 21-24 kDa eukaryotic protein(s) by C3, a novel botulinum ADP-ribosyltransferase, is regulated by guanine nucleotide. Biochem J 247:363–368
Alberts AS, Treisman R (1998) Activation of RhoA and SAPK/JNK signalling pathways by the RhoA-specific exchange factor mNET1. EMBO J 17:4075–4085. doi:10.1093/emboj/17.14.4075
Appleby SB, Ristimäki A, Neilson K, et al. (1994) Structure of the human cyclo-oxygenase-2 gene. Biochem J 302:723–727. doi:10.2492/jsir1981.15.283
Berenjeno I, Nunez F, Bustelo X (2007) Transcriptomal profiling of the cellular transformation induced by Rho subfamily GTPases. Oncogene 26:4295–4305. doi:10.1038/sj.onc.1210194
Bertrand J, Winton MJ, Rodriguez-Hernandez N, et al. (2005) Application of Rho antagonist to neuronal cell bodies promotes neurite growth in compartmented cultures and regeneration of retinal ganglion cell axons in the optic nerve of adult rats. J Neurosci 25:1113–1121. doi:10.1523/JNEUROSCI.3931-04.2005
Biggs JR, Kudlow JE, Kraft AS (1996) The role of the transcription factor Sp1 in regulating the expression of the WAF1/CIP1 gene in U937 leukemic cells. J Biol Chem 271:901–906. doi:10.1074/jbc.271.2.901
Bruhat A, Jousse C, Carraro V, et al. (2000) Amino acids control mammalian gene transcription: activating transcription factor 2 is essential for the amino acid responsiveness of the CHOP promoter. Mol Cell Biol 20:7192–7204. doi:10.1128/MCB.20.19.7192-7204.2000
Chardin P, Boquet P, Madaule P, et al. (1989) The mammalian G protein rhoC is ADP-ribosylated by Clostridium botulinum exoenzyme C3 and affects actin microfilaments in Vero cells. EMBO J 8:1087–1092
Datto MB, Yu Y, Wang X-F (1995) Functional analysis of the transforming growth factor beta responsive elements in the WAF1/Cip1/p21 promoter. J Biol Chem 270:28623–28628. doi:10.1074/jbc.270.48.28623
Deniaud E, Baguet J, Chalard R, et al. (2009) Overexpression of transcription factor Sp1 leads to gene expression perturbations and cell cycle inhibition. PLoS One 4:e7035. doi:10.1371/journal.pone.0007035
Donovan F, Pike C, Cotman C, Cunningham D (1997) Thrombin induces apoptosis in cultured neurons and astrocytes via a pathway requiring tyrosine kinase and RhoA activities. J Neurosci 17:5316–5326
Du W, Prendergast G (1999) Geranylgeranylated RhoB mediates suppression of human tumor cell growth by farnesyltransferase inhibitors. Cancer Res 59:5492–5496
Dubreuil CI, Winton MJ, McKerracher L (2003) Rho activation patterns after spinal cord injury and the role of activated Rho in apoptosis in the central nervous system. J Cell Biol 162:233–243. doi:10.1083/jcb.200301080
Eferl R, Ricci R, Kenner L, et al. (2003) Liver tumor development: c-Jun antagonizes the proapoptotic activity of p53. Cell 112:181–192. doi:10.1016/S0092-8674(03)00042-4
Gao Y, Dickerson JB, Guo F, et al. (2004) Rational design and characterization of a Rac GTPase-specific small molecule inhibitor. Proc Natl Acad Sci U S A 101:7618–7623. doi:10.1073/pnas.0307512101
Ginsberg D, Oren M, Yaniv M, Piette J (1990) Protein-binding elements in the promoter region of the mouse p53 gene. Oncogene 5:1285–1290
Gupta S, Campbell D, Dérijard B, Davis RJ (1995) Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science 267:389–393
Harper JW, Adami GR, Wei N, et al. (1993) The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805–816. doi:10.1016/0092-8674(93)90499-G
Hilberg F, Wagner EF (1992) Embryonic stem (ES) cells lacking functional c-Jun: consequences for growth and differentiation, AP-1 activity and tumorigenicity. Oncogene 7:2371–2380
Ikeda H, Nagashima K, Yanase M, et al. (2003) Involvement of Rho/Rho kinase pathway in regulation of apoptosis in rat hepatic stellate cells. Am J Physiol Gastrointest Liver Physiol 285:G880–G886. doi:10.1152/ajpgi.00039.2003
Just I, Mohr C, Schallehn G, et al. (1992a) Purification and characterization of an ADP-ribosyltransferase produced by Clostridium limosum. J Biol Chem 267:10274–10280
Just I, Schallehn G, Aktories K (1992b) ADP-ribosylation of small GTP-binding proteins by Bacillus cereus. Biochem Biophys Res Commun 183:931–936
Kaplan MH, Daniel C, Schindler U, Grusby MJ (1998) Stat proteins control lymphocyte proliferation by regulating p27Kip1 expression. Mol Cell Biol 18:1996–2003
