Skip to main content

Advertisement

SpringerLink
Log in

Oxidative stress promotes myocardial fibrosis by upregulating KCa3.1 channel expression in AGT-REN double transgenic hypertensive mice

  • Ion channels, receptors and transporters
  • Published:
Pflügers Archiv - European Journal of Physiology Aims and scope Submit manuscript

Abstract

The intermediate-conductance Ca2+-activated K+ (KCa3.1) channels play a pivotal role in the cardiac fibroblast proliferation and inflammatory reaction during the progression of myocardial fibrosis. However, the relationship between KCa3.1 expression and oxidative stress, the important factor of promoting fibrosis, has not been clearly established. This study was designed to investigate whether the role of oxidative stress in promoting myocardial fibrosis is related to KCa3.1 channel by using biochemical approaches. It was found that mean blood pressure, plasma Ang II level, and myocardium malondialdehyde (MDA) content of angiotensinogen-renin (AGT-REN) double transgenic hypertension (dTH) mice were higher than those in wild-type (WT) mice of the same age (4, 8 and 12 months) and were significantly increased with age. However, plasma Ang (1–7) level and myocardium superoxide dismutase (SOD) activity showed a downward trend and were lower than those of the same-aged WT mice (4, 8 and 12 months). In addition, protein expression of myocardium KCa3.1 channel in 4-, 8-, and 12-month-old dTH mice were significantly higher than that of the same-aged WT mice and gradually increased with age. TRAM-34, a blocker of KCa3.1 channel, and losartan mitigated the myocardial structural and functional damage by inhibiting collagen deposition and decreasing the expression of β-MHC. After intervention of ROS scavenger N-acetyl cysteine (NAC) and NADPH inhibitor apocynin (Apo) in 6-month-old dTH mice for 4 weeks, myocardial oxidative stress level was reduced and KCa3.1 channel protein expression was decreased. Meanwhile, Apo inhibited the myocardium p-ERK1/2/T-ERK protein expression in dTH mice, and after blockage of ERK1/2 pathway with PD98059, the KCa3.1 protein expression was reduced. These results demonstrate for the first time that KCa3.1 channel is likely to be a critical target on the oxidative stress for its promoting role in myocardial fibrosis, and the ERK1/2 pathway may be involved in the regulation of oxidative stress to KCa3.1.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1
Fig. 2
Fig. 3
Fig. 4
Fig. 5

Similar content being viewed by others

References

  1. Adebiyi OA, Adebiyi OO, Owira PM (2016) Naringin reduces hyperglycemia-induced cardiac fibrosis by relieving oxidative stress. PLoS One 11(3):e0149890

    Article  PubMed  PubMed Central  Google Scholar 

  2. Albaqumi M, Srivastava S, Li Z, Zhdnova O, Wulff H, Itani O, Wallace DP, Skolnik EY (2008) KCa3.1 potassium channels are critical for cAMP dependent chloride secretion and cyst growth in autosomal-dominant polycystic kidney disease. Kidney Int 74(6):740–749

    Article  CAS  PubMed  Google Scholar 

  3. Asbun J, Villarreal FJ (2006) The pathogenesis of myocardial fibrosis in the setting of diabetic cardiomyopathy. J Am Coll Cardiol 47(4):693–700

    Article  CAS  PubMed  Google Scholar 

  4. Choi S, Kim JA, Na HY, Kim JE, Park S, Han KH, Kim YJ, Suh SH (2013) NADPH oxidase 2-derived superoxide downregulates endothelial KCa3.1 in preeclampsia. Free Radic Biol Med 57:10–21

    Article  CAS  PubMed  Google Scholar 

  5. Crosas-Molist E, Bertran E, Sancho P, López-Luque J, Fernando J, Sánchez A, Fernández M, Navarro E, Fabregat I (2014) The NADPH oxidase NOX4 inhibits hepatocyte proliferation and liver cancer progression. Free Radic Biol Med 69:338–347

    Article  CAS  PubMed  Google Scholar 

  6. Díez J (2007) Mechanisms of cardiac fibrosis in hypertension. The Journal of Clinical Hypertension 9(7):546–550

    Article  PubMed  Google Scholar 

  7. Freise C, Heldwein S, Erben U, Hoyer J, Köhler R, Jöhrens K, Patsenker E, Ruehl M, Seehofer D, Stickel F, Somasundaram R (2015) K+-channel inhibition reduces portal perfusion pressure in fibrotic rats and fibrosis associated characteristics of hepatic stellate cells. Liver Int 35(4):1244–1252

