Abstract
Acute myeloid leukemia (AML) with t(8;21)(q22;q22.1);RUNX1-ETO is one of the most common subtypes of AML. Although t(8;21) AML has been classified as favorable-risk, only about half of patients are cured with current therapies. Several genetic abnormalities, including TP53 mutations and deletions, negatively impact survival in t(8;21) AML. In this study, we established Cas9+ mouse models of t(8;21) AML with intact or deficient Tpr53 (a mouse homolog of TP53) using a retrovirus-mediated gene transfer and transplantation system. Trp53 deficiency accelerates the in vivo development of AML driven by RUNX1-ETO9a, a short isoform of RUNX1-ETO with strong leukemogenic potential. Trp53 deficiency also confers resistance to genetic depletion of RUNX1 and a TP53-activating drug in t(8;21) AML. However, Trp53-deficient t(8;21) AML cells were still sensitive to several drugs such as dexamethasone. Cas9+ RUNX1-ETO9a cells with/without Trp53 deficiency can produce AML in vivo, can be cultured in vitro for several weeks, and allow efficient gene depletion using the CRISPR/Cas9 system, providing useful tools to advance our understanding of t(8;21) AML.
Similar content being viewed by others
Avoid common mistakes on your manuscript.
Introduction
The t(8;21)(q22;q22) translocation resulting in the RUNX1-ETO (also called AML1-ETO or RUNX1-RUNX1T1) rearrangement is one of the most common genetic alterations in acute myeloid leukemia (AML), accounting for 5–10% of AML cases [1,2,3]. Patients diagnosed with t(8;21) AML typically experience a favorable prognosis when treated with intensive cytarabine-based chemotherapy. However, a significant number of patients still relapse, highlighting the clinical heterogeneity within t(8;21) AML [4, 5]. Relapse rates are particularly high in elderly patients who are unable to tolerate high-dose cytotoxic chemotherapy.
RUNX1-ETO alone is not sufficient for leukemogenic transformation and requires additional genetic alterations for progression to full blown AML [1, 3]. Studies have identified the collaborative genetic alterations, including mutations in KIT, ASXL1, ZBTB7A, NRAS, CBL, and TP53 genes in t(8;21) AML [5, 6]. Some of these mutations, such as those in KIT, ASXL1, and TP53, negatively affect survival. In particular, loss of the TP53 response pathway has been shown to be associated with drug resistance and disease progression in RUNX1-ETO leukemia [7], while RUNX1-ETO itself was shown to activate the p53 pathway that sensitizes leukemia cells to DNA damage [8]. Therefore, new approaches for the treatment of t(8;21) AML patients with TP53 mutations or deletions need to be developed.
In addition to the full-length RUNX1-ETO, alternatively spliced isoforms of the RUNX1-ETO transcript have been identified in t(8;21) patients. RUNX1-ETO9a [9], a short isoform of RUNX1-ETO, encodes a C-terminally truncated RUNX1-ETO protein with a stronger leukemogenic potential than full-length RUNX1-ETO. Because RUNX1-ETO9a can induce AML without cooperating mutations in a mouse retroviral transduction-transplantation model, it has been widely used experimentally as mouse models of t(8;21) AML.
In this study, we developed novel mouse models for t(8;21) AML using RUNX1-ETO9a, Trp53 (the mouse homolog of TP53)-deficient mice and Cas9 knockin mice. The established Cas9+, RUNX1-ETO9a-expressing AML cells with/without Trp53 deficiency will be useful tools for the development of effective therapeutic strategies for t(8;21) AML.
Methods
Mice
C57BL/6 mice (Ly5.1) obtained from Sankyo Labo Service Corporation, Tokyo, Japan, were employed in bone marrow transplantation assays. Trp53−/− mice were sourced from the RIKEN BioResource Center in Ibaragi, Japan [10]. Rosa26-LSL-Cas9 knockin mice were procured from The Jackson Laboratory (#024857) [11]. To generate Trp53−/−-Cas9 mice, Trp53−/− mice were bred with Cas9 knockin mice. All animal experiments were granted approval by the Animal Care Committee of the Institute of Medical Science at the University of Tokyo (PA21-67) and were carried out in accordance with the Regulation on Animal Experimentation at the University of Tokyo, following the International Guiding Principles for Biomedical Research Involving Animals.