Kardassis D, Papakosta P, Pardali K, Moustakas A (1999) c-Jun transactivates the promoter of the human p21(WAF1/Cip1) gene by acting as a superactivator of the ubiquitous transcription factor Sp1. J Biol Chem 274:29572–29581. doi:10.1074/jbc.274.41.29572
Kishi K, Sasaki T, Kuroda S, et al. (1993) Regulation of cytoplasmic division of Xenopus embryo by rho p21 and its inhibitory GDP/GTP exchange protein (rho GDI). J Cell Biol 120:1187–1195
Koeberle SC, Fischer S, Schollmeyer D, et al. (2012a) SI—design, synthesis, and biological evaluation of novel disubstituted dibenzosuberones as highly potent and selective inhibitors of p38 mitogen activated protein kinase. J Med Chem 55:5868–5877. doi:10.1021/jm300327h
Koeberle SC, Romir J, Fischer S, et al. (2012b) Skepinone-L is a selective p38 mitogen-activated protein kinase inhibitor. Nat Chem Biol 8:141–143. doi:10.1038/nchembio.761
Krska D, Ravulapalli R, Fieldhouse RJ, et al. (2015) C3larvin toxin, an ADP-ribosyltransferase from Paenibacillus larvae. J Biol Chem 290:1639–1653. doi:10.1074/jbc.M114.589846
Li X, Liu L, Tupper JC, et al. (2002) Inhibition of protein geranylgeranylation and RhoA/RhoA kinase pathway induces apoptosis in human endothelial cells. J Biol Chem 277:15309–15316. doi:10.1074/jbc.M201253200
Lum LS, Sultzman LA, Kaufman RJ, et al. (1990) A cloned human CCAAT-box-binding factor stimulates transcription from the human hsp70 promoter. Mol Cell Biol 10:6709–6717
Maytin EV, Ubeda M, Lin JC, Habener JF (2001) Stress-inducible transcription factor CHOP/gadd153 induces apoptosis in mammalian cells via p38 kinase-dependent and -independent mechanisms. Exp Cell Res 267:193–204. doi:10.1006/excr.2001.5248
Milarski KL, Morimoto RI (1986) Expression of human HSP70 during the synthetic phase of the cell cycle. Proc Natl Acad Sci U S A 83:9517–9521. doi:10.1073/pnas.83.24.9517
Moorman JP, Bobak DA, Hahn CS (1996) Inactivation of the small GTP binding protein Rho induces multinucleate cell formation and apoptosis in murine T lymphoma EL4. J Immunol 156:4146–4153
Mudryj M, Hiebert SW, Nevins JR (1990) A role for the adenovirus inducible E2F transcription factor in a proliferation dependent signal transduction pathway. EMBO J 9:2179–2184
Nishiki T, Narumiya S, Morii N, et al. (1990) ADP-ribosylation of the rho/rac proteins induces growth inhibition, neurite outgrowth and acetylcholine esterase in cultured PC-12 cells. Biochem Biophys Res Commun 167:265–272
Oh-Hashi K, Maruyama W, Isobe K (2001) Peroxynitrite induces GADD34, 45, and 153 VIA p38 MAPK in human neuroblastoma SH-SY5Y cells. Free Radic Biol Med 30:213–221
Pausawasdi N, Ramamoorthy S, Stepan V, et al. (2000) Regulation and function of p38 protein kinase in isolated canine gastric parietal cells. Am J Physiol Gastrointest Liver Physiol 278:G24–G31
Raingeaud J, Whitmarsh AJ, Barrett T, et al. (1996) MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway. Mol Cell Biol 16:1247–1255
Resnick DK, Graham SH, Dixon CE, Marion DW (1998) Role of cyclooxygenase 2 in acute spinal cord injury. J Neurotrauma 15:1005–1013
Rivard N, Boucher M-J, Asselin C, L’Allemain G (1999) MAP kinase cascade is required for p27 downregulation and S phase entry in fibroblasts and epithelial cells. Am J Phys 277:C652–C664
Rohrbeck A, Kolbe T, Hagemann S, et al. (2012) Distinct biological activities of C3 and ADP-ribosyltransferase-deficient C3-E174Q. FEBS J 279:2657–2671. doi:10.1111/j.1742-4658.2012.08645.x
Rohrbeck A, Stahl F, Höltje M, et al (2015a) C3-induced release of neurotrophic factors from Schwann cells—potential mechanism behind its regeneration promoting activity. Neurochem Int 1–14. doi:10.1016/j.neuint.2015.09.007
Rohrbeck A, von Elsner L, Hagemann S, Just I (2015b) Uptake of Clostridium botulinum C3 exoenzyme into intact HT22 and J774A.1 cells. Toxins (Basel) 7:380–395. doi:10.3390/toxins7020380
Rozek D, Pfeifer GP (1993) In vivo protein-DNA interactions at the c-Jun promoter: preformed complexes mediate the UV response. Mol Cell Biol 13:5490–5499. doi:10.1128/MCB.13.9.5490
Rozek D, Pfeifer GP (1995) In vivo protein-DNA interactions at the c-Jun promoter in quiescent and serum-stimulated fibroblasts. J Cell Biochem 57:479–487. doi:10.1002/jcb.240570313
Schreiber M, Kolbus A, Piu F, et al. (1999) Control of cell cycle progression by c-Jun is p53 dependent. Genes Dev 13:607–619
