Skip to main content

Advertisement

SpringerLink
Log in

A 23-Nucleotide Deletion in STK11 Gene Causes Peutz–Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History

  • Original Article
  • Published:
Digestive Diseases and Sciences Aims and scope Submit manuscript

Abstract

Background and Aims

Peutz–Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies.

Methods and Results

We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426–448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain.

Conclusions

The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1
Fig. 2

Similar content being viewed by others

Abbreviations

AMPKα:

AMP-activated catalytic subunit alpha

DBE:

Double-balloon enteroscopy

dbSNP:

Database of single nucleotide polymorphisms

GI:

Gastrointestinal

HGMD:

Human Gene Mutation Database

OMIM:

Online Mendelian Inheritance in Man

PCR:

Polymerase chain reaction

PJS:

Peutz–Jeghers syndrome

STK11 :

Serine/threonine kinase 11

STRADα/β:

STE20-related kinase adaptor alpha/beta

References

  1. Giardiello FM, Brensinger JD, Tersmette AC, et al. Very high risk of cancer in familial Peutz–Jeghers syndrome. Gastroenterology. 2000;119:1447–1453.

    Article  CAS  PubMed  Google Scholar 

  2. Hearle N, Schumacher V, Menko FH, et al. Frequency and spectrum of cancers in the Peutz–Jeghers syndrome. Clin Cancer Res. 2006;12:3209–3215.

    Article  CAS  PubMed  Google Scholar 

  3. Giardiello FM, Trimbath JD. Peutz–Jeghers syndrome and management recommendations. Clin Gastroenterol Hepatol. 2006;4:408–415.

    Article  PubMed  Google Scholar 

  4. van Lier MG, Wagner A, Mathus-Vliegen EM, Kuipers EJ, Steyerberg EW, van Leerdam ME. High cancer risk in Peutz–Jeghers syndrome: a systematic review and surveillance recommendations. Am J Gastroenterol. 2010;105:1258–1264. (author reply 1265).

    Article  PubMed  Google Scholar 

  5. van Lier MG, Westerman AM, Wagner A, et al. High cancer risk and increased mortality in patients with Peutz–Jeghers syndrome. Gut. 2011;60:141–147.

    Article  PubMed  Google Scholar 

  6. Gao Y, Zhang FM, Huang S, et al. A De Novo mutation of STK11 gene in a Chinese patient with Peutz–Jeghers syndrome. Dig Dis Sci. 2010;55:1032–1036.

    Article  PubMed  Google Scholar 

  7. Peutz JL. Very remarkable case of familial polyposis of the mucous membrane of the intestinal tract and nasopharynx accompanied by peculiar pigmentation of the skin and mucous membrane. Ned Tijdschr Geneeskd. 1921;10:134–146.

    Google Scholar 

  8. Jeghers H, Mc KV, Katz KH. Generalized intestinal polyposis and melanin spots of the oral mucosa, lips and digits: a syndrome of diagnostic significance. N Engl J Med. 1949;241:993. (illust; passim).

    Article  CAS  PubMed  Google Scholar 

  9. Jenne DE, Reimann H, Nezu J, et al. Peutz–Jeghers syndrome is caused by mutations in a novel serine threonine kinase. Nat Genet. 1998;18:38–43.

    Article  CAS  PubMed  Google Scholar 

  10. Hemminki A, Tomlinson I, Markie D, et al. Localization of a susceptibility locus for Peutz–Jeghers syndrome to 19p using comparative genomic hybridization and targeted linkage analysis. Nat Genet. 1997;15:87–90.

    Article  CAS  PubMed  Google Scholar 

  11. Buchet-Poyau K, Mehenni H, Radhakrishna U, Antonarakis SE. Search for the second Peutz–Jeghers syndrome locus: exclusion of the STK13, PRKCG, KLK10, and PSCD2 genes on chromosome 19 and the STK11IP gene on chromosome 2. Cytogenet Genome Res. 2002;97:171–178.

    Article  CAS  PubMed  Google Scholar 

  12. Wang ZJ, Churchman M, Avizienyte E, et al. Germline mutations of the LKB1 (STK11) gene in Peutz–Jeghers patients. J Med Genet. 1999;36:365–368.

    CAS  PubMed  PubMed Central  Google Scholar 

  13. Giardiello FM, Welsh SB, Hamilton SR, et al. Increased risk of cancer in the Peutz–Jeghers syndrome. N Engl J Med. 1987;316:1511–1514.

    Article  CAS  PubMed  Google Scholar 

  14. Biasini M, Bienert S, Waterhouse A, et al. SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information. Nucleic Acids Res. 2014;42:W252–W258.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Hanks SK, Quinn AM, Hunter T. The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science. 1988;241:42–52.

    Article  CAS  PubMed  Google Scholar 

  16. Stenson PD, Mort M, Ball EV, et al. The Human Gene Mutation Database: towards a comprehensive repository of inherited mutation data for medical research, genetic diagnosis and next-generation sequencing studies. Hum Genet. 2017;136:665–677.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Boudeau J, Baas AF, Deak M, et al. MO25alpha/beta interact with STRADalpha/beta enhancing their ability to bind, activate and localize LKB1 in the cytoplasm. EMBO J. 2003;22:5102–5114.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Korsse SE, Peppelenbosch MP, van Veelen W. Targeting LKB1 signaling in cancer. Biochem Biophys Acta. 2013;1835:194–210.