Cell culture
RUNX1-ETO9a-Cas9+ and RUNX1-ETO9a-Trp53−/−-Cas9+ cells were isolated from spleens of leukemic mice. Initially, these cells were cultured in Roswell Park Memorial Institute (RMPI)-1640 medium (#189–02025, FUJIFILM Wako) supplemented with 10% fetal bovine serum (FBS; #FB-1365/500, Biosera), and 1% penicillin–streptomycin (PS, #09367–34, Nacalai), along with the following cytokines: 100 ng/ml SCF (#455-MC, R&D Systems), 10 ng/ml IL-6 (#216–16, PEPROTECH), and 1 ng/ml IL-3 (#213–13, PEPROTECH). The amount of cytokines was gradually reduced, and eventually the cells were maintained in the same medium supplemented only with 1 ng/ml IL-3. When the cryopreserved cells were used, the cells were initially cultured with 100 ng/ml SCF, 10 ng/ml IL-6 and 1 ng/ml IL-3 for one week and then cultured with 1 ng/ml IL-3 only.
cSAM cells were previously generated using a murine transplantation model. Briefly, a C-terminally truncated form of ASXL1 and SETBP-D868N were transduced into mouse bone marrow progenitor cells, and transplanted into sublethally irradiated recipient mice. Leukemic cells were isolated from the bone marrow of the moribund mice and their leukemogenic activity was confirmed by serial transplantation [12, 13]. The cSAM cells were cultured in RPMI-1640 medium supplemented with 10% FBS and 1 ng/ml IL-3.
Plat-E [14] and 293 T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) medium (#044–29765, Wako) with 10% FBS and 1% PS.
Plasmids and Viral transduction
HA-tagged RUNX1-ETO9a was employed for RUNX1-ETO9a expression, and it was incorporated into a pMSCV-IRES-Thy1.1 retroviral vector [15]. Retroviruses were produced by transiently transfecting Plat-E packaging cells using the calcium-phosphate coprecipitation method. The cells were transduced with retroviruses using Retronectin (Takara Bio Inc., Otsu, Shiga, Japan). Lentiviruses were produced by transiently transfecting lentiviral plasmids, along with PCMV-VSV-G (Addgene, #8454) [16] and psPAX2 (Addgene, #12,260), into 293 T cells with the calcium-phosphate method [15].
Runx1 depletion using the CRISPR/Cas9
To generate single guide RNA (sgRNA), annealed oligos were incorporated into either the pLentiguide-puro vector (#52,962) [17] or pLKO5.sgRNA.EFS.tRFP657 vector (#57,824) [18], both sourced from Addgene. For the stable expression of puromycin-resistant sgRNAs, RUNX1-ETO9a-Cas9+ cells were transduced with the sgRNAs and were subsequently selected using puromycin (1 μg/ml) in RPMI-1640 medium with 10% FBS, 1% PS, and 1 ng/ml IL-3. The sequences for the non-targeting (NT) control and sgRNAs targeting mouse Runx1 are provided below: NT: 5′ cgcttccgcggcccgttcaa 3′, sgRunx1-(1): 5′ tgcgcactagctcgccaggg 3′, sgRunx1-(2): 5’ agaactgagaaatgctaccg 3′.
Transplantation assay
5-FU (150 mg/kg, intraperitoneal injection) was administered to male mice carrying the Cas9 gene and Trp53−/−-Cas9 mice. The bone marrow was collected from the Cas9 mice and Trp53−/−-Cas9 mice after 4 days, and were pre-cultured in RPMI-1640 containing 10% FBS, 1% PS, supplemented with 100 ng/ml murine SCF, 1 ng/ml IL-3 and 10 ng/ml IL-6 for 16 h. These cells were then transduced with RUNX1-ETO9a retrovirus and transplanted into lethally irradiated (9.5 Gy) 8 weeks-old male Ly5.1 mice. Each mouse received 2 × 105 RUNX1-ETO9a-transduced cells with 2 × 105 wild type Ly5.1 bone marrow cells. For serial transplantation, 1 × 106 spleen or bone marrow cells collected from moribund leukemic mice were intravenously injected into sublethally irradiated (5.25 Gy) male Ly5.1 mice. Note that male mice were used as recipient mice in all experiments to avoid a potential immune response of female mice to male donor cells.