    Article  CAS  PubMed  Google Scholar 

  8. Fu RG, Zhang T, Wang L, Du Y, Jia LN, Hou JJ, Yao GL, Liu XD, Zhang L, Chen L, Gui BS, Xue RL (2014) Inhibition of the K(+) channel KCa3.1 reduces TGF-β1-induced premature senescence, myofibroblast phenotype transition and proliferation of mesangial cells. PLoS One 9(1):e87410

    Article  PubMed  PubMed Central  Google Scholar 

  9. Huang C, Shen S, Ma Q, Chen J, Gill A, Pollock CA, Chen XM (2013) Blockade of KCa3.1 ameliorates renal fibrosis through the TGF-β1/Smad pathway in diabetic mice. Diabetes 62(8):2923–2934

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Huang C, Shen S, Ma Q, Gill A, Pollock CA, Chen XM (2014) KCa3.1 mediates activation of fibroblasts in diabetic renal interstitial fibrosis. Nephrol Dial Transplant 29(2):313–324

    Article  CAS  PubMed  Google Scholar 

  11. Huang C, Lin MZ, Cheng D, Braet F, Pollock CA, Chen XM (2016) KCa3.1 mediates dysfunction of tubular autophagy in diabetic kidneys via PI3k/Akt/mTOR signaling pathways. Sci Rep 6:23884

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Ju CH, Wang XP, Gao CY, Zhang SX, Ma XH, Liu C (2015) Blockade of KCa3.1 attenuates left ventricular remodeling after experimental myocardial infarction. Cell Physiol Biochem 36(4):1305–1315

    Article  CAS  PubMed  Google Scholar 

  13. Kimura S, Mullins JJ, Bunnemann B, Metzger R, Hilgenfeldt U, Zimmermann F, Jacob H, Fuxe K, Ganten D, Kaling M (1992) High blood pressure in transgenic mice carrying the rat angiotensinogen gene. EMBOJ 11(3):821–827

    CAS  Google Scholar 

  14. Köhler R, Oliván-Viguera A, Wulff H (2016) Endothelial small- and intermediate-conductance K channels and endothelium-dependent hyperpolarization as drug targets in cardiovascular disease. Adv Pharmacol 77:65–104

    Article  PubMed  Google Scholar 

  15. Lijnen PJ, van Pelt JF, Fagard RH (2012) Stimulation of reactive oxygen species and collagen synthesis by angiotensin II in cardiac fibroblasts. Cardiovasc Ther 30(1):e1–e8

    Article  CAS  PubMed  Google Scholar 

  16. Liu XH, Pan LL, Deng HY, Xiong QH, Wu D, Huang GY, Gong QH, Zhu YZ (2013) Leonurine (SCM-198) attenuates myocardial fibrotic response via inhibition of NADPH oxidase 4. Int J Cardiol 168(4):3770–3778

    Article  PubMed  Google Scholar 

  17. Maki S, Miyauchi T, Sakai S, Kobayashi T, Maeda S, Takata Y, Sugiyama F, Fukamizu A, Murakami K, Goto K, Sugishita Y (1998) Endothelin-1 expression in hearts of transgenic hypertensive mice overexpressing angiotensin II. J Cardiovasc Pharmacol 31:S412–S416

    Article  CAS  PubMed  Google Scholar 

  18. Ogata T, Miyauchi T, Sakai S, Takanashi M, Irukayama-Tomobe Y, Yamaguchi I (2004) Myocardial fibrosis and diastolic dysfunction in deoxycorticosterone acetate-salt hypertensive rats is ameliorated by the peroxisome proliferator-activated receptor-alpha activator fenofibrate, partly by suppressing inflammatory responses associated with the nuclear factor-kappa-b pathway. J Am Coll Cardiol 43(8):1481–1488

    Article  CAS  PubMed  Google Scholar 

  19. Pan LL, Liu XH, Shen YQ, Wang NZ, Xu J, Wu D, Xiong QH, Deng HY, Huang GY, Zhu YZ (2012) Inhibition of NADPH oxidase 4-related signaling by sodium hydrosulfide attenuates myocardial fibrotic response. Molecules 17(3):2738–2751

    Google Scholar 

  20. Pan LL, Liu XH, Shen YQ, Wang NZ, Xu J, Wu D, Xiong QH, Deng HY, Huang GY, Zhu YZ (2013) Inhibition of NADPH oxidase 4-related signaling by sodium hydrosulfide attenuates myocardial fibrotic response. Int J Cardiol 168(4):3770–3778