Sekine A, Fujiwara M, Narumiya S (1989) Asparagine residue in the rho gene product is the modification site for botulinum ADP-ribosyltransferase. J Biol Chem 264:8602–8605
Shirodkar S, Ewen M, DeCaprio JA, et al. (1992) The transcription factor E2F interacts with the retinoblastoma product and a p107-cyclin A complex in a cell cycle-regulated manner. Cell 68:157–166
Slice LW, Walsh JH, Rozengurt E (1999) Galpha(13) stimulates Rho-dependent activation of the cyclooxygenase-2 promoter. J Biol Chem 274:27562–27566
Thorburn J, Xu S, Thorburn A (1997) MAP kinase- and Rho-dependent signals interact to regulate gene expression but not actin morphology in cardiac muscle cells. EMBO J 16:1888–1900. doi:10.1093/emboj/16.8.1888
van der Sanden MHM, Meems H, Houweling M, et al. (2004) Induction of CCAAT/enhancer-binding protein (C/EBP)-homologous protein/growth arrest and DNA damage-inducible protein 153 expression during inhibition of phosphatidylcholine synthesis is mediated via activation of a C/EBP-activating transcription factor-r. J Biol Chem 279:52007–52015. doi:10.1074/jbc.M405577200
Walton M, Woodgate A-M, Sirimanne E, et al. (1998) ATF-2 phosphorylation in apoptotic neuronal death. Brain Res Mol Brain Res 63:198–204
Wang XZ, Ron D (1996) Stress-induced phosphorylation and activation of the transcription factor CHOP (GADD153) by p38 MAP kinase. Science 272:1347–1349
Wang Y, Wang Y, Yang Q, et al. (2014) Neuroprotective effects of C3 exoenzyme in excitotoxic retinopathy. Exp Eye Res 125:128–134. doi:10.1016/j.exer.2014.05.018
Watts K, Cottrell E, Hoban P, Spiteri M (2006) RhoA signaling modulates cyclin D1 expression in human lung fibroblasts; implications for idiopathic pulmonary fibrosis. Respir Res 7:88. doi:10.1186/1465-9921-7-88
Wiegers W, Just I, Müller H, et al. (1991) Alteration of the cytoskeleton of mammalian cells cultured in vitro by Clostridium botulinum C2 toxin and C3 ADP-ribosyltransferase. Eur J Cell Biol 54:237–245
Wilde C, Chhatwal GS, Schmalzing G, et al. (2001) A novel C3-like ADP-ribosyltransferase from Staphylococcus aureus modifying RhoE and Rnd3. J Biol Chem 276:9537–9542. doi:10.1074/jbc.M011035200
Wisdom R, Johnson RS, Moore C (1999) c-Jun regulates cell cycle progression and apoptosis by distinct mechanisms. EMBO J 18:188–197. doi:10.1093/emboj/18.1.188
Xu Q, Ji Y-S, Schmedtje JFJ (2000) Sp1 increases expression of cyclooxygenase-2 in hypoxic vascular endothelium. Implications for the mechanisms of aortic aneurysm and heart failure. J Biol Chem 275:24583–24589. doi:10.1074/jbc.M003894200
Yamagata K, Andreasson KI, Kaufmann WE, et al. (1993) Expression of a mitogen-inducible cyclooxygenase in brain neurons: regulation by synaptic activity and glucocorticoids. Neuron 11:371–386. doi:10.1016/0896-6273(93)90192-T
Yamamoto M, Marui N, Sakai T, et al. (1993) ADP-ribosylation of the rhoA gene product by botulinum C3 exoenzyme causes Swiss 3T3 cells to accumulate in the G1 phase of the cell cycle. Oncogene 8:1449–1455
Zuckerbraun BS, Shapiro RA, Billiar TR, Tzeng E (2003) RhoA influences the nuclear localization of extracellular signal-regulated kinases to modulate p21Waf/Cip1 expression. Circulation 108:876–881. doi:10.1161/01.CIR.0000081947.00070.07
Author contributions
L.v.E. planned the experiments, performed experiments, analyzed data, and wrote the manuscript. S.H. performed the experiments. I.J. planned the experiments and wrote the manuscript. A.R. planned the experiments, performed experiments, analyzed data, and wrote the manuscript.
Author information
Authors and Affiliations
Corresponding author
Ethics declarations
Competing financial interests’ declaration
The authors declare that they have no conflict of interest.
Electronic supplementary material
ESM 1
(PDF 541 kb)
Rights and permissions
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.
About this article
Cite this article
von Elsner, L., Hagemann, S., Just, I. et al. C3 exoenzyme impairs cell proliferation and apoptosis by altering the activity of transcription factors. Naunyn-Schmiedeberg's Arch Pharmacol 389, 1021–1031 (2016). https://doi.org/10.1007/s00210-016-1270-2
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/s00210-016-1270-2