Flow Cytometry
Fluoro-conjugated antibodies were used to stain cells for 15 min at 4 °C. Following staining, cells underwent two cold PBS washes and were then resuspended in PBS containing 2% FBS. Subsequently, analysis of the cells was conducted using Canto II (BD Biosciences, San Jose, CA, USA) and FlowJo software (FlowJo). The antibodies employed in this study are listed below: APC-CD90.1 (Thy1.1), Biolegend; #202,526, BV421-c-kit, Biolegend; #135,123, PE-Cy5-CD11b, Biolegend; # 101,210 and PE-Gr-1, Biolegend; # 127,608. The dilution ratio of these antibodies was 1:400.
Western blotting
Cells underwent multiple washes with PBS and were then lysed using pre-heated Laemmli sample buffer (Bio-rad, USA; #1,610,737). The resulting total cell lysates were subjected to SDS-PAGE and transferred onto a polyvinylidene fluoride membrane (Bio-Rad). The membrane was incubated with anti-RUNX1 antibody [AML1 (D4A6) Rabbit mAb #8529; Cell Signaling Technology, Beverly, MA, 1:500] and anti-GAPDH antibody [GAPDH (D16H11) XP® Rabbit mAb #5174; Cell Signaling Technology, Beverly, MA, 1:500]. Signals were detected using ECL Western Blotting Substrate (Promega, Madison, WI, USA) and visualized with the LAS‐4000 Luminescent Image Analyzer (FUJIFILM).
Cell growth assay
The cytotoxic effects of DS-5272, Cytarabine, Dexamethasone, and Decitabine against RUNX1-ETO9a cells with/without Trp53 deficiency or cSAM cells were assessed using the Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) following the manufacturer's instructions. Cells were plated in 96-well plates at a density of 5 × 103 cells/well in 0.1 ml medium and treated with various concentrations of each compound. After 72 h of incubation at 37 °C, 8 μl of the Cell Counting Kit-8 was added to each well. Following a 1-h incubation at 37 °C, the absorbance at 450 nm was measured using a microplate reader (CLARIOstar Plus, BMG LABTECH, Ortenberg, GER). Relative cell viability was expressed as the ratio of the absorbance in each treatment group to that of the corresponding untreated control group. The data are presented as means ± standard deviation (SD) from more than three independent experiments. IC50 values were calculated using GraphPad Prism software.
Statistical analyses
GraphPad Prism 10 was employed for all statistical analyses. Pairwise comparisons of significance were carried out utilizing ordinary two-way ANOVA. Survival curve comparisons were performed using the log-rank (Mantel-Cox) test. Animal experiments were not subjected to blinding or randomization. Sample sizes were determined based on prior experience rather than a predetermined statistical method. All data are presented as mean ± SD.
Results
Trp53 deficiency accelerates the development of RUNX1-ETO9a-induced AML
To obtain Trp53-deficient cells expressing Cas9, we first crossed Trp53−/− mice with Cas9 knockin mice. Bone marrow cells derived from 5-FU-treated Trp53−/−-Cas9 or Cas9 mice were transduced with RUNX1-ETO9a (coexpressing Thy1.1), followed by the transplantation of 2 × 105 cells into lethally irradiated (9.5 Gy) Ly5.1 mice (Fig. 1A). All mice receiving RUNX1-ETO9a-transduced Trp53−/−-Cas9 cells (n = 7) developed AML approximately 60 days post-transplantation. In contrast, mice transplanted with RUNX1-ETO9a-transduced Cas9 cells with intact Trp53 showed considerable variation in disease onset time, with only 5 out of 7 mice developed AML (Fig. 1B). In the diseased mice, bone marrow and spleen were dominated by Thy1.1+c-Kit+ immature blasts, with a trend that Trp53 deficiency increased the c-Kit+ immature cells (Fig. 1C, D).
To confirm the leukemogenic potential of the RUNX1-ETO9a-expressing cells, we then transplanted 1 × 106 spleen cells collected from the moribund primary recipient mice into sublethally irradiated (5.25 Gy) secondary recipient mice. Again, mice transplanted with RUNX1-ETO9a-Trp53−/−-Cas9+ cells developed AML more rapidly than those receiving RUNX1-ETO9a-Cas9+ cells with intact Trp53 (Fig. 1E). We observed the accumulation of c-Kit+ cells in the spleens of the secondary recipient mice, similar to the primary recipient mice (Fig. 1F). Thus, RUNX1-ETO9a alone can initiate AML development, and its combination with Trp53 deficiency significantly accelerates disease progression.