    CAS  PubMed  Google Scholar 

  19. Forcet C, Etienne-Manneville S, Gaude H, et al. Functional analysis of Peutz–Jeghers mutations reveals that the LKB1 C-terminal region exerts a crucial role in regulating both the AMPK pathway and the cell polarity. Hum Mol Genet. 2005;14:1283–1292.

    Article  CAS  PubMed  Google Scholar 

  20. Baas AF, Kuipers J, van der Wel NN, et al. Complete polarization of single intestinal epithelial cells upon activation of LKB1 by STRAD. Cell. 2004;116:457–466.

    Article  CAS  PubMed  Google Scholar 

  21. Shaw RJ, Kosmatka M, Bardeesy N, et al. The tumor suppressor LKB1 kinase directly activates AMP-activated kinase and regulates apoptosis in response to energy stress. Proc Natl Acad Sci USA. 2004;101:3329–3335.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Mehenni H, Gehrig C, Nezu J, et al. Loss of LKB1 kinase activity in Peutz–Jeghers syndrome, and evidence for allelic and locus heterogeneity. Am J Hum Genet. 1998;63:1641–1650.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Liu L, Du X, Nie J. A novel de novo mutation in LKB1 gene in a Chinese Peutz Jeghers syndrome patient significantly diminished p53 activity. Clin Res Hepatol Gastroenterol. 2011;35:221–226.

    Article  CAS  PubMed  Google Scholar 

  24. Korsse SE, Biermann K, Offerhaus GJ, et al. Identification of molecular alterations in gastrointestinal carcinomas and dysplastic hamartomas in Peutz–Jeghers syndrome. Carcinogenesis. 2013;34:1611–1619.

    Article  CAS  PubMed  Google Scholar 

  25. Wei C, Amos CI, Stephens LC, et al. Mutation of Lkb1 and p53 genes exert a cooperative effect on tumorigenesis. Can Res. 2005;65:11297–11303.

    Article  CAS  Google Scholar 

  26. van Lier MG, Mathus-Vliegen EM, Wagner A, van Leerdam ME, Kuipers EJ. High cumulative risk of intussusception in patients with Peutz–Jeghers syndrome: time to update surveillance guidelines? Am J Gastroenterol. 2011;106:940–945.

    Article  PubMed  Google Scholar 

  27. Beggs AD, Latchford AR, Vasen HF, et al. Peutz–Jeghers syndrome: a systematic review and recommendations for management. Gut. 2010;59:975–986.

    Article  CAS  PubMed  Google Scholar 

  28. Ohmiya N, Taguchi A, Shirai K, et al. Endoscopic resection of Peutz–Jeghers polyps throughout the small intestine at double-balloon enteroscopy without laparotomy. Gastrointest Endosc. 2005;61:140–147.

    Article  PubMed  Google Scholar 

  29. May A, Nachbar L, Ell C. Double-balloon enteroscopy (push-and-pull enteroscopy) of the small bowel: feasibility and diagnostic and therapeutic yield in patients with suspected small bowel disease. Gastrointest Endosc. 2005;62:62–70.

    Article  PubMed  Google Scholar 

  30. Burke CA, Santisi J, Church J, Levinthal G. The utility of capsule endoscopy small bowel surveillance in patients with polyposis. Am J Gastroenterol. 2005;100:1498–1502.

    Article  PubMed  Google Scholar 

  31. Parsi MA, Burke CA. Utility of capsule endoscopy in Peutz–Jeghers syndrome. Gastrointest Endosc Clin N Am. 2004;14:159–167.

    Article  PubMed  Google Scholar 

  32. Zhang ZC, Li BR, Li X, et al. Location, growth and clinical outcome of polyps of patients with Peutz–Jeghers syndrome. Chin J Dig. 2016;36:593.

    Google Scholar 

Download references

Acknowledgments

This work was supported by Application Research of Capital Clinical Character (Z151100004015215), Annual Project of Air Force General Hospital (KZ2015026 and KZ2016021) and National Natural Science Foundation of China (81500490). The Authors thank the subjects for their participation.

Author information

Author notes

  1. Zi-Ye Zhao and Yu-Liang Jiang have contributed equally to this work.

Authors and Affiliations

  1. Department of Medical Genetics, Naval Medical University, 800 Xiangyin Rd., Shanghai, 200433, China

    Zi-Ye Zhao, Fu Yang & Shu-Han Sun

  2. Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd., Beijing, 100142, China

    Yu-Liang Jiang, Bai-Rong Li, Jing Li, Xiao-Wei Jin & Shou-Bin Ning

Authors
  1. Zi-Ye Zhao
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yu-Liang Jiang
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Bai-Rong Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Fu Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Jing Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Xiao-Wei Jin
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Shou-Bin Ning
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Shu-Han Sun
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding authors

Correspondence to Shou-Bin Ning or Shu-Han Sun.

Ethics declarations

Conflict of interest

None.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary material 1 (TIFF 23806 kb)

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Zhao, ZY., Jiang, YL., Li, BR. et al. A 23-Nucleotide Deletion in STK11 Gene Causes Peutz–Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History. Dig Dis Sci 62, 3014–3020 (2017). https://doi.org/10.1007/s10620-017-4741-5

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s10620-017-4741-5

Keywords

Search

Navigation