Conservation Genetics Resources

, Volume 3, Issue 3, pp 553–555

Characterization of 13 microsatellite loci for the tope shark, Galeorhinus galeus, discovered with next-generation sequencing and their utility for eastern Pacific smooth-hound sharks (Mustelus)

Open Access
Technical Note

DOI: 10.1007/s12686-011-9402-y

Cite this article as:
Chabot, C.L. & Nigenda, S. Conservation Genet Resour (2011) 3: 553. doi:10.1007/s12686-011-9402-y

Abstract

The tope shark, Galeorhinus galeus, is a commercially important member of the Triakidae that has been exploited globally for the past 80 years. Here we describe 13 microsatellite loci for G. galeus discovered by next-generation sequencing (Roche 454 pyrosequencing) and their utility for eastern Pacific smooth-hound sharks (Mustelus). These loci were polymorphic (3–12 alleles) with observed heterozygosity between 0.11 and 0.86 and expected heterozygosity between 0.24 and 0.87. Several loci (7 of 13) amplified consistently for Mustelus californicus and M. henlei. These loci are the first to be characterized explicitly for G. galeus and should be useful in the investigation of population structure of this vulnerable elasmobranch.

Keywords

Galeorhinus galeus Microsatellite Mustelus californicus Mustelus henlei Triakidae 

The tope shark, Galeorhinus galeus (Triakidae), has been commercially exploited for greater than 80 years with populations demonstrating historic collapses (Ebert 2001). Continued exploitation of the species has resulted in a classification of vulnerable by the IUCN (Walker et al. 2006) and a need to determine the connectivity of globally distributed individuals in order to generate conservation strategies. Nuclear microsatellites have been used to reveal patterns of population connectivity in numerous taxa. Therefore, we have set out to generate a library of microsatellite markers for G. galeus using next-generation sequencing technology (Roche 454 pyrosequencing) in order to elucidate the patterns of population structure and gene flow in G. galeus.

DNA used for the generation of the microsatellite library was extracted from the fin clip of an Australian sample using the DNeasy blood and tissue extraction kit (Qiagen, Valencia, USA) following the manufacturer’s protocols. 500 ng of DNA was prepared for whole genome shotgun sequencing on the Roche Genome Sequencer FLX instrument utilizing the GS FLX Titanium Rapid Library Preparation Kit (Roche Applied Sciences, Indianapolis, USA) following the manufacturer’s protocol. The library was quantified for DNA fragment size distribution and concentration (Agilent 2100 Bioanalyzer) and then processed with the GS FLX emulsion polymerase chain reaction (PCR) and sequencing kits. Sequencing was performed using 1/16th of a picotiterplate and yielded 40,156 sequences.

The sequences were screened for potential microsatellite loci by MSATCOMMANDER (Faircloth 2008) under the default settings. Of the 40,156 sequences, 1,344 contained putative microsatellite loci. Similar to a previous study of the Australian gummy shark (Boomer and Stow 2010), the majority of microsatellite motifs identified were dinucleotide in nature (~80%). Primers for dinucleotide (minimum repeat number (mrn) = 8), tetranucleotide (mrn = 4), and pentanucleotide (mrn = 4) loci were designed by the PRIMER3 software (Rozen and Skaletsky 2000) embedded in MSATCOMMANDER using the default settings. In total, 32 primer pairs were used for amplification trials consisting of 18 dinucleotide, 11 tetranucleotide, and 2 pentanucleotide loci. For all loci, the forward primer was synthesized with an M13F(-20) sequence (GTAAAACGACGGCCAG) added to the 5′ end to incorporate a 5′ fluorescent label per the technique of (Boutin-Ganache et al. 2001). Initially, eight samples from four subpopulations (2 samples per population: North America (California), South Africa, Australia (Australian Bight and Tasmania), and the U.K. (Irish Sea)) were used to test amplification of loci and evaluate polymorphic content. The PCR protocol was as follows: A 10 μL touchdown PCR was performed using an Eppendorf Mastercycler epgradient S thermal cycler and the following reaction conditions: 10–100 ng template DNA, 0.2 μM reverse primer, 0.01 μM forward primer, 0.01 μM dye labeled M13 primer, 0.4 mg/mL BSA, and 5.0 μL of Qiagen Multiplex Mastermix (Qiagen, Valencia, USA). Initial denaturation was at 95°C for 15 min followed by 25 cycles of denaturation (94°C for 30 s), annealing (59°C for 90 s), extension (72°C for 60 s) and another 20 cycles of denaturation (94°C for 30 s), annealing (53°C for 90 s), extension (72°C for 60 s), and terminating with a final extension (60°C for 30 min). All PCR products were then electrophoresed on an Applied Biosystems (ABI) 3730xl DNA Analyzer. Allele sizes were determined by using an internal lane standard LIZ 500 (ABI) and GeneMapper® 3.7 (ABI). Out of the 32 primer pairs tested, 13 were successfully amplified by PCR and further characterized using additional samples from the Australian Bight and Tasmania (n = 28). In order to validate the dataset, 30% of our samples were reanalyzed at all loci producing identical genotypes between reads.