We then enriched leukemia stem cell activity of these RUNX1-ETO9a cells through tertiary and quaternary transplantation, finally resulting in the generation of aggressive AML cells capable of producing leukemia in 10 days even in non-irradiated recipient mice (Fig. 1G).
Distinct impact of RUNX1 depletion on Trp53-intact or deficient RUNX1-ETO9a cells
Next, we examined if the RUNX1-ETO9a cells can be cultured in vitro. We first cultured the RUNX1-ETO9a-Trp53−/−-Cas9+ cells and RUNX1-ETO9a-Cas9+ cells obtained from moribund mice in RPMI-1640 medium with murine SCF, IL-3, and IL-6 for 5 days, and then reduced the concentrations of SCF and IL-6 gradually. The RUNX1-ETO9a cells with/without Trp53 deficiency grew well in the medium containing only IL-3 for at least 2 weeks. However, we observed a significant decline in the proliferative capacity of cells after approximately 20 days of in vitro culture. Both the Trp53-intact or deficient RUNX1-ETO9a cells were differentiated into mature myeloid cells, as evidenced by the reduced c-Kit expression and a remarkable increase of CD11b+ cells at day 25 (Fig. 2A). Thus, RUNX1-ETO9a cells were not immortalized in vitro, but could be cultured for up to three weeks, which is sufficient for most in vitro experiments.
We then assessed the effect of RUNX1 depletion on the growth of Trp53-intact/deficient RUNX1-ETO9a cells. RUNX1 has been shown to promote the efficient growth of AML cells including t(8;21) AML, but a previous study reported that RUNX1 promotes the tumor growth only in tumors with intact TP53 [19]. The Trp53-intact and deficient RUNX1-ETO9a cells were transduced with non-targeting (NT) or mouse Runx1-targeting [sgRunx1-1(1) and (2)] sgRNAs and the sgRNA-transduced cells were selected using puromycin for 4 days (Fig. 2B). The efficient depletion of RUNX1 following the introduction of the Runx1-targeting sgRNAs was confirmed by Western blotting (Fig. 2C). Interestingly, RUNX1 depletion showed contrasting effects in Trp53-intact and Trp53-deficient RUNX1-ETO9a cells. Consistent with many previous reports [19,20,21,22], RUNX1 depletion showed the strong growth-inhibitory effect in RUNX1-ETO9a-Cas9+ cells. In sharp contrast, RUNX1 depletion promoted the growth of RUNX1-ETO9a-Trp53−/−-Cas9+ cells by inhibiting their myeloid maturation (Fig. 2D, E). These results highlight the importance of Trp53 status in determining the effect of RUNX1 depletion in t(8;21) AML.
Trp53-intact or deficient RUNX1-ETO9a cells show distinct drug susceptibility
Finally, we assessed the effect of several drugs on the growth of Trp53-intact or deficient RUNX1-ETO9a cells using the cell viability assay. As expected, DS-5272, an inhibitor of p53-MDM2 interaction [23, 24], showed the growth-inhibitory effect only in the Trp53-intact RUNX1-ETO9a cells (Fig. 3A). We then examined whether Trp53 status affects the sensitivity of RUNX1-ETO9a cells to common chemotherapeutic agents: cytarabine [2], decitabine [25] and dexamethasone [26]. Although Trp53 deletion did not alter the sensitivity of RUNX1-ETO9a cells to these drugs, we found that RUNX1-ETO9a cells were particularly sensitive to dexamethasone regardless of Trp53 status even at low concentrations (Fig. 3B, C). In contrast, cSAM, another murine AML cell line transformed by SETBP1-D868N and ASXL1-E635RfsX15 mutations [12, 13], was resistant to dexamethasone treatment (Fig. 3C). Thus, dexamethasone was specifically effective against t(8;21) AML, including those with TP53 alterations.
Discussion
Although t(8;21) AML has been classified as a favorable risk AML, a significant proportion of patients, especially those with specific co-operating mutations, often relapse and eventually die. TP53 is one of the genes whose mutations are associated with poor prognosis in t(8;21) AML [5]. In this study, we established a novel murine model for t(8;21) AML with/without Trp53 deficiency using RUNX1-ETO9a, a short isoform of RUNX1-ETO with stronger leukemogenic potential [9]. The RUNX1-ETO9a cells are able to generate AML in vivo and can be cultured in vitro for up to three weeks. In addition, the RUNX1-ETO9a cells established in this study express Cas9. Therefore, any gene of interest can be efficiently depleted in these cells.