    Article  PubMed  Google Scholar 

  21. Papaharalambus CA, Griendling KK (2007) Basic mechanisms of oxidative stress and reactive oxygen species in cardiovascular injury. Trends Cardiovasc med 17(2):48–54

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Pitt B, Zannad F (2012) The detection of myocardial fibrosis: an opportunity to reduce cardiovascular risk in patients with diabetes mellitus? Circulation: Cardiovascular Imaging 5(1):9–11

    Google Scholar 

  23. Privratsky JR, Wold LE, Sowers JR, Quinn MT, Ren J (2003) AT1 blockade prevents glucose-induced cardiac dysfunction in ventricular myocytes: role of the AT1 receptor and NADPH oxidase. Hypertension 42(2):206–212

    Article  CAS  PubMed  Google Scholar 

  24. Roach KM, Duffy SM, Coward W, Feghali-Bostwick C, Wulff H, Bradding P (2013) The K+ channel KCa3.1 as a novel target for idiopathic pulmonary fibrosis. PLoS One 8(12):e85244

    Article  PubMed  PubMed Central  Google Scholar 

  25. Roach KM, Wulff H, Feghali-Bostwick C, Amrani Y, Bradding P (2014) Increased constitutive αSMA and Smad2/3 expression in idiopathic pulmonary fibrosis myofibroblasts is KCa3.1-dependent. Respir Res 15:155

    Article  PubMed  PubMed Central  Google Scholar 

  26. Roach KM, Feghali-Bostwick C, Wulff H, Amrani Y, Bradding P (2015) Fibrogenesis tissue repair. Human lung myofibroblast TGFβ1-dependent Smad2/3 signalling is Ca(2+)-dependent and regulated by KCa3.1K(+) channels. Fibrogenesis Tissue Repair 8:5

    Article  PubMed  PubMed Central  Google Scholar 

  27. Sevelsted Møller L, Fialla AD, Schierwagen R, Biagini M, Liedtke C, Laleman W, Klein S, Reul W, Koch Hansen L, Rabjerg M, Singh V, Surra J, Osada J, Reinehr R, de Muckadell OB, Köhler R, Trebicka J (2016) The calcium-activated potassium channel KCa3.1 is an important modulator of hepatic injury. Sci Rep 6:28770

    Article  PubMed  PubMed Central  Google Scholar 

  28. Sherrod M, Davis DR, Zhou X, Cassell MD, Sigmund CD (2005) Glial-specific ablation of angiotensinogen lowers arterial pressure in renin and angiotensinogen transgenic mice. Am J Physiol Regul Integr Comp Physiol 289(6):R1763–R1769

    Article  CAS  PubMed  Google Scholar 

  29. Somanna NK, Valente AJ, Krenz M, Fay WP, Delafontaine P, Chandrasekar B (2016) The Nox1/4 dual inhibitor GKT137831 or Nox4 knockdown inhibits angiotensin-II-induced adult mouse cardiac fibroblast proliferation and migration. AT1 physically associates with Nox4. J Cell Physiol 231(5):1130–1141

    Article  CAS  PubMed  Google Scholar 

  30. Tordjman KM, Semenkovich CF, Coleman T, Yudovich R, Bak S, Osher E, Vechoropoulos M, Stern N (2007) Absence of peroxisome proliferator-activated receptor-abolishes hypertension and attenuates atherosclerosis inthe Tsukuba hypertensive mouse. Hypertension 50(5):945–951

    Article  CAS  PubMed  Google Scholar 

  31. Touyz RM, Briones AM (2011) Reactive oxygen species and vascular biology: implications in human hypertension. Hypertens Res 34:5–14

    Article  CAS  PubMed  Google Scholar 

  32. Tsutsui H, Kinugawa S, Matsushima S (2011) Oxidative stress and heart failure. Am J Physiol Heart Circ Physiol 301(6):H2181–H2190

    Article  CAS  PubMed  Google Scholar 

  33. Wam NC, CroR KD (2006) Hypertension and oxidative stress. ClinicalExperimental Pharmacology Physiology 33(9):872–876

    Article  Google Scholar 

  34. Wang LP, Wang Y, Zhao LM, Li GR, Deng XL (2013) Angiotensin II upregulates KCa3.1 channels and stimulates cell proliferation in rat cardiac fibroblasts. Biochem Pharmacol 85(10):1486–1494

    Article  CAS  PubMed  Google Scholar 

  35. Wang J, Hong Z, Zeng C, Yu Q, Wang H (2014) NADPH oxidase 4 promotes cardiac microvascular angiogenesis after hypoxia/reoxygenation in vitro. Free Radic Biol Med 69:278–288