MICROCHECKER (Van Oosterhout et al. 2003) was used to investigate the existence of null alleles, large allele dropout, and stuttering. With the exception of Gg2, Gg17, Gg18, and Gg22, all loci demonstrated a lack of null alleles. GENEPOP 4.0 (Raymond and Rousset 1995; Rousset 2008) was used to estimate allele frequencies, observed heterozygosity (HO) and expected heterozygosity (HE), and determine departures from Hardy–Weinberg equilibrium (HWE). All 13 loci of G. galeus were polymorphic (3–12 alleles). HO and HE were 0.11–0.86 and 0.24–0.87 respectively (Table 1) and after Bonferroni correction all loci were in HWE with the exception of Gg4 and Gg17. FSTAT 2.9.4 (Goudet 2003) was used to test for linkage disequilibrium and estimate FIS. All loci were in linkage equilibrium and FIS ranged between −0.132 and 0.721 (Table 1).
Table 1

Characteristics of 13 microsatellite loci for Galeorhinus galeus

Locus

Forward primer 5′–3′

Reverse primer 5′–3′

Motif

N

Size (bp)

A

HO

HE

FIS

Gg2

TGGCTCAGTCCAGAAACCC

CCCTATTCGAGAGGCCCAG

(TG)n

29

249–259

6

0.30

0.55

0.336

Gg3

CCGTGACTGAAAGCAGCC

CCCTCAACCATGGCAAGTG

(GATT)n

28

257–265

4

0.43

0.46

0.128

Gg4

CTGGAATACATGCCGAGCAC

CCCGAAAGGTCTTAGTTCGC

(GA)n

29

179–213

3

0

0

NA

Gg7

CTGTGGAACCAAACTCCAGC

AGCTGGTCGAGGTGAATGC

(AG)n

29

296–312

5

0.48

0.51

0.060

Gg11

AAGTTGCACGTTTCCCAGC

TACTGCAGGACCGGTTTCC

(TCCC)n

28

329–363

8

0.68

0.60

−0.132

Gg12

TGTCAAACACCATCGCAGG

TGCTCTGAAGTCTACAAGAATGG

(TA)n

25

276–296

11

0.70

0.72

0.024

Gg15

GGCTGAATGGTTTCCCAGC

GCCTCCAACTTAGCATAGCC

(GA)n

27

147–169

12

0.85

0.87

0.027

Gg16

AGTGTGGTCTCACCAATGC

TGGAAGGGTAAGGAAATTGGC

(GA)n

27

174–182

3

0.41

0.43

0.047

Gg17

CCTGCTTGTGACAGTTACCC

ACAGGCATCACCTCTGTGC

(AC)n

27

159–181

5

0.15

0.52

0.721

Gg18

TCCACTTCAGGAAGGCCAG

CAAAGCCAGGTGGTTCTCC

(GA)n

28

179–187

4

0.11

0.31

0.661

Gg20

GACCAAGGGTCATCCAGAC

TCAGCTTGGGCAATTCCAG

(TC)n

29

194–202

3

0.21

0.24

0.147

Gg22

TCCTGGGATGGCAACTTCG

AGGCCACCCAACTATCCTG

(GT)n

30

237–247

7

0.63

0.82

0.229

Gg23

ACAGACCACAGGGCATGG

TGCAGAGCAGGCTAGATGG

(AC)n

28

258–278

9

0.86

0.83

−0.029

N number of Australian samples, Size based on all samples, A number of alleles, HO observed heterozygosity for Australian samples, HE expected heterozygosity for Australian samples

To determine the utility of these markers for genotyping species of eastern Pacific smooth-hound sharks (Mustelus), we tested the 13 loci on Mustelus californicus and M. henlei using the PCR reactions and analyses described above. Seven of the loci successfully amplified for both species and two loci produced stutter products (Table 2). The development of these 13 microsatellite loci from G. galeus using next-generation sequencing technology, along with those of Boomer and Stow (2010), should aid in the elucidation of gene flow within species of the Triakidae and provide valuable tools for the conservation of threatened and data deficient shark species.
Table 2

PCR results of the 13 loci for Mustelus californicus and M. henlei

 

Gg2

Gg3

Gg4

Gg7

Gg11

Gg12

Gg15

Gg16

Gg17

Gg18

Gg20

Gg22

Gg23

Mustelus californicus

S

0

+

+

+

0

0

+

+

+

+

S

0

Mustelus henlei

S

+

+

+

+

0

0

+

+

+

+

+

0

Successful PCRs indicated by +, stutter products by S, and failed reactions by 0

Acknowledgments

We would like to thank John Pollinger for the preparation of the 454 library and Robert K. Wayne for laboratory equipment and reagents. Funding was provided by the Southern California Academy of Sciences and the U.S. Department of Education (GAANN Fellowship).

Open Access

This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

Copyright information

© The Author(s) 2011

Authors and Affiliations

  1. 1.Department of Ecology and Evolutionary BiologyUniversity of CaliforniaLos AngelesUSA

Personalised recommendations