Previous experimental studies have shown that loss of TP53 promotes disease progression and therapy resistance in RUNX1-ETO leukemia [7, 8]. Consistent with these findings, we showed that Trp53 deficiency accelerates the development of AML driven by RUNX1-ETO9a. However, it should be noted that Trp53 was already deleted in cells prior to RUNX1-ETO9a transduction in all these Trp53-deficient t(8;21) AML models. Given that TP53 mutations are typically detected as secondary somatic mutations in t(8;21) AML, and that acute and chronic inhibition of TP53 sometimes show opposing effects [27], the effect of late Trp53 depletion in the established RUNX1-ETO9a leukemia warrants further investigation. The Cas9+RUNX1-ETO9a cells established in this study will be useful for this purpose. Furthermore, our mouse t(8;21) AML models will provide ideal platforms to perform the in vivo CRISPR/Cas9 library screening to identify key regulators that promote or suppress the development of RUNX1-ETO leukemia, particularly in vivo.
Using these RUNX1-ETO9a cells with or without Trp53 deficiency, we showed that targeting RUNX1 is only effective in Trp53-intact RUNX1-ETO9a cells. Previous studies have shown that RUNX1 has a dual role in leukemogenesis [28]. RUNX1 acts as a tumor promoter by promoting the survival of AML cells [20, 21], in part through activation of TP53-mediated pro-apoptotic signaling [19, 29]. On the other hand, RUNX1 also acts as a tumor suppressor by inhibiting myeloid maturation [20, 30]. Therefore, it is likely that the tumor suppressor role of RUNX1 is more pronounced in the Trp53-deficient RUNX1-ETO cells. Thus, our data together with previous findings strongly suggest that the antileukemic effect mediated by RUNX1 depletion requires functional TP53.
Various novel therapeutic strategies for treating RUNX1-ETO leukemia have demonstrated promise in either clinical or experimental investigations [1]. These include a KIT inhibitor dasatinib [31], JAK inhibitors [15, 32], HDAC inhibitors [33], and glucocorticoid drugs such as dexamethasone. In this study, we found that RUNX1-ETO9a cells were particularly sensitive to dexamethasone regardless of Trp53 status. While glucocorticoids are widely used to treat lymphoid malignancies [26], they are generally not deemed beneficial in the context of AML. However, several previous reports have repeatedly shown that glucocorticoids are effective in suppressing the growth of t(8;21) AML cells at low doses, but not in other subtypes of AML [34, 35]. These findings, together with our data, provide a rational basis for clinical testing of glucocorticoid drugs, such as dexamethasone, against t(8;21) AML including those with TP53 alterations.
In summary, we established novel murine Cas9+ RUNX1-ETO9a cells with intact or deficient Trp53. These cells allow testing the effect of novel drugs in vitro and in vivo, enable genetic screens using sgRNA libraries, and will provide valuable information on the role of TP53 in the development of t(8;21) AML in future studies.
Data availability
All data will be made available on reasonable request.
References
Lin S, Mulloy JC, Goyama S. RUNX1-ETO leukemia. Adv Exp Med Biol. 2017;962:151–73. https://doi.org/10.1007/978-981-10-3233-2_11.
Dohner H, Weisdorf DJ, Bloomfield CD. Acute myeloid leukemia. N Engl J Med. 2015;373:1136–52. https://doi.org/10.1056/NEJMra1406184.
Swart LE, Heidenreich O. The RUNX1/RUNX1T1 network: translating insights into therapeutic options. Exp Hematol. 2021;94:1–10. https://doi.org/10.1016/j.exphem.2020.11.005.
Al-Harbi S, Aljurf M, Mohty M, Almohareb F, Ahmed SOA. An update on the molecular pathogenesis and potential therapeutic targeting of AML with. Blood Adv. 2020;4:229–38. https://doi.org/10.1182/bloodadvances.2019000168.
Yu GP, Yin CX, Wu FQ, Jiang L, Zheng ZX, Xu D, Zhou JH, Jiang XJ, Liu QF, Meng FY. Gene mutation profile and risk stratification in <i>AML1-ETO</i>-positive acute myeloid leukemia based on next-generation sequencing. Oncol Rep. 2019;42:2333–44. https://doi.org/10.3892/or.2019.7375.