    Article  CAS  PubMed  Google Scholar 

  36. Yang CM, Lee IT, Hsu RC, Chi PL, Hsiao LD (2013) NADPH oxidase/ROS-dependent PYK2 activation is invol ved in TNF-α-induced matrix metalloproteinase-9 expression in rat heart-derived H9c2 cells. Toxicol Appl Pharmacol 272(2):431–442

    Article  CAS  PubMed  Google Scholar 

  37. Yu M, Zheng Y, Sun HX, Yu DJ (2012) Inhibitory effects of enalaprilat on rat cardiac fibroblast proliferation via ROS/P38MAPK/TGF-β1 signaling pathway. Molecules 17(3):2738–2751

    Article  CAS  PubMed  Google Scholar 

  38. Zhao W, Zhao D, Yan R, Sun Y (2009) Cardiac oxidative stress and remodeling following infarction: role of NADPH oxidase. Cardiovasc Pathol 18(3):156–166

    Article  CAS  PubMed  Google Scholar 

  39. Zhao LM, Zhang W, Wang LP, Li GR, Deng XL (2012) Advanced glycation end products promote proliferation of cardiac fibroblasts by upregulation of KCa3.1 channels. Pflug Arch 464(6):613–621

    Article  CAS  Google Scholar 

  40. Zhao LM, Wang LP, Wang HF, Ma XZ, Zhou DX, Deng XL (2015) The role of KCa3.1 channels in cardiac fibrosis induced by pressure overload in rats. Pfluger Arch 467:2275–2285

    Article  CAS  Google Scholar 

  41. Zhuang Y, Feng Q, Ding G, Zhao M, Che R, Bai M, Bao H, Zhang A, Huang S (2014) Activation of ERK1/2 by NADPH oxidase-originated reactive oxygen species mediates uric acid-induced mesangial cell proliferation. Am J Physiol Renal Physiol 307(4):F396–F406

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgments

The work was supported by National Natural Science Foundation of China (grant nos. 81600316 and 81372029) and the Natural Science Foundation of Hebei Province (grant no. H2015209153).

Author information

Authors and Affiliations

  1. Department of Physiology, School of Basic Medical Science, North China University of Science and Technology, No. 57, Jianshe South Road, Tangshan, 063000, Hebei Province, People’s Republic of China

    Li-Ping Wang, Su-Jing Fan, Shu-Min Li, Xiao-Jun Wang & Xiu-Hong Yang

  2. Tangshan Key Laboratory for Preclinical and Basic Research on Chronic Diseases, North China University of Science and Technology, Tangshan, Hebei Province, People’s Republic of China

    Li-Ping Wang, Su-Jing Fan, Shu-Min Li, Xiao-Jun Wang, Jun-Ling Gao & Xiu-Hong Yang

Authors
  1. Li-Ping Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Su-Jing Fan
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Shu-Min Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Xiao-Jun Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Jun-Ling Gao
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Xiu-Hong Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Xiu-Hong Yang.

Ethics declarations

Experimental protocols were approved by the Institutional Animal Care and Use Committee of North China University of Science and Technology and conformed to the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health, USA.

Conflict of interest

The authors declare that they have no conflict of interest.

Additional information

Ion channels, receptors, and transporters

Electronic supplementary material

Fig. S1

The PCR result of AGT-REN double transgenic hypertensive mice. 10–14 days after birth, postnatal mice underwent toe-clipping for numbering and clipping of the tip of tail for identification. Primer sequence: AGT (441 bp) L: CACCCCAGAGCACCATTACT; R: TGGAGCTGTAGCGTGTCATC. REN (545 bp) L: AACCACTGCTTCACCACCG; R: CACACTACCCTTTCCTTCCTACATC. Results are shown in S1 Fig; water was used as the blank control, WT as the negative control, 1–9 were AGT-REN double transgenic hypertensive mice and 10 as the positive control of AGT and REN, respectively. (GIF 60 kb)

High Resolution image (TIFF 13227 kb)

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Wang, LP., Fan, SJ., Li, SM. et al. Oxidative stress promotes myocardial fibrosis by upregulating KCa3.1 channel expression in AGT-REN double transgenic hypertensive mice. Pflugers Arch - Eur J Physiol 469, 1061–1071 (2017). https://doi.org/10.1007/s00424-017-1984-0

Download citation

  • Received:

  • Revised:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s00424-017-1984-0

Keywords

Search

Navigation