Erratum to: Genetic Dissection of Mycobacterial Biofilms

The online version of the updated chapter can be found at http://dx.doi.org/10.1007/978-1-4939-2450-9_12

These keywords were added by machine and not by the authors. This process is experimental and the keywords may be updated as the learning algorithm improves.

The publisher regrets the error published in chapter 12, in the print and online versions of this book. The corrections are given below.

The following changes have been updated in the book.

Chapter 12, page 218

In Section 2.3 “Mapping Transponson Insertion Sites in Biofilm-Defective Mutants”

Primer 4, should be:

“CGCCTTCTTGACGAGTTCTTCTGA”.

(it is currently a copy of Primer 3)

Page 222

Section 3.3 “Mapping Transposon Insertion Sites in Biofilm-Defective Mutants”

Step 3: First PCR: Replace “34.5 uL of H₂O₂” with “ 34.5 uL of H₂O”

Section 3.3

Step 3: Second PCR: Replace “39.5 H₂O₂” with “37.5 uL of H₂O”.