Opatz S, Bamopoulos SA, Metzeler KH, Herold T, Ksienzyk B, Braundl K, Tschuri S, Vosberg S, Konstandin NP, Wang C, Hartmann L, Graf A, Krebs S, Blum H, Schneider S, Thiede C, Middeke JM, Stolzel F, Rollig C, Schetelig J, Ehninger G, Kramer A, Braess J, Gorlich D, Sauerland MC, Berdel WE, Wormann BJ, Hiddemann W, Spiekermann K, Bohlander SK, Greif PA. The clinical mutatome of core binding factor leukemia. Leukemia. 2020;34:1553–62. https://doi.org/10.1038/s41375-019-0697-0.
Zuber J, Radtke I, Pardee TS, Zhao Z, Rappaport AR, Luo WJ, McCurrach ME, Yang MM, Dolan ME, Kogan SC, Downing JR, Lowe SW. Mouse models of human AML accurately predict chemotherapy response. Genes Dev. 2009;23:877–89. https://doi.org/10.1101/gad.1771409.
Krejci O, Wunderlich M, Geiger H, Chou FS, Schleimer D, Jansen M, Andreassen PR, Mulloy JC. P53 signaling in response to increased DNA damage sensitizes AML1-ETO cells to stress-induced death. Blood. 2008;111:2190–9. https://doi.org/10.1182/blood-2007-06-093682.
Yan M, Kanbe E, Peterson LF, Boyapati A, Miao Y, Wang Y, Chen IM, Chen ZX, Rowley JD, Willman CL, Zhang DE. A previously unidentified alternatively spliced isoform of t(8;21) transcript promotes leukemogenesis. Nat Med. 2006;12:945–9. https://doi.org/10.1038/nm1443.
Tsukada T, Tomooka Y, Takai S, Ueda Y, Nishikawa S, Yagi T, Tokunaga T, Takeda N, Suda Y, Abe S, Matsuo I, Ikawa Y, Aizawa S. Enhanced proliferative potential in culture of cells from P53-deficient mice. Oncogene. 1993;8:3313–22.
Platt RJ, Chen SD, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas O, Eisenhaure TM, Jovanovic M, Graham DB, Jhunjhunwala S, Heidenreich M, Xavier RJ, Langer R, Anderson DG, Hacohen N, Regev A, Feng GP, Sharp PA, Zhang F. CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell. 2014;159:440–55. https://doi.org/10.1016/j.cell.2014.09.014.
Inoue D, Kitaura J, Matsui H, Hou HA, Chou WC, Nagamachi A, Kawabata KC, Togami K, Nagase R, Horikawa S, Saika M, Micol JB, Hayashi Y, Harada Y, Harada H, Inaba T, Tien HF, Abdel-Wahab O, Kitamura T. SETBP1 mutations drive leukemic transformation in ASXL1-mutated MDS. Leukemia. 2015;29:847–57. https://doi.org/10.1038/leu.2014.301.
Saika M, Inoue D, Nagase R, Sato N, Tsuchiya A, Yabushita T, Kitamura T, Goyama S. ASXL1 and SETBP1 mutations promote leukaemogenesis by repressing TGF beta pathway genes through histone deacetylation. Sci Rep. 2018;8:15873. https://doi.org/10.1038/s41598-018-33881-2.
Morita S, Kojima T, Kitamura T. Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene Ther. 2000;7:1063–6. https://doi.org/10.1038/sj.gt.3301206.
Goyama S, Schibler J, Gasilina A, Shrestha M, Lin S, Link KA, Chen J, Whitman SP, Bloomfield CD, Nicolet D, Assi SA, Ptasinska A, Heidenreich O, Bonifer C, Kitamura T, Nassar NN, Mulloy JC. UBASH3B/Sts-1-CBL axis regulates myeloid proliferation in human preleukemia induced by AML1-ETO. Leukemia. 2016;30:728–39. https://doi.org/10.1038/leu.2015.275.
Stewart SA, Dykxhoorn DM, Palliser D, Mizuno H, Yu EY, An DS, Sabatini DM, Chen ISY, Hahn WC, Sharp PA, Weinberg RA, Novina CD. Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA. 2003;9:493–501. https://doi.org/10.1261/rna.2192803.
Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014;11:783–4. https://doi.org/10.1038/nmeth.3047.
Heck D, Kowalczyk MS, Yudovich D, Belizaire R, Puram RV, McConkey ME, Thielke A, Aster JC, Regev A, Ebert BL. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014;32:941–6. https://doi.org/10.1038/nbt.2951.
Morita K, Suzuki K, Maeda S, Matsuo A, Mitsuda Y, Tokushige C, Kashiwazaki G, Taniguchi J, Maeda R, Noura M, Hirata M, Kataoka T, Yano A, Yamada Y, Kiyose H, Tokumasu M, Matsuo H, Tanaka S, Okuno Y, Muto M, Naka K, Ito K, Kitamura T, Kaneda Y, Liu PP, Bando T, Adachi S, Sugiyama H, Kamikubo Y. Genetic regulation of the RUNX transcription factor family has antitumor effects. J Clin Investig. 2017;127:2815–28. https://doi.org/10.1172/jci91788.
Goyama S, Schibler J, Cunningham L, Zhang Y, Rao Y, Nishimoto N, Nakagawa M, Olsson A, Wunderlich M, Link KA, Mizukawa B, Grimes HL, Kurokawa M, Liu PP, Huang G, Mulloy JC. Transcription factor RUNX1 promotes survival of acute myeloid leukemia cells. J Clin Invest. 2013;123:3876–88. https://doi.org/10.1172/JCI68557.
Ben-Ami O, Friedman D, Leshkowitz D, Goldenberg D, Orlovsky K, Pencovich N, Lotem J, Tanay A, Groner Y. Addiction of t(8;21) and inv(16) acute myeloid leukemia to native RUNX1. Cell Rep. 2013;4:1131–43. https://doi.org/10.1016/j.celrep.2013.08.020.
Iida K, Tsuchiya A, Tamura M, Yamamoto K, Kawata S, Ishihara-Sugano M, Kato M, Kitamura T, Goyama S. RUNX1 inhibition using lipid nanoparticle-mediated silencing RNA delivery as an effective treatment for acute leukemias. Exp Hematol. 2022;112:2–8. https://doi.org/10.1016/j.exphem.2022.05.001.
Miyazaki M, Uoto K, Sugimoto Y, Naito H, Yoshida K, Okayama T, Kawato H, Kitagawa M, Seki T, Fukutake S, Aonuma M, Soga T. Discovery of DS-5272 as a promising candidate: a potent and orally active p53-MDM2 interaction inhibitor. Bioorg Med Chem. 2015;23:2360–7. https://doi.org/10.1016/j.bmc.2015.03.069.
Hayashi Y, Goyama S, Liu X, Tamura M, Asada S, Tanaka Y, Fukuyama T, Wunderlich M, O’Brien E, Mizukawa B, Yamazaki S, Matsumoto A, Yamasaki S, Shibata T, Matsuda K, Sashida G, Takizawa H, Kitamura T. Antitumor immunity augments the therapeutic effects of p53 activation on acute myeloid leukemia. Nat Commun. 2019;10:4869. https://doi.org/10.1038/s41467-019-12555-1.
Yabushita T, Chinen T, Nishiyama A, Asada S, Shimura R, Isobe T, Yamamoto K, Sato N, Enomoto Y, Tanaka Y, Fukuyama T, Satoh H, Kato K, Saitoh K, Ishikawa T, Soga T, Nannya Y, Fukagawa T, Nakanishi M, Kitagawa D, Kitamura T, Goyama S. Mitotic perturbation is a key mechanism of action of decitabine in myeloid tumor treatment. Cell Rep. 2023;42: 113098. https://doi.org/10.1016/j.celrep.2023.113098.
Inaba H, Pui CH. Glucocorticoid use in acute lymphoblastic leukaemia. Lancet Oncology. 2010;11:1096–106. https://doi.org/10.1016/s1470-2045(10)70114-5.
Tamura M, Yonezawa T, Liu XX, Asada S, Hayashi Y, Fukuyama T, Tanaka Y, Kitamura T, Goyama S. Opposing effects of acute versus chronic inhibition of p53 on decitabine’s efficacy in myeloid neoplasms. Sci Rep. 2019;9:8171. https://doi.org/10.1038/s41598-019-44496-6.
Goyama S, Huang G, Kurokawa M, Mulloy JC. Posttranslational modifications of RUNX1 as potential anticancer targets. Oncogene. 2014. https://doi.org/10.1038/onc.2014.305.
Morita K, Noura M, Tokushige C, Maeda S, Kiyose H, Kashiwazaki G, Taniguchi J, Bando T, Yoshida K, Ozaki T, Matsuo H, Ogawa S, Liu PP, Nakahata T, Sugiyama H, Adachi S, Kamikubo Y. Autonomous feedback loop of RUNX1-p53-CBFB in acute myeloid leukemia cells. Sci Rep. 2017;7:16604. https://doi.org/10.1038/s41598-017-16799-z.
Goyama S, Mulloy JC. Molecular pathogenesis of core binding factor leukemia: current knowledge and future prospects. Int J Hematol. 2011;94:126–33. https://doi.org/10.1007/s12185-011-0858-z.
Marcucci G, Geyer S, Laumann K, Zhao WQ, Bucci D, Uy GL, Blum W, Eisfeld AK, Pardee TS, Wang ES, Stock W, Kolitz JE, Kohlschmidt J, Mrózek K, Bloomfield CD, Stone RM, Larson RA. Combination of dasatinib with chemotherapy in previously untreated core binding factor acute myeloid leukemia: CALGB 10801. Blood Adv. 2020;4:696–705. https://doi.org/10.1182/bloodadvances.2019000492.
Lo MC, Peterson LF, Yan M, Cong X, Hickman JH, DeKelver RC, Niewerth D, Zhang DE. JAK inhibitors suppress t(8;21) fusion protein-induced leukemia. Leukemia. 2013;27:2272–9. https://doi.org/10.1038/leu.2013.197.
Yang G, Thompson MA, Brandt SJ, Hiebert SW. Histone deacetylase inhibitors induce the degradation of the t(8;21) fusion oncoprotein. Oncogene. 2007;26:91–101. https://doi.org/10.1038/sj.onc.1209760.
Lu LH, Wen YF, Yao Y, Chen FJ, Wang GH, Wu FR, Wu JY, Narayanan P, Redell M, Mo QX, Song YC. Glucocorticoids inhibit oncogenic RUNX1-ETO in acute myeloid leukemia with chromosome translocation t(8;21). Theranostics. 2018;8:2189–201. https://doi.org/10.7150/thno.22800.
Corsello SM, Roti G, Ross KN, Chow KT, Galinsky I, DeAngelo DJ, Stone RM, Kung AL, Golub TR, Stegmaier K. Identification of AML1-ETO modulators by chemical genomics. Blood. 2009;113:6193–205. https://doi.org/10.1182/blood-2008-07-166090.
Acknowledgements
We thank the Flow Cytometry Core and the Mouse Core at The Institute of Medical Science, The University of Tokyo. This work was supported by Grant-in-Aid for Scientific Research (B) (22H03100, SG), Grant-in-Aid for Scientific Research on Innovative Areas (Research in a proposed research area) (21H00274, SG), Research grant from The Japanese Society of Hematology (SG), AMED under Grant Number (22ck0106644s0202 and 23ama221514h0002, SG), JSPS KAKENHI Grant Number JP22K16319 (KY), AMED under Grant Number JP23ama221223 (KY) and Kobayashi Foundation for Cancer Research (KY).
Funding
Open Access funding provided by The University of Tokyo.
Author information
Authors and Affiliations
Contributions
W.Z. designed and performed experiments, analyzed the data, and wrote the paper. J.L. performed experiments, analyzed the data. K.Y. provided resources and advised on data interpretation. S.G. conceived the project, designed experiments, analyzed the data and wrote the paper.
Corresponding author
Ethics declarations
Conflict of interest
All authors declare no competing financial interests with the contents of this article.
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
This article is published under an open access license. Please check the 'Copyright Information' section either on this page or in the PDF for details of this license and what re-use is permitted. If your intended use exceeds what is permitted by the license or if you are unable to locate the licence and re-use information, please contact the Rights and Permissions team.
About this article
Cite this article
Zhang, W., Li, J., Yamamoto, K. et al. Modeling and therapeutic targeting of t(8;21) AML with/without TP53 deficiency. Int J Hematol (2024). https://doi.org/10.1007/s12185-024-03783-3
Received:
Revised:
Accepted:
Published:
DOI: https://doi.org/10.1007/s12185-024-03783-3